Bombyx mori four-transmembrane protein gene Tsp E and application thereof

Abstract

The invention provides a silkworm four-transmembrane protein gene Tsp E and application thereof, and belongs to the technical field of bioengineering. Research and analysis find that the silkworm four-transmembrane protein gene TspE is a key gene for silkworm nuclear polyhedrosis virus infection; the expression mode of the silkworm four-transmembrane protein gene TspE is researched and analyzed to determine the specific biological function of the silkworm four-transmembrane protein gene TspE, the influence of the TspE gene on BmNPV infection is determined through experiments such as cell level gene overexpression, RNAi and antibody sealing, and the four-transmembrane protein TspE gene can be used as an effect factor in the process that BmNPV infects host silkworm cells. The method plays a key role in virus invasion and host-virus interaction processes, and has good application in the aspects of BmNPV scientific prevention and control, silkworm molecular improved breeding, resistant variety cultivation and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a silkworm tetraspanin gene Tsp E and an application thereof. Background Art

[0002] The silkworm, a key economic insect and model insect, possesses significant economic and scientific value. Research on the silkworm can provide a theoretical basis for other insects or mammals and also point the way to new directions for the sericulture industry. Bombyx mori nuclear polyhedrovirus (BmNPV) is a pathogen that poses a serious threat to silkworm production. After oral infection, it enters the digestive tract, infecting silkworms and causing blood-borne pustular disease, which can lead to death from suppuration. This disease is rapid and intense, and is highly contagious, making it the most devastating viral disease in silkworm production. Currently, the detailed mechanism by which BmNPV invades host silkworm cells remains unclear, and there are still no effective methods or drugs to control the disease. Therefore, exploring the mechanism of BmNPV invasion has become a research hotspot in the field of silkworm pustular disease prevention and control.

[0003] Because BmNPV poses a serious threat to silkworm production, researchers have been eager to identify key genes that influence silkworm resistance to the virus and, through molecular biotechnology, improve its resistance. Cloning and characterizing the full-length sequence of key genes that influence silkworm resistance has important theoretical and practical implications for elucidating the mechanisms of silkworm resistance and breeding resistant strains for application in silkworm production.

[0004] Tetraspanins are a class of evolutionarily conserved cell membrane proteins that function as channels connecting intracellular and extracellular signals. They play an important role in viral recognition and entry, virion release, and cell signal transduction. Therefore, there is an urgent need to investigate the function of the silkworm tetraspanin E (Tsp E) during BmNPV invasion of host silkworm cells. This is crucial for further understanding the pathogenic mechanism of BmNPV and provides theoretical guidance for the scientific diagnosis and prevention of BmNPV, as well as the breeding of virus-resistant silkworm varieties. Summary of the Invention

[0005] In response to some deficiencies in the prior art, the present invention provides a silkworm tetraspanin gene TspE and an application thereof; through research and analysis, the present invention finds that the silkworm tetraspanin gene TspE is a key gene for silkworm nuclear polyhedrosis virus infection; the present invention studies and analyzes the expression pattern of the silkworm tetraspanin gene TspE to determine its specific biological function, and clarifies the effect of the TspE gene on BmNPV infection through experiments such as gene overexpression, RNAi and antibody blocking at the cellular level. The tetraspanin TspE gene may serve as an effector factor in the process of BmNPV infecting host silkworm cells, and plays a key role in virus invasion and host-virus interaction. It has great application in the scientific prevention and control of BmNPV, molecular improvement breeding of silkworms, and cultivation of resistant varieties.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical means:

[0007] The present invention first provides a silkworm tetraspanin gene TspE, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0008] The present invention also provides the outer loop domain LEL of the silkworm tetraspanin gene TspE, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0009] The present invention also provides a vector comprising the silkworm tetraspanin gene Tsp E; the vector comprises a cloning vector or an overexpression vector.

[0010] Preferably, the cloning vector is obtained by connecting the silkworm tetraspanin gene TspE and the pMD19-T vector to the Kpn I and Xba I restriction sites.

