Exosome containing TERT mRNA and preparation method and application thereof
By overexpressing the TERT gene in human mesenchymal stem cells to generate exosomes, the carcinogenic risk and uneven delivery problems of systemic telomeres prolongation in the prior art are solved, and a systemic, safe and efficient telomeres prolongation effect is achieved.
Patent Information
- Application Number
- CN202510566630.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art has problems such as carcinogenic risk, uneven delivery, short-term effect or tissue-specific limitation in the extension of systemic telomeres. It is urgent to develop a systemic telomere extension strategy that is efficient, controllable and significantly improved in safety.
Through genetic engineering technology, the TERT gene is overexpressed in human mesenchymal stem cells to generate exosomes loaded with TERT mRNA, and the homing effect of stem cells and the penetration of exosomes can be used to achieve systemic telomeres prolongation, avoiding the risk of oncogenicity and immune response of persistent TERT expression.
Significantly reduce the risk of cancer, break through tissue barriers to achieve systemic homogeneity of telomeres, improve immune compatibility, support long-term benefits of single treatment, reduce treatment costs and accessibility, and achieve dual safety guarantees.
Smart Images

Figure CN120442554A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to exosomes containing TERT mRNA, and a preparation method and application thereof. Background Art
[0002] Telomeres are complex structures composed of repetitive DNA sequences (such as TTAGGG) and their binding proteins located at the ends of chromosomes. Their core functions include: Protecting genetic stability: Preventing chromosome ends from degradation by nucleases or abnormal fusion through a "cap-like structure." Cell division timer: As cells divide, telomeres gradually shorten due to defects in the DNA replication mechanism (end replication problem); when shortened to a critical length (Hayflick limit), cells enter a state of senescence or apoptosis. Regulation of genome integrity: Telomere shortening triggers cell cycle arrest by activating the p53 / p16 pathway, preventing the unlimited proliferation of potentially cancerous cells.
[0003] Prolonging telomere length throughout the body may have the following physiological effects: Delaying aging: Prolonging cell replication potential and improving tissue regeneration (such as skin, bone marrow, and immune system). Reducing the risk of age-related diseases: including cardiovascular disease (endothelial cell aging), neurodegenerative diseases (neuronal loss), and metabolic syndrome (pancreatic beta cell failure). Enhancing immune function: Slowing T cell telomere loss and maintaining immune response effectiveness. Potential lifespan extension: Animal models (such as telomerase transgenic mice) show a positive correlation between telomere lengthening and lifespan.
[0004] Existing technologies generally use AAV-based systemic overexpression therapy of telomerase reverse transcriptase (TERT). The principle is to deliver the human telomerase reverse transcriptase (hTERT) gene to tissues throughout the body through an adeno-associated virus (AAV) vector, causing somatic cells to re-express telomerase and extend telomeres. However, it has many drawbacks: Carcinogenic risk: Telomerase (TERT) is abnormally activated in 85% of cancer cells, and its long-term systemic overexpression may promote the clonal expansion of precancerous cells. Increased incidence of liver cancer and lung cancer has been observed in animal experiments (such as TERT transgenic mouse models). Immunogenicity: Exogenous AAV vectors may trigger host immune responses, leading to vector clearance or hepatotoxicity (especially when administered repeatedly), and there is a high probability that AAV pre-neutralizing antibodies exist in the general population. Uneven delivery efficiency: AAV has low transfection efficiency in certain tissues (such as skeletal muscle and heart), making it difficult to achieve systemic homogenous telomere extension. The blood-brain barrier hinders delivery to the central nervous system, limiting the neuroprotective effect. Risk of irreversible integration: The AAV genome may randomly integrate into host DNA, causing insertional mutagenesis (although the probability is lower than that of retroviruses).
[0005] The drawback of other small molecule telomerase activators (such as TA-65) is that they only slightly extend telomeres (an average increase of 1-3%), and the effect is limited to specific cell types (such as lymphocytes). There is a lack of long-term safety data, and they may interfere with the function of telomere-binding proteins (such as the Shelterin complex). The drawback of CRISPR-mediated telomere extension is the risk of off-target editing leading to genomic instability (such as non-specific cutting of telomere-adjacent regions). It is difficult to achieve systemic delivery, and local applications (such as in vitro cell editing) cannot solve the problem of systemic aging. The drawback of stem cell transplantation therapy is that the telomere length advantage of the young stem cells is gradually lost as the transplanted cells divide, and the ability to extend the telomeres of the body's original cells is very weak. Immune rejection and low homing efficiency limit their wide applicability. The drawback of telomere extension inducers (such as PAPD5 inhibitors) is that they are only applicable to cells with residual telomerase activity (such as germ cells, stem cells) and are ineffective against terminally differentiated cells.
[0006] In summary, current therapies for extending systemic telomeres have core problems such as carcinogenicity, uneven delivery, short-lived effects, or limited tissue specificity. There is an urgent need to develop a systemic telomere extension strategy that is efficient, controllable, and significantly safer. Summary of the Invention
[0007] The present invention aims to overcome the shortcomings of the prior art by providing exosomes containing TERT mRNA, as well as methods for their preparation and use. The exosomes of the present invention carry TERT mRNA, which is produced by human mesenchymal stem cells that overexpress the TERT gene. The exosomes of the present invention can increase the expression of related telomere genes and extend telomere length throughout the body (excluding the brain).
