Enhanced TCR-T cell for over-expression of CD200 and application of enhanced TCR-T cell

Abstract

The invention provides an enhanced TCR-T cell overexpressing CD200 and application thereof, and belongs to the technical field of biological medicine. The invention provides application of CD200 in preparation of a product for improving the anti-tumor effect of TCR-T cells. The CD200 can improve the cytokine secretion capacity of the TCR-T cells and inhibit the TCR-T cell depletion, so that the killing and anti-tumor effects of the TCR-T cells can be improved. Compared with the traditional TCR-T cell, the CD200 is over-expressed on the TCR-T cell, so that the TCR-T cell has stronger cytokine secretion capacity, and further can better play the killing and anti-tumor functions.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to an enhanced TCR-T cell overexpressing CD200 and an application thereof. Background Art

[0002] TCR-T (T cell receptor transduced T cell) therapy is an innovative cancer immunotherapy method that uses genetic engineering to modify T cells to express specific T cell receptors (TCR) to recognize and attack tumor cells. Compared with CAR-T therapy, its biggest feature is that it utilizes endogenous TCR to interact with DC cells. Although current TCR-T therapy has achieved certain success, it still has the problem of drug resistance. This may be because solid tumors have highly immunosuppressive properties, and the infused TCR-T cells are prone to lose their effector function after entering the tumor microenvironment, thereby losing their anti-tumor effect. Finding new solutions to improve the effectiveness of TCR-T therapy is a clinical problem that needs to be solved urgently. Summary of the Invention

[0003] The purpose of the present invention is to provide an enhanced TCR-T cell overexpressing CD200 and its application. Compared with traditional TCR-T cells, the enhanced TCR-T cell of the present invention has better killing and anti-tumor effects.

[0004] The present invention provides the use of CD200 in preparing a product for improving the anti-tumor effect of TCR-T cells. The nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.

[0005] In the specific implementation of the present invention, the improvement of the anti-tumor effect of TCR-T cells includes improving the cytokine secretion ability of TCR-T cells and / or inhibiting TCR-T cell exhaustion.

[0006] In a specific implementation of the present invention, the cytokines include IFN-γ and / or TNF-α.

[0007] The present invention also provides a fusion gene comprising a gene encoding a T cell antigen receptor and a gene encoding CD200; the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.

[0008] In a specific implementation of the present invention, the T cell antigen receptor includes a TCR Vα chain, a TCR Cα chain, P2A, a TCR-Vβ chain and a TCR-Cβ chain connected in sequence; the gene encoding CD200 is connected to the TCR-Cβ chain through the gene encoding the E2A peptide.

[0009] The present invention also provides a lentiviral expression vector comprising the fusion gene described in the above scheme.

[0010] The present invention also provides a recombinant lentivirus, which is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid described in the above scheme are mixed and then transfected into packaging cells, and incubated after transfection to obtain the recombinant lentivirus.

[0011] The present invention also provides an enhanced TCR-T cell, comprising a T lymphocyte containing the lentiviral expression vector or the recombinant lentivirus described in the above scheme.

[0012] The present invention also provides the use of the fusion gene, the lentiviral expression vector, the recombinant lentivirus or the enhanced TCR-T cell described in the above scheme in the preparation of a drug for preventing, treating and / or assisting in the treatment of malignant tumors.

[0013] In the specific implementation of the present invention, the malignant tumor includes melanoma.

[0014] The present invention provides the use of CD200 in the preparation of products that enhance the anti-tumor effects of TCR-T cells. CD200 can enhance the cytokine secretion capacity of TCR-T cells and inhibit TCR-T cell exhaustion, thereby enhancing the killing and anti-tumor effects of TCR-T cells. By overexpressing CD200 on TCR-T cells, the present invention enhances the cytokine secretion capacity compared to traditional TCR-T cells, thereby better exerting their killing and anti-tumor functions. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 Schematic diagram of the structure of CD200-overexpressing TCR-T and traditional TCR-T;

[0017] Figure 2 The results of IFN-γ secretion by CD200-overexpressing TCR-T and conventional TCR-T cells are shown in the figure;

[0018] Figure 3 The results of TNF-α secretion by CD200-overexpressing TCR-T and conventional TCR-T cells are shown in the figure;

[0019] Figure 4This figure shows the comparison of the killing function between CD200-overexpressing TCR-T and traditional TCR-T cells;

[0020] Figure 5 The figure shows the anti-tumor ability test results of CD200 overexpressing TCR-T and traditional TCR-T. DETAILED DESCRIPTION

[0021] The present invention provides the use of CD200 in preparing a product for improving the anti-tumor effect of TCR-T cells. The nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.