[0011] Preferably, the overexpression vector comprises the silkworm tetraspanin gene Tsp E and the pIZ / V5-mCherry vector; the silkworm tetraspanin gene TspE and the pIZ / V5-mCherry vector are connected between the Kpn I and Xba I restriction enzyme cutting sites.

[0012] The present invention also provides a vector comprising the outer loop domain LEL of the silkworm tetraspanin gene Tsp E, wherein the vector comprises a cloning vector or a prokaryotic expression vector.

[0013] Preferably, the cloning vector comprises a TspE-LEL sequence and a pMD19-T vector; the connection sites between the TspE-LEL and pMD19-T vector are Nco I and Xho I.

[0014] Preferably, the prokaryotic expression vector comprises a TspE-LEL sequence and a pET-28a vector; the connection sites between the TspE-LEL and pET-28a vector are Nco I and Xho I.

[0015] The present invention also provides a recombinant protein, which is expressed and purified by the above-mentioned prokaryotic expression vector, and is denoted as TspE-LEL.

[0016] The present invention also provides the use of the specific antibody of the recombinant protein in preparing a proliferation inhibitor of Bombyx mori nuclear polyhedrosis virus BmNPV.

[0017] Preferably, the method for obtaining the specific antibody comprises: injecting the recombinant protein into a rabbit to obtain a polyclonal antibody that specifically recognizes Tsp E.

[0018] The present invention also provides the use of the knocked-down silkworm tetraspanin gene Tsp E in preparing a transformant resistant to the silkworm nuclear polyhedrosis virus BmNPV.

[0019] Preferably, the application is: designing a targeted siRNA sequence for the silkworm tetraspanin gene TspE to knock down the silkworm tetraspanin gene TspE, and then transforming the sequence into a recipient cell to obtain a transformant.

[0020] Preferably, the nucleotide sequence of the siRNA is shown in SEQ ID NO: 3.

[0021] Preferably, the transformant comprises a silkworm cell or a silkworm individual.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention cloned the tetraspanin gene TspE of the silkworm, and detected by qRT-PCR that the TspE gene showed differential expression in different resistant silkworm varieties after BmNPV infection. The study found that TspE was significantly upregulated in the midgut tissue of silkworms within 48 hours of BmNPV infection, and after virus induction, the upregulation level of this gene in the midgut tissue of susceptible silkworm varieties was significantly higher than that of resistant varieties. This indicates that the tetraspanin TspE plays a key role in BmNPV infection and the host's resistance to viral invasion.

[0024] The present invention shows that the Tsp E gene can significantly promote the infection of BmNPV to host cells through gene overexpression and siRNA-mediated knockdown at the cellular level; injection of Tsp E-LEL recombinant protein can promote the proliferation and spread of BmNPV in silkworms, thereby accelerating the death of susceptible larvae; antibody blocking experiments show that Tsp E can promote the infection and replication of BmNPV in cells. The above experiments show that the tetraspanin TspE gene, as an effector factor in the process of BmNPV infecting host silkworm cells, plays a key role in virus invasion and host-virus interaction. The antiviral ability of silkworms can be improved by knocking down this gene, and polyclonal antibodies that specifically recognize TspE can also be used to prepare a proliferation inhibitor of the silkworm nuclear polyhedrosis virus BmNPV, which is of great significance for combating the silkworm nuclear polyhedrosis virus BmNPV. The present invention provides a theoretical basis for the diagnosis and scientific prevention and control of blood-type pus disease in silkworms, and provides new clues and ideas for molecular breeding and resistant variety cultivation. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Analysis of the temporal expression pattern and induced expression pattern of TspE; in the figure, A is the change in the transcription level of TspE in the midgut tissue at different time points after BmNPV infection detected by qRT-PCR; B is the change in the transcription level of TspE gene in the midgut of susceptible (S) and resistant (R) varieties of silkworms after BmNPV infection; * indicates a significant difference compared with the control group (unpaired t-test; *, p < 0.05; **, p < 0.01; ****p < 0.0001; ns: no significant difference).