[0008] To achieve the above object, the technical solution adopted by the present invention is:
[0009] In a first aspect, the present invention provides an exosome, wherein the exosome is loaded with mRNA of the TERT gene; the mRNA of the TERT gene is produced by cells overexpressing the TERT gene; the cells overexpressing the TERT gene are human mesenchymal stem cells overexpressing the TERT gene.
[0010] The TERT gene is a telomerase reverse transcriptase (TERT) gene that can extend the length of chromosome telomeres. The present invention uses genetic engineering techniques to overexpress the TERT gene in human mesenchymal stem cells, and exosomes are obtained from these cells. Experiments have shown that the exosomes of the present invention can increase the expression levels of related telomere genes (TERT, TP1), and have the effect of extending the length of telomeres in various organs throughout the body (except the brain). Therefore, the exosomes of the present invention have the effect of extending telomeres throughout the body (except the brain).
[0011] As a preferred embodiment of the first aspect, the number of TERT mRNA copies per milligram of the exosome protein is ≥10 6 , accounting for ≥30% of the total exosome RNA; the exosome TERT mRNA contains a double CD box structure; the exosome membrane surface expresses CD63-L7Ae fusion protein.
[0012] As a preferred embodiment of the first aspect, the human mesenchymal stem cells overexpressing the TERT gene are prepared by the following preparation method:
[0013] A. Construction of plasmid 1, plasmid 2, and plasmid 3; the nucleotide sequence of plasmid 1 is shown in SEQ ID NO: 5; the nucleotide sequence of plasmid 2 is shown in SEQ ID NO: 10; and the nucleotide sequence of plasmid 3 is shown in SEQ ID NO: 11;
[0014] B. co-transfecting human mesenchymal stem cells with the plasmid 1, plasmid 2, and plasmid 3;
[0015] C. The transfected human mesenchymal stem cells are cultured in a complete culture medium, and the supernatant of the cell culture is collected to obtain the exosomes.
[0016] In a second aspect, the present invention provides an engineered human mesenchymal stem cell, comprising a plasmid 1 having a nucleotide sequence as shown in SEQ ID NO: 5, a plasmid 2 having a nucleotide sequence as shown in SEQ ID NO: 10, and a plasmid 3 having a nucleotide sequence as shown in SEQ ID NO: 11.
[0017] The present invention uses genetic engineering techniques to construct human mesenchymal stem cells that overexpress the TERT gene. Experimental studies have demonstrated that these engineered human mesenchymal stem cells can increase the expression of related telomere genes (TERT and TP1), extending telomere length throughout the body (all organs except the brain). Therefore, the human mesenchymal stem cells constructed in this invention have the efficacy of extending telomeres throughout the body (all organs except the brain).
[0018] As a preferred embodiment of the second aspect, the human mesenchymal stem cells are prepared by the following preparation method:
[0019] A. Construction of plasmid 1, plasmid 2, and plasmid 3; the nucleotide sequence of plasmid 1 is shown in SEQ ID NO: 5; the nucleotide sequence of plasmid 2 is shown in SEQ ID NO: 10; and the nucleotide sequence of plasmid 3 is shown in SEQ ID NO: 11;
[0020] B. co-transfecting human mesenchymal stem cells with the plasmid 1, plasmid 2, and plasmid 3;
[0021] C. Culturing the transfected human mesenchymal stem cells in a complete culture medium, collecting the cells, and obtaining the human mesenchymal stem cells.
[0022] As a preferred embodiment of the second aspect, in step A, the mass ratio of plasmid 1, plasmid 2, and plasmid 3 is 1:1:1.
[0023] As a preferred embodiment of the second aspect, the method for preparing human mesenchymal stem cells further comprises the step of identifying the plasmid using primers;
[0024] The nucleotide sequences of the upstream and downstream primers used to identify plasmid 1 are shown in SEQ ID NOs: 3-4;
[0025] The nucleotide sequences of the upstream and downstream primers used to identify plasmid 2 are shown in SEQ ID NOs: 8-9.
[0026] As a preferred embodiment of the second aspect, the human mesenchymal stem cells include bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells, dental pulp mesenchymal stem cells, peripheral blood mesenchymal stem cells, amniotic fluid mesenchymal stem cells, synovial mesenchymal stem cells, muscle mesenchymal stem cells and induced pluripotent stem cells.
[0027] In a third aspect, the present invention provides use of the exosomes described in the first aspect or the human mesenchymal stem cells described in the second aspect in the preparation of a medicine or health product for extending telomeres in an animal.
[0028] As a preferred embodiment of the third aspect, the drugs for extending telomeres in animals include: anti-tumor drugs, anti-aging drugs, immunity-enhancing drugs, drugs for treating cardiovascular diseases, drugs for treating neurodegenerative diseases, and drugs for treating metabolic syndrome.
[0029] In a fourth aspect, the present invention provides a method for extending telomeres of cells, comprising the step of incubating the exosomes described in the first aspect with cells.
[0030] The present invention found that after incubating the exosomes of the present invention with cells, not only can the transcription level of related telomere genes (TERT gene, TP1 gene) in the cells be significantly increased, but also the relative length of the telomeres of the cells can be significantly extended.
