Application of gene FoUPE8 in regulation of pathogenicity of fusarium oxysporum
By constructing knockout and backfill mutants of the gene FoUPE8, the problem of unknown pathogenicity of banana blight bacteria was solved, and the pathogenicity was significantly reduced, and products were provided to prevent and treat banana blight were reduced, thus reducing economic losses.
Patent Information
- Application Number
- CN202510358445.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-08-08
AI Technical Summary
The existing technology has not yet fully understood the pathogenic mechanism of banana blight bacteria, and lacks effective genetic targets to reduce their pathogenicity, making it difficult to prevent and treat banana blight.
The knockout vector of the gene FoUPE8 was constructed through homologous recombination technology, and the protoplasts of the banana blight bacteria were transformed using PEG-mediated transformation method to obtain knockout mutants of the gene FoUPE8, and the back-complement mutants were obtained through random insertion. Analysis found that the knockout gene FoUPE8 significantly reduced the pathogenicity and the pathogenicity was restored after recovery.
It significantly reduces the pathogenicity of banana blight bacteria, provides products to prepare for preventing and treating banana blight, and reduces economic losses for growers.
Smart Images

Figure CN120442657A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and more specifically relates to the application of the gene FoUPE8 in regulating the pathogenicity of banana Fusarium wilt pathogen. Background Art
[0002] Banana wilt is a devastating soil-borne disease caused by the banana pathogen Fusarium oxysporum f.sp.cubense (Foc). Among them, Foc TR4 is the most devastating.
[0003] Banana wilt control methods include chemical and biological control, and breeding resistant varieties. If genes associated with the pathogenicity of the banana wilt pathogen can be identified, agents could be developed that target these pathogenicity-reducing agents, thereby effectively controlling the disease. While genes associated with the pathogenicity of banana wilt have been reported, the pathogenic mechanism of banana wilt remains unclear, requiring further research to effectively control banana wilt. Summary of the Invention
[0004] The present invention promotes the development of banana wilt prevention and treatment products and provides application of the gene FoUPE8 in regulating the pathogenicity of banana wilt pathogen.
[0005] The first objective of the present invention is to provide an application of the gene FoUPE8 in regulating the pathogenicity of banana Fusarium wilt.
[0006] The second object of the present invention is to provide a use of an agent for knocking down or knocking out the FoUPE8 gene in reducing the pathogenicity of banana Fusarium wilt.
[0007] The third object of the present invention is to provide a use of an agent for knocking down or knocking out the gene FoUPE8 in the preparation of a product that reduces the pathogenicity of banana Fusarium wilt.
[0008] The fourth object of the present invention is to provide an agent for reducing the pathogenicity of banana wilt fungus.
[0009] A fifth object of the present invention is to provide use of the agent for reducing the pathogenicity of banana wilt fungus in preventing and / or treating banana wilt disease.
[0010] A sixth object of the present invention is to provide use of the agent for reducing the pathogenicity of banana Fusarium wilt in the preparation of a product for preventing and / or treating banana Fusarium wilt.
[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0012] In previous studies of the Foc TR4 secretome, the present invention identified an uncharacterized protein, designated FoUPE8. Amino acid sequence analysis of FoUPE8 revealed that it contains no known domains, is highly evolutionarily conserved, and has an unknown biological function in Fusarium wilt. To address this, the present invention utilized homologous recombination to construct a knockout vector encoding the gene (FoUPE8). This vector was then transformed into Fusarium wilt protoplasts via PEG-mediated transformation to generate a knockout mutant of FoUPE8, designated ΔFoUPE8. Based on this knockout mutant, a complementary mutant of FoUPE8, designated ΔFoUPE8-com, was generated using a random insertion method.
[0013] Based on the obtained knockout and complement mutants of the FoUPE8 gene, the present invention analyzed their spore production, sensitivity to cell wall stress factors, and pathogenicity. It was found that knocking out the FoUPE8 gene increased the sensitivity of the banana wilt pathogen to cell wall stress factors and significantly reduced its pathogenicity. However, complementing the FoUPE8 gene restored its pathogenicity. This indicates that the FoUPE8 gene is related to the pathogenicity of the banana wilt pathogen.
[0014] Therefore, the present invention seeks to protect the use of gene FoUPE8 in regulating the pathogenicity of banana Fusarium wilt.