[0026] Figure 2 Figure 2: Effects of TspE overexpression in BmN cells on BmNPV infection and replication. Figure A: Fluorescence microscopy of overexpressed and infected BmN cells. White light, white light; mCherry, red light; GFP, green light; Scale bar = 200 μm; B: Analysis of TspE transcription levels at different time points after transfection with the overexpression vector; C: Analysis of VP39 expression levels at different time points after TspE overexpression. * indicates a significant difference compared with the control group (unpaired t-test; ***, p < 0.001; ****, p < 0.0001; ns: not significant).

[0027] Figure 3Figure 2: Effects of knocking down TspE expression in BmN cells on BmNPV infection and replication. Figure A: Fluorescence microscopy of infected BmN cells after TspE knockdown. White light; GFP; Scale bar = 200 μm. Figure B: Analysis of TspE transcription levels 48 hours after siTspE transfection. Figure C: Analysis of VP39 expression levels at different time points after siTspE transfection. * indicates a significant difference compared to the control group (unpaired t-test; ***, p < 0.001; ****, p < 0.0001; ns: not significant).

[0028] Figure 4 The figures show the effect of injection of Tsp E-LEL recombinant protein on the proliferation and spread of BmNPV in silkworms and the antibody blocking experiment; in the figure, A shows the purity detection of Tsp E-LEL recombinant protein; B shows the death of two groups of silkworms after injection of purified Tsp E-LEL recombinant protein (sterile TBS was used as a control); C shows the fluorescence expression level in BmN cells after antibody blocking (addition of anti-Bm Tsp E-LEL) and infection (purified rabbit negative serum was used as a control) observed under a fluorescence microscope; D shows the expression level of viral nucleocapsid protein gene VP39 after antibody blocking; * indicates significant difference compared with the control group (unpaired t-test; **, p < 0.01).

[0029] Figure 5 Schematic diagram of the Tsp E protein structure. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with the accompanying drawings and specific examples, but the scope of protection of the present invention is not limited thereto. It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used are not indicated by manufacturers and are conventional products that can be purchased from the market.

[0031] The silkworm p50, sensitive (S) strain and resistant (R) strain silkworm larvae used in the following examples were obtained from the Sericulture Research Institute of Jiangsu University of Science and Technology.

[0032] Example 1: Temporal expression pattern and inducible expression pattern of the silkworm TspE gene

[0033] In this example, the transcription level of TspE gene in the midgut tissue of the p50 silkworm strain after BmNPV infection at different time points was detected by qRT-PCR. The specific steps are as follows: a number of p50 silkworm strains on the first day of the fifth instar were selected and divided into two groups. The treatment group was treated with BmNPV suspension (1.0×10 8 Larvae from each group were orally infected with fresh mulberry leaves soaked in sterile water (0.84 0 / mL). Larvae from the control and treatment groups were collected 24, 48, 72, and 96 hours after infection, and midgut tissue samples were collected from the larvae in each group.

[0034] Total RNA was extracted from the midgut tissue samples of each group of larvae using TRIzol lysis buffer, and the RNA was reverse transcribed to obtain cDNA using the FastKing RT Kit kit according to the reaction system and procedures in the instructions. The concentration and quality of the cDNA were then detected using a NanoDrop-2000 spectrophotometer and stored at -20°C until use.

[0035] The obtained cDNA was diluted to 100 ng / μL, and then the diluted cDNA was used as a template to design specific primers TspE-qF and TspE-qR. qRT-PCR detection was performed using a LightCycler-96 PCR instrument to analyze the expression pattern of the TspE gene.

[0036] Among them, TspE-qF: 5'-CACATTTACGGCACCATCC-3' (SEQ ID NO: 4);

[0037] TspE-qR: 5'-TGTACCCAGTTACCGAACG-3' (SEQ ID NO: 5);

[0038] The qRT-PCR reaction system is shown in Table 1. The amplification procedure is 95℃ pre-denaturation for 10 min, followed by 40 cycles of 95℃ denaturation for 15 s, 60℃ annealing and extension for 1 min. Each reaction was performed with 3 biological replicates and 2 technical replicates, and 2 -ΔΔCt Methods The relative expression level of each gene was calculated. During the detection process, the silkworm glyceraldehyde-3-phosphate dehydrogenase (BmGAPDH) gene was used as an internal reference to calibrate the total amount of RNA. The detection results are shown in Figure 2. Figure 1 shown.

