AcBBX19 gene and its application in regulating fruit ester aroma

Abstract

This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the AcBBX19 gene and its application in regulating ester aroma in fruits. This invention provides a kiwifruit AcBBX19 gene related to ester aroma formation and its encoded protein, and constructs corresponding overexpression and silencing vectors for transfection into kiwifruit fruits. Results show that overexpression and silencing of the AcBBX19 gene, respectively, can reduce and increase the content of ester aroma in kiwifruit fruits. The kiwifruit AcBBX19 gene described in this invention can regulate the formation of ester aroma. This invention has significant application value in the precise creation of new, storage-resistant kiwifruit germplasm through genetic improvement.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to the AcBBX19 gene and its application in regulating the ester aroma of fruits. Background Technology

[0002] When kiwifruit is unripe, its aroma components are mainly C6 alcohols and aldehydes. As the fruit ripens and softens, the content of aldehydes and alcohols gradually decreases, while the content of ester aroma components such as methyl butyrate, ethyl butyrate, and ethyl acetate rapidly increases. Kiwifruit aroma synthesis mainly relies on the fatty acid metabolism pathway, which involves two key pathways: lipoxygenase and β-oxidation. Fatty acids in the fruit are catalyzed by fatty acid desaturases to produce unsaturated fatty acids such as linoleic acid and linolenic acid. The 1,4-isoprene structure of these unsaturated fatty acids is recognized by lipoxygenases and oxidized to produce peroxyhydroxy fatty acids. These peroxyhydroxy fatty acids are then cleaved into oxyacids and aldehydes by hydroperoxide lyases. Ethanol dehydrogenases then reduce the aldehydes to their corresponding alcohols, which are then catalyzed by alcohol acyltransferases to produce their corresponding esters. Simultaneously, fatty acids can also produce C6 and C9 acids through β-oxidation. These acids, under the action of reductases, generate corresponding aldehydes. Under the action of alcohol dehydrogenase, the aldehydes are catalyzed into corresponding alcohols, and then, under the action of alcohol acyltransferases, ester aroma compounds are generated. During the post-harvest ripening process of kiwifruit, the content of ester aroma compounds shows a significant upward trend. This process is accompanied by the enhancement of the activities of lipoxygenase, hydroperoxide lyase, alcohol dehydrogenase, and alcohol acyltransferase, with the activity of alcohol acyltransferase showing the most significant increase.

[0003] B-box proteins, abbreviated as BBX, are a group of zinc finger transcription factors. BBX proteins play a crucial role in regulatory networks controlling various growth and development processes. Recent studies have revealed additional roles of BBX proteins in various biological processes, including anthocyanin accumulation, carotenoid biosynthesis, and fruit ripening and softening. However, research on the influence of BBX proteins on fruit aroma synthesis is still scarce. Therefore, clarifying the regulatory mechanism of the AcBBX19 gene provides an important breakthrough for the precise creation of new, storage-resistant kiwifruit germplasm through genetic improvement. Summary of the Invention

[0004] The purpose of this invention is to provide the AcBBX19 gene and its application in regulating the aroma of fruit esters.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] This invention provides a kiwifruit AcBBX19 gene that regulates the ester aroma of the fruit, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0007] This invention cloned the differential gene AcBBX19 related to ester formation in kiwifruit and found that transient overexpression of the AcAAT1 gene in red kiwifruit can reduce the content of ester aroma compounds, while transient silencing of the AcAAT1 gene can increase the content of ester aroma compounds.

[0008] The present invention also provides a recombinant overexpression vector containing the above-mentioned kiwifruit AcBBX19 gene.

[0009] The present invention also provides a recombinant cell comprising the above-described recombinant overexpression vector.

[0010] The present invention also provides a recombinant transient silencing vector containing a specific fragment for silencing the kiwifruit AcBBX19 gene.

[0011] The present invention also provides the application of the kiwifruit AcBBX19 gene in regulating the formation of ester aroma in kiwifruit fruit.

[0012] Furthermore, the content of ester aroma compounds in kiwifruit was reduced by increasing the expression of the AcBBX19 gene.

[0013] Furthermore, the content of ester aroma compounds in kiwifruit was increased by reducing the expression of the AcBBX19 gene.

[0014] The present invention also provides the application of the recombinant overexpression vector and the recombinant cells in reducing the formation of ester aroma compounds in kiwifruit.

[0015] The present invention also provides the application of the recombinant transient silencing carrier in promoting the formation of ester aroma substances in kiwifruit.