[0031] In a fifth aspect, the present invention provides a method for extending whole-body telomeres for non-diagnostic or therapeutic purposes, the method comprising the step of injecting the human mesenchymal stem cells described in the second aspect.
[0032] The present invention found that after the engineered human mesenchymal stem cells constructed by the present invention were injected intravenously into mice, it was found that the relative length of telomeres in the mice's organs or tissues (except the brain) was significantly improved, while the transcription level of related telomere genes (TERT gene, TP1 gene) in the organs or tissues (except the brain) was reduced. This is because the present invention utilizes the homing effect of stem cells to reach organs or tissues (except the brain) throughout the body and secrete exosomes loaded with TERT gene mRNA, which lengthens the telomeres at the location where they arrive. After the exosomes are secreted by the stem cells for a short period of time, they are cleared by the immune system, avoiding the side effect of persistent telomere extension. Therefore, injecting the engineered cells of the present invention into mice will extend the relative length of telomeres in organs or tissues (except the brain) throughout the body, but will not extend them persistently.
[0033] Compared with the prior art, the present invention has the following beneficial effects:
[0034] 1. Significantly reduce the risk of carcinogenesis and achieve precise spatiotemporal control of telomerase activity
[0035] Limitations of existing technologies: Sustained TERT expression caused by AAV or gene editing may activate cancer pathways (such as telomerase-dependent tumors).
[0036] Advantages of the present invention: 1) Transient expression: TERT protein is delivered through exosomes during the survival of engineered stem cells (weeks to months), and its activity is terminated as the stem cells are cleared by the immune system, avoiding the risk of long-term exposure to cancer. 2) No gene integration: Exosomes directly deliver TERT protein instead of genes, avoiding insertion mutations in the host genome (better than AAV / CRISPR). 3) Controllable dosage: By adjusting the number of engineered stem cell transplants or the efficiency of exosome secretion, the amount of TERT released can be precisely controlled to prevent over-activation. 4) The telomeres of stem cells that overexpress TERT will be lengthened, which can prolong the survival time of stem cells in the body.
[0037] 2. Break through tissue barriers and achieve homogenized telomere extension throughout the body
[0038] Deficiencies of existing technologies: AAV has low delivery efficiency to specific tissues (such as the brain and heart).
[0039] Advantages of this invention: 1) Targeted delivery through homing effect: Mesenchymal stem cells actively migrate to damaged or aging tissues (such as myocardial ischemia), achieving local high-concentration enrichment. 2) Exosome penetrability advantage: Exosomes can diffuse through tissue gaps to areas difficult to reach with traditional carriers (such as articular cartilage), ensuring systemic homogenous treatment. 3) Multi-cell type coverage: Exosomes can be efficiently taken up by a variety of cells, including endothelial cells and fibroblasts, breaking through the cell type limitations of existing therapies.
[0040] 3. High immune compatibility, supporting long-term benefits from a single treatment
[0041] Deficiencies of existing technologies: Repeated administration of AAV induces immune clearance, and small molecules such as TA-65 require continuous administration and have weak effects.
[0042] Advantages of the present invention: 1) Stem cell compatibility: It uses allogeneic embryonic mesenchymal stem cells or the user's own mesenchymal stem cells or other stem cells for transformation, and has low immunogenicity. 2) "Once and for all" effect: After a single injection, exosomes continue to secrete TERT, permanently extending telomeres during the treatment period, without relying on long-term drug maintenance (superior to small molecules such as TA-65 that require continuous administration). 3) Exosomes are naturally low in immunogenicity: CD47 protein is expressed on the surface of exosomes, reducing clearance by macrophages and extending half-life. 4) Broad effect: With the help of stem cell homing, engineered stem cells can continuously secrete engineered exosomes in various tissues and organs, thereby having a good telomere extension effect on multiple organs.
[0043] 4. Double security protection mechanism
[0044] Deficiencies of existing technologies: risk of off-target gene editing (CRISPR) and non-specific effects of chemical activators (TA-65).
[0045] Advantages of this invention: 1) Dual regulatory switches: Temporal switch: The stem cell survival period determines the therapeutic window, preventing uncontrolled, sustained TERT release. Spatial switch: Exosomes are delivered only to the stem cell homing area, reducing the risk of non-target tissue exposure. 2) No genome manipulation: No host DNA editing or exogenous gene integration is involved, completely avoiding the risks associated with gene therapy.
[0046] 5. Optimizing treatment costs and accessibility
[0047] Deficiencies of existing technologies: AAV vector production costs are high, and CRISPR requires personalized design.