[0039] Table 1. qRT-PCR reaction system

[0040]

[0041]

[0042] from Figure 1 It can be seen that compared with the control group (p50 silkworms not infected with the virus), the transcription level of the TspE gene in the midgut of the p50 silkworms in the treated group was significantly increased at 24h and 48h after BmNPV infection; while at 72h and 96h after infection, there was no significant difference in the transcription level of the gene in the midgut tissues of the two groups of silkworms ( Figure 1 -A).

[0043] This example also uses qRT-PCR to detect the transcription level of the TspE gene in the midgut tissues of sensitive (S) and resistant (R) strains of silkworm larvae after BmNPV infection. The specific steps are as follows:

[0044] The above method was used to use BmNPV suspension (1.0×10 8 OB / mL) were used to infect sensitive (S) and resistant (R) silkworm larvae. 48 hours after infection, the sensitive (S) and resistant (R) silkworm larvae were dissected and their midgut tissues were collected. Total RNA and cDNA from the sensitive midgut tissues were extracted using the above method, and qRT-PCR was performed according to the above description. The test results are shown in Figure 2. Figure 1 shown.

[0045] As can be seen from the figure, compared with the control group (resistant or susceptible silkworm varieties not infected with the virus), 48 hours after BmNPV infection, the transcription level of the TspE gene in the midgut of the susceptible variety (S) was significantly increased, while the transcription level in the above tissues of the resistant variety (R) was slightly decreased and significantly lower than that of the susceptible variety ( Figure 1 -B).

[0046] In summary, the TspE gene was significantly upregulated in the midgut tissue of silkworms within 48 hours of BmNPV infection, and after virus induction, the upregulation level of this gene in the midgut tissue of susceptible silkworm varieties was significantly higher than that in resistant varieties, indicating that the tetraspanin Tsp E may play a key role in BmNPV infection and the host's resistance to viral invasion.

[0047] Example 2: Obtaining the CDS sequence of the silkworm TspE gene, constructing the TspE-LEL prokaryotic expression vector, and expressing and purifying the recombinant protein

[0048] (1) Obtaining the CDS sequence of the silkworm TspE gene

[0049] Specific primers Tsp EF and Tsp ER were designed based on the TspE gene and the multiple cloning site on the pMD19-T vector. PCR amplification was performed using the cDNA of the midgut tissue of Bombyx mori p50 obtained in Example 1 as a template. The PCR amplification system is shown in Table 2.

[0050] in,

[0051] Tsp EF: TAGGTACCATGGGATGTGGAACGAG (SEQ ID NO: 6); Tsp ER: TATCTAGACCGTAGCGTGACCTTCTGTC (SEQ ID NO: 7);

[0052] The PCR reaction procedure was as follows: pre-denaturation at 94°C for 3 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s, and finally extension at 72°C for 10 min. The PCR product was recovered and ligated with the pMD19-T vector (purchased from TaKaRa), transformed into DH5α competent cells (purchased from TaKaRa), and the positive clones were obtained and sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the CDS sequence of the TspE gene was successfully cloned, as shown in SEQ ID NO: 1, and a T clone containing the target gene TspE was obtained.

[0053] Table 2. PCR amplification system

[0054] Sample name Sample addition amount <![CDATA[ddH2O]]> 31μL Midgut cDNA (100 ng / μL) 1.5 μL Primer F 2μL Primer R 2μL LATaq 0.5μL 10×LATaqBuffer 5μL dNTPMixture 8μL

[0055] (2) Obtaining Tsp E-LEL recombinant protein

[0056] TMHMM-2.0 was used to predict the transmembrane region of the Tsp E sequence. Figure 5 As shown, the full-length encoded protein is divided into an inner loop (SIL) and two outer loops, of which the main outer loop structure region is from 107 to 202 amino acids, called the extracellular large loop (LEL), and the other is the extracellular small loop (SEL). The extracellular large loop (LEL) domain contains important amino acid motifs and cysteine residues, of which the four cysteines are highly conserved in different species, indicating that the LEL domain of Tsp E plays an important role in its protein function. Considering the difficulty of expressing transmembrane proteins and the domain function of Tsp E, the LEL region of the Tsp E protein was intercepted to construct a prokaryotic expression vector for expression and purification to obtain the recombinant protein Tsp E-LEL. The specific steps are as follows:

[0057] Based on the expected recombinant protein Tsp E-LEL sequence and the multiple cloning site of the pET-28a vector, Nco I and Xho I restriction sites were selected. Specific primers Tsp E-LEL-F and Tsp E-LEL-R were designed. PCR amplification was performed using the p50 silkworm cDNA from Example 1 as a template, using the same reaction system and procedure as in Example 1. The PCR product was sequenced at Zhejiang Shangya Biotechnology Co., Ltd., and the correctly sequenced target fragment was then digested and ligated with the empty pET-28a plasmid. The digestion and ligation systems are shown in Tables 3 and 4.

[0058] Among them, Tsp E-LEL-F: 5′-CCCATGGGCGAGAGCATCAAGG-3′ (SEQ ID NO: 8);

[0059] Tsp E-LEL-R: 5'-CCTCGAGAGGCTTGTTCC-3' (SEQ ID NO: 9).

[0060] Table 3. Double enzyme digestion system

[0061] Sample name Sample addition amount TspE-LEL-pMD19-T / pET-28a vector 2 μg NcoⅠ endonuclease 2μL XhoⅠ endonuclease 2μL 10×KBuffer 5μL 0.1% BSA 2μL <![CDATA[ddH2O]]> up to 50 μL

[0062] Table 4. Connection system

[0063] Sample name Sample addition amount TspE-LEL digestion products 8μL pET-28a vector digestion products 2μL 10×T4 DNA Ligation Buffer 2μL T4 DNA ligase 1 μL <![CDATA[ddH2O]]> 7μL

[0064] The ligation product was ligated overnight at 16°C and transformed into E. coli BL21 (DE3) competent cells (purchased from TaKaRa) for recombinant protein expression. The recombinant protein was purified using nickel agarose gel affinity chromatography, and its purity was finally detected by Western Blot using anti-His. The results showed that the purified Tsp E-LEL recombinant protein was detected by anti-His and a specific band was obtained at around 12kDa of the protein marker, which was consistent with the theoretical prediction value and can be used for subsequent injection experiments and antibody preparation. Figure 4 A).

[0065] Example 3: Effect of the silkworm TspE gene on BmNPV infection

[0066] (1) Construction of TspE gene overexpression vector and synthesis of siRNA:

[0067] The T clone containing the target gene TspE obtained in Example 2 and the pIZT / V5-mCherry empty plasmid were double-digested with KpnⅠ and XbaⅠ, respectively, at 37°C for more than 4 hours. The enzyme digestion system is shown in Table 5. After the enzyme digestion, the target fragment and vector were recovered and ligated with T4 ligase. The ligation system is shown in Table 6.

[0068] Table 5. Double enzyme digestion system

[0069] Sample name Sample addition amount TspE-pMD19-T / pIZT / V5-His-mCherry 2 μg KpnⅠ endonuclease 2μL XbaⅠ endonuclease 2μL 10×MBuffer 5μL <![CDATA[ddH2O]]> up to 50 μL

[0070] Table 6. Connection system

[0071] Sample name Sample addition amount TspE digestion products 8μL pIZT / V5-His-mCherry vector digestion product 2μL 10×T4 DNA Ligation Buffer 2μL T4 DNA ligase 1 μL <![CDATA[ddH2O]]> 7μL

[0072] The ligation product was transformed into DH5α competent cells, and double enzyme digestion verification was performed after obtaining positive clones. The correct recombinant plasmid was verified to be the TspE gene overexpression vector, which was named pIZT / V5-mCherry-Tsp E. In addition, small interfering RNA (siRNA) specifically targeting the TspE gene was designed by Suzhou Genema Gene Co., Ltd., and disordered single-stranded small RNA (siNC) was used as a negative control.