[0016] The present invention has the following beneficial effects:

[0017] This invention provides a kiwifruit AcBBX19 gene and its encoded protein related to the formation of ester aroma compounds. An overexpression vector and a transient silencing vector for the kiwifruit AcBBX19 gene were constructed. These vectors were then transferred into kiwifruit fruits using Agrobacterium-mediated transformation. Results showed that overexpression or silencing of the kiwifruit AcBBX19 gene, respectively, reduced or increased the content of ester aroma compounds in the kiwifruit fruit. Therefore, the kiwifruit AcBBX19 gene described in this invention can regulate the formation of ester aroma compounds. This invention utilizes genetic engineering technology, providing a theoretical basis and technical means for the precise creation of new, storage-resistant kiwifruit germplasm through genetic improvement, and has significant application value. Attached Figure Description

[0018] Figure 1 The image shows the PCR amplification results of the AcBBX19 gene.

[0019] Figure 2 The graph shows the postharvest ester aroma content and AcBBX19 expression level of kiwifruit.

[0020] Figure 3 The images show the results of transient overexpression and silencing of the AcBBX19 gene in kiwifruit. A represents the identification of AcBBX19 expression level in kiwifruit with transient overexpression; B represents the analysis of ester aroma content in kiwifruit with transient overexpression; C represents the identification of AcBBX19 expression level in kiwifruit with transient silencing; and D represents the analysis of ester aroma content in kiwifruit with transient silencing.

[0021] Figure 4 Figure 1 shows the results of a yeast one-hybrid experiment demonstrating the binding of the kiwifruit transcription factor AcBBX19 and the ester aroma-forming gene AcAAT1 to their promoters.

[0022] Figure 5 This diagram illustrates the results of the kiwifruit transcription factor AcBBX19 inhibiting the promoter activity of the ester aroma-forming gene AcAAT1. Different lowercase letters indicate significant differences between groups. p <0.05. Detailed Implementation

[0023] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.

[0024] Example 1: Obtaining the AcBBX19 gene sequence.

[0025] Total RNA was extracted from the pulp of *Actinidia chinensis* using a polysaccharide and polyphenol plant total RNA extraction kit. The RNA was then reverse transcribed into cDNA using a PrimeScript-RT-reagent-kit reverse transcription kit. Using the obtained cDNA as a template, AcBBX19 full-length amplification primers were designed, and PCR amplification was performed using a high-fidelity PCR enzyme. The AcBBX19 full-length amplification primers are shown in Table 1.

[0026] Table 1: Primers for AcBBX19 full-length sequence amplification

[0027]

[0028] The PCR amplification system is shown in Table 2.

[0029] Table 2: PCR amplification system

[0030]

[0031] The PCR amplification program was as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 10 s; 55℃ annealing for 30 s; 72℃ extension for 30 s; return to step 2 for 34 cycles; 72℃ final extension for 7 min; store at 4℃.

[0032] The products obtained from PCR amplification were detected by agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the specific band obtained is the kiwifruit AcBBX19 gene. After purification and recovery of the PCR product, it was ligated into a TA cloning vector and transformed into E. coli competent cells DH5α. Positive clones were screened and sequenced. The sequencing results showed that the AcBBX19 gene is 633 bp in length and encodes 210 amino acids. The AcBBX19 gene sequence is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4.

[0033] SEQ ID NO.3: ATGAGAACGCTTTGCGACGTTTGTGAGAGCGCCGCCGCGATCCTCTTCTGCGCGGCCGACGAGGCTGCTCTTTGCCGTTCTTGCGACGATAAGGTTCATATGTGTAACAAGCTTGCTAGTCGTCATGTACGTGTTGGGCTAGCTAGCCCTAGTGATGTTCCCCGGTGTGACATATGTGAAAATGCACCTGCTTTCTTCTACTGCGAGGTCGATGGTACTTCCCTTTGTCTGCAATGTGATATGATTGTACATGTTGGGGGTAAAAGAACACATGAAAGATACCTCCTAATGAGGCAGAGAGTTGAGTTTCCAGGTGATAAACCTAGTTGCATTGATGAGCTAGGTCCACAACCTTGTGAAGTGGGTCAAATTAGGAGGGAACAAAATCAGCTACGTAGGCCTACAATGAGAGAGAACCAGCAAAATCACATGGTGTCTGCTGTTCCAGTGCTAGACTCAAATATTGGTGGCAAGATAGAGAATAGAATGATTGATCTTAATGCCAAGCCCCAACGTCCACATGGGCAGGCTTCAAACAATCAGGAACAAGGAATGGTTGTTCAAAGTGAGGCTAATCATGAATCTTCTGGAGTGGTTCCTATTGGATCCTTCAAGAGAGAGCTTGAGAAGTGA。