[0048] Advantages of this invention: 1) Standardized preparation process: Mature technologies for in vitro expansion of mesenchymal stem cells and collection of exosomes facilitate scalable production. 2) Universal transformation strategy: The TERT-exosome engineering approach can be adapted to stem cells from different sources, eliminating the need for individual customization. 3) Reduced repeat treatments: A single treatment provides long-term benefits, reducing the financial burden on users. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 Schematic diagram of the plasmid GV394 vector and plasmid GV712 vector maps;
[0050] Figure 2 Schematic diagram of qPCR detection of telomere genes (hTERT gene, TP1 gene) related to in vitro experiments;
[0051] Figure 3 Schematic diagram of telomere length detection in different organs in in vivo animal experiments;
[0052] Figure 4 Schematic diagram of the hTERT gene qPCR detection results in different organs of in vivo animal experiments. DETAILED DESCRIPTION
[0053] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0054] Example 1 Construction of plasmid
[0055] 1. Construction of plasmid 1TERT gene overexpression vector:
[0056] (1) Use the following primers to obtain the target TERT gene from the synthetic gene fragment:
[0057] TERT(108331-1)-p1:
[0058] TTGGTACCGAGCTCGGATCCCGCCACCATGCCGCGCGCTCCCCGCTG (SEQ ID NO: 1);
[0059] TERT(108331-1)-p2:
[0060] ACGGGCCCTCTAGACTCGAGGAAGCGGCGGGTCACCTTTCGGATCAC (SEQ ID NO: 2).
[0061] (2) Using GV394 vector ( Figure 1 ) as the backbone, the PCR product of the target gene obtained in step (1) was linked to the linearized GV394 vector to obtain plasmid 1.
[0062] (3) Plasmid 1 was identified using the following primers:
[0063] KL108331-p3: TGTCACAGCCTGTTTCTGGA (SEQ ID NO: 3)
[0064] KL108331-p4:TTATTAGGAAAGGACAGTGGG (SEQ ID NO: 4)
[0065] The nucleotide sequence of plasmid 1 is as follows:
[0066] CTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGC
[0067] TCGGATCCCGCCACCATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACCGCGAGGTGC
[0068] TGCCGCTGGCCACGTTCGTGCGGCGCCTGGGGCCCCAGGGCTGGCGGCTGGTGCAGCGCGGGGACCCGGCGGCTTTCC
[0069] GCGCGCTGGTGGCCCAGTGCCTGGTGTGCGTGCCCTGGGACGCACGGCCGCCCCCCGCCGCCCCCTCCTTCCGCCAGG
[0070] TGTCCTGCCTGAAGGAGCTGGTGGCCCGAGTGCTGCAGAGGCTGTGCGAGCGCGGCGCGAAGAACGTGCTGGCCTTC
[0071] GGCTTCGCGCTGCTGGACGGGGCCCGCGGGGGCCCCCCCGAGGCCTTCACCACCAGCGTGCGCAGCTACCTGCCCAAC
[0072] ACGGTGACCGACGCACTGCGGGGGAGCGGGGCGTGGGGGCTGCTGCTGCGCCGCGTGGGCGACGACGTGCTGGTTCA
[0073] CCTGCTGGCACGCTGCGCGCTCTTTGTGCTGGTGGCTCCCAGCTGCGCCTACCAGGTGTGCGGGCCGCCGCTGTACCAG
[0074] CTCGGCGCTGCCACTCAGGCCCGGCCCCCGCCACACGCTAGTGGACCCCGAAGGCGTCTGGGATGCGAACGGGCCTGG
[0075] AACCATAGCGTCAGGGAGGCCGGGGTCCCCCTGGGCCTGCCAGCCCCGGGTGCGAGGAGGCGCGGGGGCAGTGCCAG
[0076] CCGAAGTCTGCCGTTGCCCAAGAGGCCCAGGCGTGGCGCTGCCCCTGAGCCGGAGCGGACGCCCGTTGGGCAGGGGT
[0077] CCTGGGCCCACCCGGGCAGGACGCGTGGACCGAGTGACCGTGGTTTCTGTGTGGTGTCACCTGCCAGACCCGCCGAAG
[0078] AAGCCACCTCTTTGGAGGGTGCGCTCTCTGGCACGCGCCACTCCCACCCATCCGTGGGCCGCCAGCACCACGCGGGCC
[0079] CCCCATCCACATCGCGGCCACCACGTCCCTGGGACACGCCTTGTCCCCCGGTGTACGCCGAGACCAAGCACTTCCTCTA
[0080] CTCCTCAGGCGACAAGGAGCAGCTGCGGCCCTCCTTCCTACTCAGCTCTCTGAGGCCCAGCCTGACTGGCGCTCGGAG
[0081] GCTCGTGGAGACCATCTTTCTGGGTTCCAGGCCCTGGATGCCAGGGACTCCCCGCAGGTTGCCCCGCCTGCCCCAGCGC