[0022] In the present invention, the nucleotide sequence shown in SEQ ID NO.1 is specifically:

[0023] atggagaggctggtgatcaggatgcccttctctcatctgtctacctacagcctggtttgggtcatggcagcagtggtgctgtgcacagcacaagtgcaag tggtgacccaggatgaaagagagcagctgtacacacctgcttccttaaaatgctctctgcaaaatgcccaggaagccctcattgtgacatggcagaaaaag aaagctgtaagcccagaaaacatggtcaccttcagcgagaaccatggggtggtgatccagcctgcctataaggacaagataaacattacccagctgggactccaaaactcaaccatcaccttctggaatatcaccctggaggatgaagggtgttacatgtgtctcttcaatacctttggttttgggaagatctcaggaacgg cctgcctcaccgtctatgtacagcccatagtatcccttcactacaaattctctgaagaccacctaaatatcacttgctctgccactgcccgcccagccccc atggtcttctggaaggtccctcggtcagggattgaaaaatagtacagtgactctgtctcacccaaatgggaccacgtctgttaccagcatcctccatatcaa agaccctaagaatcaggtggggaaggaggtgatctgccaggtgctgcacctggggactgtgaccgactttaagcaaaccgtcaacaaaggctattggtttt cagttccgctattgctaagcattgtttccctggtaattcttctcgtcctaatctcaatcttactgtactggaaacgtcaccggaatcaggaccgagagccc 。

[0024] In the specific implementation of the present invention, CD200 expression on CD8+ T cells can inhibit their exhaustion; the said enhancement of the anti-tumor effect of TCR-T cells includes enhancing the cytokine secretion capacity of TCR-T cells and / or inhibiting TCR-T cell exhaustion.

[0025] In a specific implementation of the present invention, the cytokines include IFN-γ and / or TNF-α.

[0026] The present invention also provides a fusion gene comprising a gene encoding a T cell antigen receptor and a gene encoding CD200; the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.1.

[0027] In a specific implementation of the present invention, the T cell antigen receptor is NY-ESO-1TCR-T, which includes TCR Vα chain, TCR Cα chain, P2A, TCR-Vβ chain and TCR-Cβ chain connected in sequence.

[0028] In a specific implementation of the present invention, the gene encoding the T cell antigen receptor and the gene encoding CD200 are sequentially connected in series; the gene encoding CD200 is connected to the TCR-Cβ chain in the T cell antigen receptor through the gene encoding the E2A peptide.

[0029] In one embodiment of the present invention, the nucleotide sequence of the T cell antigen receptor is shown in SEQ ID NO. 2, specifically:

[0030]

[0031] The present invention also provides a lentiviral expression vector comprising the fusion gene described in the above scheme.

[0032] In one embodiment of the present invention, the lentiviral expression vector further comprises an EF1α promoter and a gene encoding EGFP; the EF1α promoter, the gene encoding the T cell antigen receptor, the gene encoding CD200, and the gene encoding EGFP are sequentially connected in series; the gene encoding CD200 is connected via a gene encoding the T2A peptide and a gene encoding EGFP.

[0033] The present invention has no particular limitation on the method for constructing the lentiviral expression vector, and conventional methods in the art may be used.

[0034] The present invention also provides a recombinant lentivirus, which is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid described in the above scheme are mixed and then transfected into packaging cells, and incubated after transfection to obtain the recombinant lentivirus.

[0035] In the specific implementation process of the present invention, the packaging cells include HEK293T cells; the cell density of the HEK293T is 4×10e5 / ml; the lentiviral expression plasmid is the transfer plasmid pLVX; the packaging plasmid is psPAX2; the envelope plasmid is PmD2.G; the mass ratio of the lentiviral expression vector, packaging plasmid and envelope plasmid is 10:7.5:2.5.

[0036] The present invention also provides an enhanced TCR-T cell, comprising a T lymphocyte containing the lentiviral expression vector or the recombinant lentivirus described in the above scheme.

[0037] In the present invention, the T lymphocytes include CD3+ T cells.

[0038] The present invention also provides the use of the fusion gene, the lentiviral expression vector, the recombinant lentivirus or the enhanced TCR-T cell described in the above scheme in the preparation of a drug for preventing, treating and / or assisting in the treatment of malignant tumors.