[0034] SEQ ID NO.4: MRTLCDVCESAAAILFCAADEAALCRSCDDKVHMCNKLASRHVRVGLASPSDVPRCDICENAPAFFYCEVDGTSLCLQCDMIVHVGGKRTHERYLLMRQRVEFPGDKPSCIDELGPQPCEVGQIRREQNQLRRPTMRENQQNHMVSAVPVLDSNIGGKIENRMIDLNAKPQRPHGQASNNQEQGMVVQSEANHESSGVVPIGSFKRELEK。

[0035] Example 2: AcBBX19 gene expression analysis.

[0036] The content of ester aroma and the expression of AcBBX19 gene were measured in Donghong kiwifruit on days 0, 2, 4, 6, 8 and 10 after harvest.

[0037] Approximately 0.5 g of kiwi fruit sample was taken from a -80°C cryogenic freezer, ground into a fine powder using liquid nitrogen, and placed in a 20 mL headspace vial. A saturated sodium chloride solution (0.4 g / mL) and 20 µL of 3-hexanone solution (10 µg / mL) were added to the vial. The vial was immediately sealed with a PTFE / silicone gasket, and the sample was extracted using an automated headspace solid-phase microextraction (HS-MS) system for GC-MS analysis. The vial was placed in a magnetic stirrer and shaken at 60°C for 5 min. Then, a 120 µm DVB / CARWR / PDMS extractor was inserted into the vial, and adsorption and extraction were performed at 60°C for 15 min, followed by desorption at 250°C for 5 min. Volatile organic compounds were then separated and identified using a triple quadrupole gas chromatography-mass spectrometry (GC-MS) system. The system conditions were a DB-5MS capillary column with dimensions of 30 m × 0.25 mm × 0.25 µm. High-purity helium (99.999% purity) was used as the carrier gas at a constant flow rate of 1.2 mL / min. The inlet temperature was set to 250℃, with splitless injection and a solvent delay time of 3.5 min. A programmed temperature ramp was then employed: the temperature was initially held at 40℃ for 3.5 min, then increased to 100℃ at a rate of 10℃ / min. This was followed by a ramp to 180℃ at 7℃ / min, and finally a rapid ramp to 280℃ at 25℃ / min, followed by a hold for 5 min. Mass spectrometry utilized an electron impact ion source with a temperature set to 230℃, a quadrupole temperature of 150℃, a mass spectrometer interface temperature of 280℃, and an electron energy of 70 eV, using ion detection mode. The raw data from the mass spectrometry analysis were processed using MassHunter software for qualitative and quantitative analysis. The relative content of ester compounds in the sample was determined by comparing the electron ionization mass spectrometry results of ester compounds with the results of the NIST-2017 mass spectrometry library and the retention time of standards.

[0038] qRT-PCR analysis was performed using a CFX196-Touch real-time PCR instrument. A 10µL reaction system was used, consisting of 3.4µL ddH2O, 0.3µL each of specific forward and reverse primers, 5µL of 2×Realtime-PCR-Super-mix, and 1µL of template DNA added sequentially to an RNase-free centrifuge tube. The specific reaction program was: 95℃, 30s; 95℃, 5s; 60℃, 30s; 72℃, 45s, repeated for 40 cycles. Relative gene expression levels were expressed as -2... △△Ct This indicates that a total of three biological replicates were performed. Specific upstream and downstream primers are shown in Table 3.

[0039] Table 3: qPCR primer sequences

[0040]

[0041] The results are as follows Figure 2 As shown, as the Donghong kiwifruit ripens and softens after harvest, the content of ester aroma substances in the fruit gradually increases, while the relative expression level of AcBBX19 gradually decreases, showing a negative correlation between the two.

[0042] Example 3: Functional study of the AcBBX19 gene.

[0043] I. Kiwi fruit with AcBBX19 gene overexpression.

[0044] 1. Overexpression vector construction: The sequence of SEQ ID NO.3 was inserted into the overexpression vector PBI121 using a one-step rapid cloning kit. Nde I and BamH Between the I restriction sites, the AcBBX19-PBI121 overexpression recombinant plasmid was obtained, and the PBI121 empty vector and AcBBX19-PBI121 were transformed into Agrobacterium competent cells GV3101 by freeze-thaw method.