[0082] TACTGGCAAATGCGGCCCCTGTTTCTGGAGCTGCTTGGGAACCACGCGCAGTGCCCCTACGGGGTGCTCCTCAAGACG
[0083] CACTGCCCGCTGCGAGCTGCGGTCACCCCAGCAGCCGGTGTCTGTGCCCGGGAGAAGCCCCAGGGCTCTGTGGCGGCC
[0084] CCCGAGGAGGAGGACACAGACCCCCGTCGCCTGGTGCAGCTGCTCCGCCAGCACAGCAGCCCCTGGCAGGTGTACGG
[0085] CTTCGTGCGGGCCTGCCTGCGCCGGCTGGTGCCCCCAGGCCTCTGGGGCTCCAGGCACAACGAACGCCGCTTCCTCAG
[0086] GAACACCAAGAAGTTCATCTCCCTGGGGGAAGCATGCCAAGCTCTCGCTGCAGGAGCTGACGTGGAAGATGAGCGTGCG
[0087] GGACTGCGCTTGGCTGCGCAGGAGCCCAGGGGTTGGCTGTGTTCCGGCCGCAGAGCACCGTCTGCGTGAGGAGATCCT
[0088] GGCCAAGTTCCTGCACTGGCTGATGAGTGTGTACGTCGTCGAGCTGCTCAGGTCTTTCTTTTATGTCACGGAGACCACG
[0089] TTTCAAAAGAACAGGCTCTTTTTCTACCGGAAGAGTGTCTGGAGCAAGTTGCAAAGCATTGGAATCAGACAGCACTTG
[0090] AAGAGGGTGCAGCTGCGGGAGCTGTCGGAAGCAGAGGTCAGGCAGCATCGGGAAGCCAGGCCCCGCCTGCTGACGTC
[0091] CAGACTCCGCTTCATCCCCAAGCCTGACGGGCTGCGGCCGATTGTGAACATGGACTACGTCGTGGGAGCCAGAACGTT
[0092] CCGCAGAGAAAAGAGGGCGAGCGTCTCACCTCGAGGGTGAAGGCACTGTTCAGCGTGCTCAACTACGAGCGGGCGC
[0093] GGCGCCCCGGCCTCCTGGGCGCCTCTGTGCTGGGCCTGGACGATATCCACAGGGCCTGGCGCACCTTCGTGCTGCGTGT
[0094] GCGGGCCCAGGACCCGCCGCCTGAGCTGTACTTTGTCAAGGTGGATGTGACGGGCGCGTACGACACCATCCCCCAGGA
[0095] CAGGCTCACGGAGGTCATCGCCAGCATCATCAAACCCCAGAACACGTACTGCGTGCGTCGGTATGCCGTGGTCCAGAA
[0096] GGCCGCCCATGGGCACGTCCGCAAGGCCTTCAAGAGCCACGTCTCTACCTTGACAGACCTCCAGCCGTACATGCGACA
[0097] GTTCGTGGCTCACCTGCAGGAGACCAGCCCGCTGAGGGATGCCGTCGTCATCGAGCAGAGCTCCTCCCTGAATGAGGC
[0098] CAGCAGTGGCCTCTTCGACGTCTTCCTACGCTTCATGTGCCACCACGCCGTGCGCATCAGGGGCAAGTCCTACGTCCAG
[0099] TGCCAGGGGATCCCGCAGGGCTCCATCCTCTCCACGCTGCTCTGCAGCCTGTGCTACGGCGACATGGAGAACAAGCTGT
[0100] TTGCGGGGATTCGGCGGGACGGGCTGCTCCTGCGTTTGGTGGATGATTTCTTGTTGGTGACACCTCACCTCACCCACGC
[0101] GAAAACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGAGTATGGCTGCGTGGTGAACTTGCGGAAGACAGTGGTGAA
[0102] CTTCCCTGTAGAAGACGAGGCCCTGGGTGGCACGGCTTTTGTTCAGATGCCGGCCCACGGCCTATTCCCCTGGTGCGGC
[0103] CTGCTGCTGGATACCCGGACCCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCTCCATCAGAGCCAGTCTCA
[0104] CCTTCAACCGCGGCTTCAAGGCTGGGAGGAACATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGAAGTGTCACAGCC
[0105] TGTTTCTGGATTTGCAGGTGAACAGCCTCCAGACGGTGTGCACCAACATCTACAAGATCCTCCTGCTGCAGGCGTACAG
[0106] GTTTCACGCATGTGTGCTGCAGCTCCCATTTCATCAGCAAGTTTGGAAGAACCCCACATTTTTCCTGCGCGTCATCTCTG
[0107] ACACGGCCTCCCTCTGCTACTCCATCCTGAAAGCCAAGAACGCAGGGATGTCGCTGGGGGCCAAGGGCGCCGCCGGCC
[0108] CTCTGCCCTCCGAGGCCGTGCAGTGGCTGTGCCACCAAGCATTCCTGCTCAAGCTGACTCGACACCGTGTCACCTACGT
[0109] GCCACTCCTGGGGTCACTCAGGACAGCCCAGACGCAGCTGAGTCGGAAGCTCCCGGGGACGACGCTGACTGCCCTGG
[0110] AGGCCGCAGCCAACCCGGCACTGCCCTCAGACTTCAAGACCATCCTGGACTGAGGATCCTCTAGAGTCGACCCGGGCG
[0111] GGGCGTGATCCGAAAGGTGACCCGGATCTGGGGCGTGATCCGAAAGGTGACCCGCCGCTTCCTCGAGTCTAGAGGGCC
[0112] CGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTT
[0113] GACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATT
[0114] CTATTCT (SEQ ID NO: 5).
[0115] 2. Construction of plasmid 2CD63-L7Ae expression vector:
[0116] (1) The following primers were used to obtain the CD63-L7Ae fragment from the synthetic gene fragment:
[0117] CD63-L7Ae(108345-1)-p1:
[0118] GTTTAAACGGGCCCTCTAGACGCCACCATGGGTGACTGGAGCGCCTTAG (SEQ ID NO: 6);
[0119] CD63-L7Ae(108345-1)-p2:
[0120] CAGCGGTTTAACTATCTAGATTACTTCTGAAGGCCTTTAATCTTCTCCACAAGGC (SEQ ID NO: 7).