[0073] Among them, siRNA: 5'-GGUGAUCAUCAUUGUGCAATT-3' (SEQ ID NO: 3);

[0074] siNC: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 10).

[0075] (2) Transfection and BmNPV infection:

[0076] The Tsp E gene overexpression vector pIZT / V5-mCherry-Tsp E and siRNA constructed in step (1) were transfected according to the instructions of GP-transfect-Mate transfection reagent. The Tsp E gene overexpression vector was used as the experimental group, and the siRNA was used as the control group.

[0077] The specific method is: Bombyx mori BmN cells (purchased from Qingqi (Shanghai) Biotechnology Development Co., Ltd.) were cultured at 28°C in TC-100 culture medium containing 10% fetal bovine serum, 100 μg / mL penicillin and 100 μg / mL streptomycin, and then the well-grown BmN cells were evenly spread on a 12-well plate. When the cell density reached 60%, 1.5 μg of TspE gene overexpression vector or siRNA (80 pmol) was mixed with 4 μL of transfection agent through serum-free TC-100 to prepare 100 μL of TspE gene overexpression vector dilution or siRNA dilution, respectively. Then, the transfection reagent dilution was slowly added to the TspE gene overexpression vector dilution and siRNA dilution, respectively, and the mixture was allowed to stand for 15 minutes before transfection. After 4-6 hours of transfection, the complete culture medium was replaced. Cells transfected with overexpressing empty vector or siNC were used as controls, and finally TspE overexpression and knockdown cell lines were established. 24 hours after transfection, equal amounts of recombinant baculovirus BmNPV-EGFP expressing enhanced green fluorescent protein (EGFP) were added to each well of the experimental and control groups for infection. The distribution of green fluorescent protein in BmNPV cells was observed and recorded using an inverted research-grade fluorescence microscope 24 hours, 48 hours, and 72 hours after infection. The distribution results are shown in Figure 2. Figure 2 After that, the cell culture medium was removed, and the attached BmN cells were resuspended in PBS and centrifuged at 1000 g for 5 min to collect BmN cells at different time points for subsequent use.

[0078] (3) Extraction of total cell RNA and genomic DNA:

[0079] The method for extracting total RNA from cells was referred to the method in Example 1 above, and reverse transcription was performed to obtain cDNA. In addition, the collected BmN cells were subjected to cell genome extraction using DNA extraction buffer. After thorough mixing, the supernatant was collected by centrifugation at 12000rpm for 5min, and an equal volume of saturated phenol solution (pH = 7.4) was added and shaken to mix. The supernatant was taken after centrifugation at 12000rpm for 10min, and then an equal volume of chloroform: isoamyl alcohol (24:1) mixture was added and thoroughly mixed. The supernatant was taken after centrifugation at 12000rpm for 15min, and then 2 volumes of anhydrous ethanol and 0.1 volumes of NaAc (3M) were added to promote precipitation at -20°C. After removing the supernatant, the supernatant was washed twice with 75% ethanol and dried. Finally, ddH2O was added to dissolve the supernatant to obtain cell genomic DNA, which was stored at -20°C for later use.

[0080] (4) Analysis of TspE and VP39 expression levels by quantitative PCR (qRT-PCR):

[0081] The cDNA obtained above was used as a template, and the primers in Example 1 were used to detect the expression level of TspE by qRT-PCR technology. Using the cell genomic DNA as a template, specific primers for the nucleocapsid protein gene VP39 expressed in the late stage of BmNPV were designed to detect the relative expression of the virus. The specific reaction system and program settings are shown in Example 1. The silkworm glyceraldehyde-3-phosphate dehydrogenase (BmGAPDH) gene was used as an internal reference, and the relative expression of each gene was expressed using 2 -ΔΔCt The calculation is performed by the method. The result is as follows Figure 2 shown.