[0045] 2. Experimental Method: Transfer the transformed Agrobacterium to 1 mL of LB liquid medium containing kanamycin resistance and incubate overnight at 28°C with gentle shaking. The next day, transfer 0.2 mL of Agrobacterium to 6 mL of LB liquid medium and incubate at 28°C with shaking for 9 hours to allow OD to develop. 600 The OD value reached 0.8. At room temperature, the bacterial cells were collected by centrifugation at 4000 rpm for 10 min. After resuspending the bacterial cells, the OD value was adjusted to 0.8, and the resuspended Agrobacterium was allowed to stand for approximately 3 hours. Bacterial solutions containing the PBI121 empty vector and the AcBBX19-PBI121 plasmid were injected into the central column of Donghong kiwifruit fruits on the day of harvest. The SK group was injected with bacterial solution containing the PBI121 empty vector plasmid, and the AcBBX19-OE group was injected with bacterial solution containing the AcBBX19-PBI121 plasmid. 0.2 mL of bacterial solution was injected into each fruit. The expression level of the AcBBX19 gene and the content of ester aroma compounds in the injected area were measured 3 days after injection.

[0046] 3. Experimental results: such as Figure 3 As shown in Figure A, after overexpression of the AcBBX19 gene in kiwifruit, the relative expression level of AcBBX19 increased significantly, indicating successful gene overexpression. The content of total ester aroma compounds in fruits overexpressing the AcBBX19 gene was measured, such as... Figure 3 As shown in B, overexpression of the AcBBX19 gene significantly reduced the content of esters.

[0047] II. Kiwi fruit with transient AcBBX19 gene silencing.

[0048] 1. Construction of the VIGS silencing vector: A specific 442bp fragment was obtained from the sequence SEQ ID NO.3, the sequence of which is shown in SEQ ID NO.9, and inserted into the pTRV2 vector. BamH I and Xba Between the two restriction enzyme sites, the AcBBX19-pTRV2 recombinant plasmid was obtained. The pTRV1+pTRV2 group was formed by mixing pTRV1 and pTRV2 at a mass ratio of 1:1 and then transforming them into Agrobacterium competent cells GV3101 via the freeze-thaw method. The pTRV1+AcBBX19-pTRV2 group was formed by mixing pTRV1 and AcBBX19-pTRV2 at a mass ratio of 1:1 and then transforming them into Agrobacterium competent cells GV3101 via the freeze-thaw method.

[0049] SEQ ID NO.9: TCCCGAGGAATCCAATGCTGAACCACGAGTTTTCTCATGCAACTATTGTCAAAGAAAATTCTTCAGTTCACAAGCACTTGGAGGGCACCAAAATGCTCACAAGAGAGAGGACTCTAGCAAAAAGAGGACTTAAAATAGGGTCACCTCTCGGGCACTCCCACTCATACCATCAGCAGCACCACTATTCTAGCATGTCTAGTCTTCCTCTCCATGGTGC TTATAATAGGAGTCTTGGAATTCAAGTCCACTCAATGATCCATAAACCCTCTTATATACCAAGTTCTTCTGGGATTAGGGGTATTTATGGACATGGTGGATGGTTTAGGCATCCGATTGACCAACAACCAGCTATAGGGAAGCTAGCAGCAGAGAGTTGCCATGGAAATTCATCAACAGGACTGTCAACTCAAGGCAGAGCCGGTAGATTCGGCACGGTAAGG.

[0050] 2. Experimental Methods: Bacterial solutions from the pTRV1+pTRV2 group and the pTRV1+AcBBX19-pTRV2 group were injected into the central column of kiwifruit fruits harvested on the same day, with 0.2 mL of bacterial solution injected into each fruit. The expression level of the AcBBX19 gene and the content of ester aroma compounds at the injection site were measured 3 days after injection.

[0051] 3. Experimental results: such as Figure 3As shown in C, silencing the AcBBX19 gene in kiwifruit significantly reduced the relative expression level of AcBBX19, indicating successful transient gene silencing. The content of ester aroma compounds in the fruit with the AcBBX19 gene silenced was then measured, as shown in Figure C. Figure 3 As shown in D, silencing the AcBBX19 gene significantly increased the content of ester aroma compounds.

[0052] Example 4: AcBBX19 directly negatively regulates the expression of ester aroma-forming genes in kiwifruit.

[0053] I. Yeast one-hybrid experiment.