[0039] In the specific implementation of the present invention, the malignant tumor includes melanoma.

[0040] In the specific implementation of the present invention, the dosage form of the drug includes injection.

[0041] To further illustrate the present invention, the enhanced TCR-T cells overexpressing CD200 and their applications provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0042] Example 1

[0043] The schematic diagram of the TCR-T structure designed in this embodiment is shown in FIG. Figure 1 The conventional TCR-T plasmid structure contains the EF1α promoter, TCR, and EGFP fluorescent protein. The CD200-overexpressing TCR-T plasmid structure adds the CD200 gene to the aforementioned construct.

[0044] 1. Construction of lentiviral expression plasmid: Obtain TCR-T and CD200 gene expression sequences,

[0045] The nucleotide sequence of the CD200 gene is shown in SEQ ID NO. 1. The nucleotide sequence of the NY-ESO-1 TCR-T gene is shown in SEQ ID NO. 2. The CD200 gene was linked to the TCR-Cβ chain of the TCR gene via E2A. By gene editing in the pIG NY-ESO-1_TCR plasmid, the CD200 gene fragment was knocked in to generate a lentiviral expression plasmid that overexpresses the CD200 gene.

[0046] 2. Lentivirus packaging: HEK293T cells were used as packaging cells and plated at an appropriate cell density (4×10e5 / ml) for 24 h. The transfer plasmid (pLVX), packaging plasmid (psPAX2), and envelope plasmid (PmD2.G) (the mass ratio of the lentiviral expression vector, packaging plasmid, and envelope plasmid was 10:7.5:2.5) were then mixed using lipo3000 transfection reagent (1 tube was added with 625 μl Opti-mem and 45 μl Lipo3000, and another tube was added with 625 μl, 30 μl P3000, and the plasmid mixture. The two tubes were mixed and allowed to stand for 15 min). The cells were then dripped into the cell culture medium. The viruses were collected after incubation in an incubator for 48 h and 72 h, and concentrated using a lentivirus concentration reagent.

[0047] 3. Purification of human peripheral blood T cells: Select healthy volunteers with HLA subtype 02:01, first isolate lymphocytes from human peripheral blood using lymphocyte separation solution, and then use a magnetic bead sorting kit to obtain highly pure CD3+ T cells.

[0048] 4. T cell lentiviral transfection: Activate the highly purified CD3+ T cells obtained in step 3 with pre-coated CD3 / CD28 antibodies for 24 hours. Harvest the activated cells and plate them at 1 × 10e6 cells / well in a 24-well plate. Add viral supernatant at an appropriate MOI and 10 ng / ml polybrene. Centrifuge at room temperature for 2 hours. Four hours after centrifugation, replace the medium with fresh T cell culture medium supplemented with fresh cytokines.

[0049] 5. T cell expansion: Monitor T cell density daily using a Luna counting plate (no more than 3×10e6 / ml). Every two days, split each well into two plates and passage them into 6-well plates. Supplement with cytokines (100 IU / ml IL-2, 12.5 ng / ml IL-7, 25 ng / ml IL-15) to obtain a sufficient number of TCR-T cells.

[0050] Comparative Example 1

[0051] Comparison of cytokine secretion function between the experimental group (overexpressing CD200TCR-T, CD200OE) and the control group (conventional TCR-T cells, control)

[0052] The CD200 TCR-T cells and conventional TCR-T cells prepared by the above method were incubated with PMA and ionomycin (using the Thermo Fisher Scientific kit, catalog number 00-4975-93, at a ratio of 1:500 according to the instructions) in a 37°C incubator for 4 hours. The intracellular IFN-γ and TNF-α staining of the two groups of cells was detected by flow cytometry. The results are shown in Figure 2. Figure 2 、 Figure 3 As shown in Tables 1 and 2, the results show that compared with traditional TCR-T, TCR-T overexpressing CD200 has stronger IFN-γ and TNF-α secretion ability.