[0121] (2) GV712( Figure 1 ) as the backbone, the PCR product of the gene obtained in step (1) was linked to the linearized GV712 vector to obtain plasmid 2.
[0122] (3) Plasmid 2 was identified using the following primers:
[0123] KL108345-p3: TGTCACAGCCTGTTTCTGGA (SEQ ID NO: 8)
[0124] KL108345-p4: TTATTAGGAAAGGACAGTGGG (SEQ ID NO: 9)
[0125] The nucleotide sequence of plasmid 2 is as follows:
[0126] TTCTGCTAGCGTTTAAACGGGCCCTCTAGACGCCACCATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACA
[0127] AGGTTCAAGCCTACTCAACTGCTGGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGAC
[0128] AGCGGTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGTTGTGAAAATGTCTGC
[0129] TATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTGCAGATCATATTTGTGTCTGTACCCACACTCTTGTAC
[0130] CTGGCTCATGTGTTCTATGTGATGCGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACT
[0131] GATGGTGTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAAGAGCATGGTAAGG
[0132] TGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTCTTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTG
[0133] ATCCAGTGGTACATCTATGGATTCAGCTTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTG
[0134] TTTCCTCTCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCCCTGGCCTTGAATAT
[0135] CATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTTAAGGGAAAGAGCGACCCTTACCATGCGACCAGT
[0136] GGTGCGCTGAGCCCTGCCAAAGACTGTGGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCT
[0137] CTCGCCTATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAATTACAACAAGCAA
[0138] GCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATGGGGCAGGCGGGAAGCACCATCTCTAACTCC
[0139] CATGCACAGCCTTTTGATTTCCCCGATGATAACCAGAATTCTAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGC
[0140] CATTGTGGACCAGCGACCTTCAAGCAGAGCCGCCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTGGAGATCCG
[0141] GCGGAAGCGGGGCAGCGGCGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTATGA
[0142] GCCCAGGCCCGGCAGCCATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACGTCCTCCTGCTGGCCTT
[0143] TTGCGCCTGTGCAGTGGGACTGATTGCCGTGGGTGTCGGGGCACAGCTTGTCCTGAGTCAGACCATAATCCAGGGGGCT
[0144] ACCCCTGGCTCTCTGTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGTGGGCTGCTGCGG
[0145] GGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCTTATCATGTTGGTGGAGGTGGCCGCAG
[0146] CCATTGCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATAACAACTTCCGGCAGCAGATGGAGAATTACCCG
[0147] AAAAATAACCACACTGCTTCGATCCTGGACAGGATGCAGGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATT
[0148] GGGAGAAAATCCCTTCCATGTCGAAGAACCGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAAT
[0149] TTCAACGAGAAGGCGATCCATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTA
[0150] GCTGCAGCAGCCCTTGGAATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAA
[0151] GTGGCTACGAGGTGATGGGAGGCGGAGGCGGAGGCGGAGGCATGTACGTGAGATTTGAGGTTCCTGAGGACATGCAG
[0152] AACGAAGCTCTGAGTCTGCTGGAGAAGGTTAGGGAGAGCGGTAAGGTAAAGAAAGGTACCAACGAGACGACAAAGGC
[0153] TGTGGAGAGGGGACTGGCAAAGCTCGTTTACATCGCAGAGGATGTTGACCCGCCTGAGATCGTTGCTCATCTGCCCCTC
[0154] CTCTGCGAGGAGAAGAATGTGCCGTACATTTTACGTTAAAAGCAAGAACGACCTTGGAAGGGCTGTGGGCATTGAGGTG
[0155] CCATGCGCTTCGGCAGCGATAATCAACGAGGGAGAGCTGAGAAAGGAGCTTGGAAGCCTTGTGGAGAAGATTAAAGGC
[0156] CTTCAGAAGTAATCTAGATAGTTAAACCGCTGATCAGCCTCG (SEQ ID NO: 10).
[0157] 3. Construction of plasmid 3-STEAP3-IRES-SDC4-IRES-NADB plasmid:
[0158] Plasmid 3 was purchased from Solebro, catalog number: VT284-1EA. The nucleotide sequence of plasmid 3 is shown in SEQ ID NO: 11.
[0159]
[0160] 4. Plasmid amplification and extraction:
[0161] (1) Add 2 μl of plasmid 1, 2, or 3 to 20 μl of competent E. coli cells, place in a 4°C refrigerator for 30 min, heat shock in a 42°C water bath for 1 min, and then immediately place on ice for 2 min. Add 900 μl of LB medium to each tube and shake at 37°C, 150 rpm, for 45 min to obtain plasmid transformation solution.
[0162] (2) Take 100 μl of transformation solution and add it to the corresponding resistance plate, add appropriate amount of glass beads and spread the liquid evenly;
[0163] (3) The plate was inverted and cultured in a 37°C constant temperature incubator overnight. Positive clones were screened and plasmids were extracted. The plasmids were identified using the above identification primers to obtain plasmids 1-3.
[0164] Example 2 Preparation of exosomes
[0165] 1. Human Mesenchymal Stem Cell (hMSC) culture:
[0166] hMSC cells were seeded into 100 mm dishes, cultured in 5% ncMission hMSC complete medium, and cultured in a 37° C., 5% CO 2 incubator until the cells reached 80% confluency.