[0054] The AcAAT1 promoter sequence SEQ ID NO.10 was inserted into the pHIS2 vector. Sac I and Mlu Between the two restriction enzyme sites, the proAcAAT1-pHIS2 recombinant plasmid was obtained; SEQ ID NO.3 was inserted into the pGADT7 vector. Nde I and BamH The AcBBX19-pGADT7 recombinant plasmid was obtained between the two restriction sites of enzyme I. Four combinations, AcBBX19-pGADT7+proAcAAT1-pHIS2, AcBBX19-pGADT7+pHIS2, pGADT7+proAcAAT1-pHIS2, and pGADT7+pHIS2, were co-transformed into yeast strain Y187 and plated onto SD-TL and SD-TLH+5mM 3AT-deficient media, respectively. The cultures were incubated at 30℃ for 5 days in the dark, and yeast growth was observed.

[0055]

[0056] The results are as follows Figure 4 As shown, neither pGAD7+proAcAAT1-pHIS2 nor pGAD7+pHIS2 yeast grew on SD-TLH+5mM 3AT medium. This indicates that 5mM 3-amino-1,2,4-triazole (3AT) can inhibit the activation activity of the AcAAT1 promoter. AcBBX19-pGAD7+proAcAAT1-pHIS2 grew well on SD-TLH+5mM 3AT medium, indicating that the transcription factor AcBBX19 can bind to the AcAAT1 promoter.

[0057] II. Tobacco Dual-Luciferase Test.

[0058] The SEQ ID NO.10 sequence was inserted into the pGreenII 0800-LUC vector. Xho I and Sal Between the I restriction sites, the proAcAAT1-LUC recombinant plasmid was obtained, and SEQ ID NO.3 was inserted into the pGreenII-0029-62-SK vector. Spe I and Xma Between the I restriction sites, the AcBBX19-SK recombinant plasmid was obtained. The constructed recombinant plasmid was then transferred into Agrobacterium competent cells GV3101 using the freeze-thaw method.

[0059] After successful transformation, the bacterial suspension was resuspended, and the OD value was adjusted to approximately 0.6. The resuspended Agrobacterium was allowed to stand for 3 hours. Tobacco plants with good growth were selected and injected with the bacterial suspension. The ST group received a suspension containing an empty vector plasmid, while the AcBBX19 group received a suspension containing both proAcAAT1-LUC and AcBBX19-SK plasmids. The injected tobacco plants were then cultured under low light for 2 days. The intensity of firefly luciferin (LUC) and kidney luciferin (REN) was measured. The regulatory effect of transcription factors on the target promoter was expressed as the LUC / REN ratio.

[0060] The results are as follows Figure 5 As shown, AcBBX19 can significantly inhibit the expression of LUC reporter genes driven by the AcAAT1 promoter, indicating that AcBBX19 can directly negatively regulate the activity of the AcAAT1 promoter.

[0061] In summary, the content of ester aroma compounds in kiwifruit increases during post-harvest ripening and softening, while the expression of the AcBBX19 gene is downregulated, indicating a negative correlation between the transcription factor AcBBX19 and the formation of ester aroma in kiwifruit. Transient overexpression and silencing of the AcBBX19 gene in kiwifruit can inhibit and promote the formation of ester aroma in the fruit, respectively. Furthermore, it was found that AcBBX19 can directly bind to the promoter of the kiwifruit ester aroma formation gene AcAAT1 and inhibit its transcriptional activity. Therefore, the kiwifruit transcription factor AcBBX19 described in this invention can regulate the formation of ester aroma in the fruit, providing a theoretical basis for elucidating the formation mechanism of ester aroma during kiwifruit ripening. It also provides genetic resources for the precise creation of new kiwifruit germplasm with good storage resistance and rich aroma through genetic improvement, possessing significant application value.

[0062] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

Claims

1. The application of the kiwifruit AcBBX19 gene in regulating the formation of ester aroma in kiwifruit fruit, characterized by, The nucleotide sequence of the kiwifruit AcBBX19 gene is shown in SEQ ID NO.

3. The regulation is achieved by increasing the expression of the kiwifruit AcBBX19 gene to reduce the content of kiwifruit ester aroma substances.

2. The application of the kiwifruit AcBBX19 gene in regulating the formation of ester aromas in kiwifruit, characterized by, The nucleotide sequence of the kiwifruit AcBBX19 gene is shown in SEQ ID NO.

3. The regulation is achieved by reducing the expression of the kiwifruit AcBBX19 gene to increase the content of kiwifruit ester aroma compounds.

Images