[0082] The sequences of the specific primers are:

[0083] VP39-qF: 5'-CAACTTTTTGCGAAACGACTT-3' (SEQ ID NO: 11);

[0084] VP39-qR: 5'-GGCTACACCTCCACTTGCTT-3' (SEQ ID NO: 12);

[0085] GAPDH-qF: 5'-TTCATGCCACAACTGCTACA-3' (SEQ ID NO: 13);

[0086] GAPDH-qR: 5'-AGTCAGCTTGCCATTAAGAG-3' (SEQ ID NO: 14).

[0087] from Figure 2 It can be seen that after 48h and 72h of virus infection, the green fluorescence distribution density of the treatment group was significantly higher than that of the control group ( Figure 2 A); In addition, the relative transcription level of TspE and the relative viral load in each group of cells were detected by qRT-PCR. The results showed that the transcription level of TspE in the treatment group was significantly increased compared with the control group 48h and 72h after virus infection ( Figure 2 B).

[0088] (5) Effect of overexpression of TspE gene on BmNPV infection:

[0089] To determine the effect of the Tsp E gene on viral infection, a BmN cell line overexpressing Tsp E was established by the method described in Example 2. The recombinant baculovirus BmNPV-EGFP (donated by Professor Xia Dingguo from the Institute of Sericulture, Jiangsu University of Science and Technology) was then added to infect the cells. The expression of green fluorescence in the cells was observed under a fluorescence microscope at different time points after infection. The results showed that the expression level of the BmNPV virus VP39 gene was significantly increased compared with the control group ( Figure 2C) In summary, overexpression of the TspE gene at the cellular level can promote the infection and replication of BmNPV.

[0090] (6) Effect of siRNA-mediated knockdown of the TspE gene on BmNPV infection:

[0091] To further verify the above experimental results, a TspE knockdown BmN cell line was established by transfecting siRNA targeting the TspE gene into BmN cells. Then, the recombinant baculovirus BmNPV-EGFP was added to infect the cells. The expression of green fluorescence in the cells was observed under a fluorescence microscope at different time points after infection. The results are shown in Figure 2. Figure 3 As shown in the figure, 72 hours after infection, the green fluorescence distribution density in the treated group cells decreased significantly compared with the control group ( Figure 3 A); In addition, the relative transcription level of Tsp E and the relative viral load in each group of cells were detected by qRT-PCR. The results showed that the transcription level of Tsp E gene in cells was significantly reduced after transfection with siTspE ( Figure 3 B), the expression level of VP39 was also significantly decreased compared with the control group 48h and 72h after virus infection ( Figure 3 C), indicating that siRNA-mediated knockdown of the Tsp E gene leads to a decrease in the ability of the virus to infect and replicate in cells.

[0092] Example 4: Double verification of the effect of Tsp E on BmNPV infection by injection of Tsp E-LEL recombinant protein and antibody blocking experiment

[0093] (1) Effect of injection of Tsp E-LEL recombinant protein on BmNPV infection:

[0094] The oral administration method was used to test the BmNPV (1.0×10 8 OB / mL) were used to infect p50 silkworm larvae. 24 h after virus infection, 2 μL of the purified Tsp E-LEL recombinant protein obtained in Example 2 (500 ng / μL) was injected into each p50 silkworm larvae. Sterile TBS was used as a control (30 silkworm larvae per group, repeated 3 times). Afterwards, fresh mulberry leaves were fed and artificially raised in the same growth environment of 26±1°C, relative humidity of 75%, and a 12h day and night cycle. The growth, development, and mortality of the two groups of silkworms were observed and recorded. The results showed that compared with the control group, the mortality rate of the silkworm larvae injected with the Tsp E-LEL recombinant protein increased significantly ( Figure 4 B) indicates that Tsp E-LEL protein can enhance the proliferation and spread of BmNPV in silkworms, thereby accelerating the disease-induced death of silkworms.

[0095] (2) Effect of antibody blocking Tsp E protein on BmNPV infection:

[0096] To further verify the role of TspE in the process of BmNPV infecting cells, the purified Tsp E-LEL recombinant protein obtained in Example 2 was used to immunize rabbits to obtain polyclonal antibodies that specifically recognize Tsp E. Then, well-grown BmN cells were evenly plated on a 12-well plate. When the cell density reached 70%, the prepared rabbit polyclonal antibody to Tsp E-LEL (50 μg / mL) was used to incubate the BmN cells at 28°C, and a rabbit negative antibody was used as a control. After incubation for 2 hours, equal amounts of BmNPV-EGFP were added for infection. After 72 hours of viral infection, the fluorescence distribution in the BmN cells was observed and analyzed under an inverted fluorescence microscope. The cells were then collected and the cell genome was extracted according to the method in Example 3, and qRT-PCR was performed to determine the relative expression of viral DNA in each group of cells.