[0167] Preparation of 5% ncMission hMSC complete medium: Take 500 mL of ncMission Basal Medium and 25 mL of ncMission Supplement (21×) and mix them evenly.
[0168] 2. Cell passaging:
[0169] (1) Aspirate the culture medium, wash once with DPBS (without calcium and magnesium), add rewarmed digestion solution (0.125% trypsin digestion solution, TrypLE (0.5×)), digest at 37°C for 4-5 minutes, then add an equal volume of ncMission hMSC complete culture medium containing trypsin inhibitor to terminate digestion, collect cells and centrifuge (200×g, 5 minutes);
[0170] (2) Add 5 mL of normal saline to resuspend the cells and take a sample for counting: the cell viability should be ≥90%; collect the cells by centrifugation (200 × g, 5 min);
[0171] (3) Add 5 mL of ncMission hMSC complete medium to resuspend the cells and plate at an appropriate density (5000-7000 / cm2 , preferably 6000 / cm 2 ) Inoculate the cells into a cell culture vessel, add an appropriate amount of pre-warmed fresh ncMission hMSC complete medium, shake horizontally three times, and place in an incubator at 37°C, 5% CO2 concentration, and saturated humidity. Shake horizontally three times again and culture continuously for 3 days. When the cell confluence reaches 80-85%, you can choose to passage.
[0172] 3. Plasmid transfection
[0173] The passaged hMSC cells were trypsinized, washed with PBS buffer, and the cell density was adjusted to 1×10 6 cells / ml; after extraction of plasmid 1, plasmid 2 and plasmid 3, the final concentration was adjusted to 200ng / ul;
[0174] Culture medium A: 312ul basal medium + 10ul Lip 3000 transfection reagent, let stand;
[0175] Medium B:
[0176] Culture medium B-1: 104ul basal culture medium + 15.6ul plasmid 1; Culture medium B-2: 104ul basal culture medium + 15.6ul plasmid 2; Culture medium B-3: 104ul basal culture medium + 15.6ul plasmid 3; Mix culture media B-1 to -3, add 31ul p3000 transfection reagent, let it stand, and obtain culture medium B.
[0177] Medium C: Add Medium A to Medium B and mix gently. Then add to ncMission hMSC complete medium (4300ul) and let stand to obtain Medium C.
[0178] hMSC cells (human mesenchymal stem cells) were added to the above culture medium C and cultured for 24 hours to obtain hMSC cells transfected with the plasmid.
[0179] The supernatant of the cell culture was collected to obtain the exosomes.
[0180] The cells are collected to obtain the human mesenchymal stem cells.
[0181] 4. Exosome preparation:
[0182] Effect Example 1 In Vitro Verification - Exosomes
[0183] The cell culture supernatant of the transfected hMSC cells was collected and transferred into HEK-293T cells (human kidney epithelial cell line). After incubation for 24 hours, the transcription levels of related telomere genes in the cells: TERT gene and TP1 gene were detected by qPCR.
[0184] The results are as follows Figure 2 As shown, compared with the control group, in the treated group of HEK-293T cells to which plasmid transfection supernatant was added, the mRNA of TERT gene and TP1 gene increased significantly at the transcription level, and the relative telomere length (T / S) was significantly prolonged. Figure 2 In cell experiments, due to the lack of tissue barrier restrictions, exogenous TERT (i.e., exosomes loaded with TERT gene mRNA) can directly replenish the TERT gene mRNA in cells, thereby increasing the overall level of TERT gene mRNA in cells and increasing the activity of telomerase in cells, thereby extending the length of cell telomeres. Therefore, at the cellular level, it was shown that the expression level of TERT gene mRNA increased, thereby increasing the length of cell telomeres.
[0185] Telomere length detection method: qPCR method was used to detect telomere length, as follows:
[0186] By measuring the telomere signal (T) and the reference single-copy gene signal (S), the T / S ratio is calculated. This ratio is proportional to the average telomere length (TL). The specific steps are as follows:
[0187] The genomic DNA was extracted, the concentration was measured, and then diluted to a concentration of approximately 20 ng / μL.
[0188] PCR setup: 50-100 ng of template DNA was used for a PCR reaction using a telomere primer pair (T reaction primers) and a control single-copy gene 36b4 primer pair (S reaction primers). PCR conditions included activation and a three-step cycling protocol.
[0189] Calculation of T / S ratio: Use the software supporting the fluorescent quantitative PCR instrument to determine the Ct values of the T reaction and S reaction (Ct(telomeres) and Ct(36b4)), respectively. Based on the principle that the PCR reaction products increase exponentially by 2, calculate the T / S ratio.
[0190] The formula is: T / S=2-ΔCt=2-(ΔCt1-ΔCt2), where ΔCt1 and ΔCt2 are the Ct values of the T reaction and the S reaction, respectively.
[0191] Effect Example 2 In Vivo Verification - Engineered Human Mesenchymal Stem Cells
[0192] 1. C57BL / 6 mice were divided into control group, low-dose group (0.1 ml × 1E8 cells / ml), and high-dose group (0.5 ml × 2E8 cells / ml);
[0193] 2. Transfected hMSC cells and untransfected hMSC cells were injected into mice via tail vein. On the third day after transfection, eye blood, liver, spleen, aorta, and brain tissue were extracted from the mice. Real-time fluorescence quantitative PCR was used to detect the ratio of telomere (T) repeat copy number to single copy gene (S). The T / S ratio can be used to determine the relative length of telomeres and confirm whether the mice's telomeres are elongated.