[0053] Table 1 IFN-γ secretion by CD200 overexpressing TCR-T and conventional TCR-T cells

[0054] Biological replication <![CDATA[Control (×10 3 )]]> <![CDATA[CD200OE(×10 3 )]]> 1 3.527 5.1978 2 3.324 5.1214 3 3.7372 5.5476 average value 3.5294 5.2889

[0055] Table 2 TNF-α secretion by CD200 overexpressing TCR-T and conventional TCR-T cells

[0056] Biological replication <![CDATA[Control (×10 4 )]]> <![CDATA[CD200OE(×10 4 )]]> 1 4.128 8.696 2 4.408 8.559 3 4.328 8.688 average value 4.288 8.648

[0057] Comparative Example 2

[0058] Comparison of the cytotoxicity between CD200 overexpressing TCR-T (CD200OE) and conventional TCR-T cells (control, CD200Control)

[0059] The NY-ESO-1 gene (NCBI Gene ID: 246100) was cloned into human melanoma A375 to obtain NY-ESO-1-expressing A375 cells (A375-NY-ESO1). A375 and A375-NY-ESO-1 cells were then mixed 1:1 and co-cultured with the CD200-overexpressing TCR-T cells and conventional TCR-T cells prepared by the above method. After 24 hours, the specific killing of the two groups was detected. Figure 4 As shown in Table 3, the results showed that compared with traditional TCR-T, TCR-T overexpressing CD200 has stronger tumor cell killing ability.

[0060] Table 3 Comparison of the killing function of CD200 overexpressing TCR-T and traditional TCR-T cells

[0061] Biological replication Control (%) CD200OE(%) 1 66 87.56 2 64 87.22 3 66.8 85.68 average value 65.6 86.82

[0062] Comparative Example 3

[0063] Comparison of the anti-tumor abilities of CD200-overexpressing TCR-T and conventional TCR-T

[0064] 1.1 Detection of mouse tumor growth

[0065] Based on the experiment in Comparative Example 2, A375-NY-ESO-1 cells were subcutaneously implanted into NSG immunodeficient mice. Twelve days after tumor implantation, CD200-overexpressing TCR-T cells (CD200OE), conventional TCR-T cells (CD200Control), or PBS were infused back into the mice. Five replicates were performed in each group, and tumor volume was measured every 2 to 3 days using a vernier caliper. The experimental results are shown in Figure 2. Figure 5 As shown in Tables 4 to 7, the results showed that compared with traditional TCR-T, CD200 overexpression TCR-T can achieve better anti-tumor effects.

[0066] Table 4 Changes in tumor volume over time after PBS injection into tumor-bearing mice

[0067]

[0068] Table 5 Changes in tumor volume over time in tumor-bearing mice after infusion of conventional TCR-T

[0069]

[0070] Table 6 Changes in tumor volume over time in tumor-bearing mice after transfusion of overexpressed CD200TCR-T cells

[0071]

[0072]

[0073] Table 7 Average tumor volume of tumor-bearing mice in each group over time

[0074]

[0075] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of CD200 in the preparation of a product for enhancing the anti-tumor effect of TCR-T cells, wherein the nucleotide sequence of the gene encoding CD200 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The improvement of the anti-tumor effect of TCR-T cells includes improving the cytokine secretion ability of TCR-T cells and / or inhibiting TCR-T cell exhaustion.

3. The use according to claim 2, characterized in that The cytokines include IFN-γ and / or TNF-α.

4. A fusion gene, characterized in that: It includes a gene encoding a T cell antigen receptor and a gene encoding CD200; the nucleotide sequence of the CD200 encoding gene is shown in SEQ ID NO.

1.

5. The fusion gene according to claim 4, characterized in that The T cell antigen receptor includes TCR Vα chain, TCR Cα chain, P2A, TCR-Vβ chain and TCR-Cβ chain connected in sequence; the gene encoding CD200 is connected to the TCR-Cβ chain through the gene encoding the E2A peptide.

6. A lentiviral expression vector, characterized in that: Contains the fusion gene according to claim 4 or 5.

7. A recombinant lentivirus, characterized in that The lentivirus is prepared by the following method: the lentiviral expression vector, packaging plasmid and envelope plasmid according to claim 6 are mixed and then transfected into packaging cells, and then incubated after transfection to obtain a recombinant lentivirus.

8. An enhanced TCR-T cell, characterized in that A T lymphocyte comprising the lentiviral expression vector according to claim 6 or the recombinant lentivirus according to claim 7.

9. Use of the fusion gene according to claim 4 or 5, the lentiviral expression vector according to claim 6, the recombinant lentivirus according to claim 7, or the enhanced TCR-T cell according to claim 8 in the preparation of a drug for preventing, treating, and / or assisting in the treatment of malignant tumors.

10. The use according to claim 9, characterized in that The malignant tumor includes melanoma.

Images