[0097] The results showed that compared with the control group, after antibody blocking, the green fluorescence intensity in the treated group cells was weaker than that in the control group, and the transcription level of VP39 in the treated group cells was significantly decreased ( Figure 4 C, 4D), further verifying that Tsp E promotes the infection of BmNPV.

[0098] In summary, cellular gene overexpression and siRNA-mediated knockdown demonstrated that the TspE gene significantly promoted BmNPV infection of host cells. Furthermore, injection of the TspE-LEL recombinant protein promoted the proliferation and spread of BmNPV in silkworms, accelerating the death of infected larvae. Antibody blocking experiments demonstrated that the tetraspanin TspE participates in BmNPV infection on the host cell surface.

[0099] The present invention has found through research and analysis that the silkworm tetraspanin gene Tsp E is a key gene for silkworm nuclear polyhedrosis virus infection; the present invention studies and analyzes the expression pattern of the silkworm tetraspanin gene TspE to determine its specific biological function, and through experiments such as gene overexpression, RNAi and antibody blocking at the cellular level, the effect of the TspE gene on BmNPV infection is clarified. The tetraspanin TspE gene may serve as an effector factor in the process of BmNPV infecting host silkworm cells, playing a key role in virus invasion and host-virus interaction. The gene can be knocked down by siRNA to improve the antiviral ability of silkworms, and the prepared polyclonal antibody that specifically recognizes Tsp E can also be used as a proliferation inhibitor of silkworm nuclear polyhedrosis virus BmNPV. The above invention will have good application prospects in the scientific prevention and control of BmNPV, molecular improvement breeding of silkworms, and cultivation of resistant varieties.

[0100] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. A silkworm tetraspanin gene TspE, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. The outer loop domain LEL of the silkworm tetraspanin gene TspE according to claim 1, whose nucleotide sequence is shown in SEQ ID NO:

2.

3. A vector comprising the silkworm tetraspanin gene Tsp E according to claim 1, wherein the vector comprises a cloning vector or an overexpression vector.

4. The carrier according to claim 3, characterized in that The cloning vector is obtained by connecting the silkworm tetraspanin gene TspE and the pMD19-T vector at the Kpn I and Xba I restriction sites; The overexpression vector comprises a silkworm tetraspanin gene Tsp E and a pIZ / V5-mCherry vector; the silkworm tetraspanin gene Tsp E and the pIZ / V5-mCherry vector are connected between Kpn I and Xba I restriction enzyme cutting sites.

5. A vector comprising the outer loop domain LEL of the silkworm tetraspanin gene Tsp E, wherein the vector comprises a cloning vector or a prokaryotic expression vector.

6. The carrier according to claim 5, characterized in that The cloning vector comprises a Tsp E-LEL sequence and a pMD19-T vector; the connection sites between the Tsp E-LEL and pMD19-T vector are Nco I and Xho I; The prokaryotic expression vector comprises a TspE-LEL sequence and a pET-28a vector; the connection sites of the TspE-LEL and the pET-28a vector are Nco I and Xho I.

7. A recombinant protein, characterized in that The recombinant protein is expressed and purified by the prokaryotic expression vector according to claim 5.

8. Use of the specific antibody against the recombinant protein according to claim 7 in the preparation of a proliferation inhibitor of Bombyx mori nuclear polyhedrosis virus (BmNPV).

9. Use of the silkworm tetraspanin gene Tsp E knocked down according to claim 1 in preparing a transformant resistant to Bombyx mori nuclear polyhedrosis virus (BmNPV).

10. The use according to claim 9, characterized in that The transformant includes a silkworm cell or a silkworm individual.

Images