[0194] The results are as follows Figure 3 As shown, compared with the control and low-dose groups, the high-dose group significantly prolonged telomere length in the liver, spleen, aorta, and blood of mice, while no extension effect was found in brain tissue. Because of the blood-brain barrier in the brain, exosomes secreted by engineered human mesenchymal stem cells cannot produce an effect.
[0195] The results are as follows Figure 4 As shown, compared with the control group, the low-dose group and the high-dose group reduced the transcription level of hTERT gene in the liver, aorta and brain tissues of mice, while it was significantly increased in the blood.
[0196] Animal experimental results showed a trend of increased telomere length but decreased hTERT expression levels in organs and tissues such as the liver. This is because the exosomal hTERT secreted by exogenous engineered human mesenchymal stem cells extends telomere length, but hTERT expression levels decrease because it is cleared by the body after transient expression. This further proves that the engineered human mesenchymal stem cells of the present invention transiently express TERT, reducing the side effects of continuous expression.
[0197] The results of animal experiments showed an upward trend in telomere length and hTERT in the blood. This is because immune cells directly absorb the hTERT signal secreted by MSCs and activate endogenous transcription.
[0198] The results of animal experiments showed that in brain tissue, due to the restriction of the blood-brain barrier, exogenous TERT (i.e., exosomes loaded with TERT gene mRNA) was restricted from entering the brain tissue, and endogenous TERT was downregulated, resulting in the inability to maintain telomeres.
[0199] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. An exosome, characterized in that: The exosomes are loaded with mRNA of the TERT gene; The mRNA of the TERT gene is produced by cells that overexpress the TERT gene; The cells overexpressing the TERT gene are human mesenchymal stem cells overexpressing the TERT gene.
2. The exosome according to claim 1, wherein The human mesenchymal stem cells overexpressing the TERT gene are prepared by the following preparation method: A. Construction of plasmid 1, plasmid 2, and plasmid 3; The nucleotide sequence of the plasmid 1 is shown in SEQ ID NO: 5; The nucleotide sequence of the plasmid 2 is shown in SEQ ID NO: 10; The nucleotide sequence of the plasmid 3 is shown in SEQ ID NO: 11; B. co-transfecting human mesenchymal stem cells with the plasmid 1, plasmid 2, and plasmid 3; C. The transfected human mesenchymal stem cells are cultured in a complete culture medium, and the supernatant of the cell culture is collected to obtain the exosomes.
3. An engineered human mesenchymal stem cell, characterized in that: The human mesenchymal stem cells contain plasmid 1 with a nucleotide sequence as shown in SEQ ID NO: 5, plasmid 2 with a nucleotide sequence as shown in SEQ ID NO: 10, and plasmid 3 with a nucleotide sequence as shown in SEQ ID NO:
11.
4. The human mesenchymal stem cells according to claim 3, wherein The human mesenchymal stem cells are prepared by the following preparation method: A. Construction of plasmid 1, plasmid 2, and plasmid 3; The nucleotide sequence of the plasmid 1 is shown in SEQ ID NO: 5; The nucleotide sequence of the plasmid 2 is shown in SEQ ID NO: 10; The nucleotide sequence of the plasmid 3 is shown in SEQ ID NO: 11; B. co-transfecting human mesenchymal stem cells with the plasmid 1, plasmid 2, and plasmid 3; C. Culturing the transfected human mesenchymal stem cells in a complete culture medium, collecting the cells, and obtaining the human mesenchymal stem cells.
5. The human mesenchymal stem cells according to claim 4, wherein In step A, the mass ratio of plasmid 1, plasmid 2, and plasmid 3 is 1:1:
1.
6. The human mesenchymal stem cells according to claim 4, wherein The method for preparing human mesenchymal stem cells further comprises the step of identifying the plasmid using upper and lower primers; The nucleotide sequences of the upstream and downstream primers used to identify plasmid 1 are shown in SEQ ID NOs: 3-4; The nucleotide sequences of the upstream and downstream primers used to identify plasmid 2 are shown in SEQ ID NOs: 8-9.
7. The human mesenchymal stem cells according to claim 3, wherein The human mesenchymal stem cells include bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, umbilical cord mesenchymal stem cells, placental mesenchymal stem cells, dental pulp mesenchymal stem cells, peripheral blood mesenchymal stem cells, amniotic fluid mesenchymal stem cells, synovial mesenchymal stem cells, muscle mesenchymal stem cells and induced pluripotent stem cells.
8. Use of the exosomes according to claim 1 or 2 or the human mesenchymal stem cells according to any one of claims 3 to 7 in the preparation of a medicine or health product for extending telomeres in an animal.
9. A method for extending telomeres of a cell, characterized in that: The method comprises the step of incubating the exosomes according to claim 1 or 2 with cells.
10. A method for extending whole-body telomeres for non-diagnostic or therapeutic purposes, characterized in that: The method comprises the step of injecting the human mesenchymal stem cells according to any one of claims 3 to 7.