[0015] Specifically, the amino acid sequence of the protein FoUPE8 encoded by the gene is shown in SEQ ID NO.1.
[0016] Specifically, the application is the application of the gene FoUPE8 in reducing the pathogenicity of banana Fusarium wilt pathogen; the application is achieved by knocking down or knocking out the gene FoUPE8 in banana Fusarium wilt pathogen.
[0017] In a specific embodiment of the present invention, the nucleotide sequence of the gene FoUPE8 is shown as SEQ ID NO.2.
[0018] Because knocking out the gene FoUPE8 of banana wilt pathogen can significantly reduce the pathogenicity of banana wilt pathogen, and knocking down or knocking out the gene has similar effects, the present invention also claims the use of an agent for knocking down or knocking out the gene FoUPE8 to reduce the pathogenicity of banana wilt pathogen.
[0019] The present invention also claims protection for the use of an agent for knocking down or knocking out the gene FoUPE8 in preparing a product for reducing the pathogenicity of banana wilt fungus.
[0020] Optionally, the reagent for knocking down the gene FoUPE8 is an siRNA, dsRNA, shRNA, miRNA or antisense nucleic acid that has the transcript of the gene FoUPE8 as the target sequence and can inhibit the expression or transcription of the gene FoUPE8; the reagent for knocking out the gene FoUPE8 is a knockout vector of the gene FoUPE8 constructed based on homologous recombination.
[0021] In a specific embodiment of the present invention, the knockout vector is constructed based on the filamentous fungus expression vector pCT74; the knockout vector contains upstream and downstream homologous fragments of the gene FoUPE8.
[0022] In a specific embodiment of the present invention, the upstream homologous fragment of the gene FoUPE8 is amplified using primers FoUPE8-AF and FoUPE8-AR; the nucleotide sequences of the primers FoUPE8-AF and FoUPE8-AR are shown in SEQ ID NOs. 3 and 4, respectively.
[0023] In a specific embodiment of the present invention, the downstream homologous fragment of the gene FoUPE8 is amplified using primers FoUPE8-BF and FoUPE8-BR; the nucleotide sequences of the primers FoUPE8-BF and FoUPE8-BR are shown in SEQ ID NOs. 5 and 6 respectively.
[0024] The invention provides a reagent for reducing the pathogenicity of banana wilt pathogen. The reagent can knock down or knock out the gene FoUPE8 in banana wilt pathogen.
[0025] Specifically, the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1.
[0026] In a specific embodiment of the present invention, the nucleotide sequence of the gene FoUPE8 is shown as SEQ ID NO.2.
[0027] Optionally, the reagent is siRNA of the gene FoUPE8 or a knockout vector of the gene FoUPE8 constructed based on homologous recombination.
[0028] Since banana wilt is caused by the pathogenicity of Fusarium oxysporum f. bananai, reducing the pathogenicity of banana wilt can prevent its occurrence and alleviate its harm. Therefore, the present invention also claims protection for the use of the agent for reducing the pathogenicity of Fusarium oxysporum f. bananai in preventing and / or treating banana wilt.
[0029] The present invention also claims protection for the use of the agent for reducing the pathogenicity of banana wilt fungus in the preparation of products for preventing and / or treating banana wilt disease.
[0030] In a specific embodiment of the present invention, the banana wilt pathogen is banana wilt pathogen race 4.
[0031] The present invention has the following beneficial effects:
[0032] The present invention constructs a knockout vector for the gene FoUPE8 and transforms protoplasts of the banana wilt pathogen using homologous recombination and PEG-mediated transformation to obtain a knockout mutant of the gene FoUPE8. Based on the resulting knockout mutant, a complemented mutant of the gene FoUPE8 was obtained using a random insertion method. Analysis of the knockout mutants of the gene FoUPE8 revealed that suppressing expression of the protein FoUPE8 increased the sensitivity of the banana wilt pathogen to cell wall stress factors and significantly reduced its pathogenicity. However, complementing the gene FoUPE8 restored its pathogenicity. This indicates that the gene FoUPE8 is associated with the pathogenicity of the banana wilt pathogen. Therefore, agents capable of knocking down or eliminating the gene FoUPE8 in banana wilt pathogens can be used to prepare products for preventing and / or treating banana wilt.
[0033] The invention is beneficial to the prevention and treatment of banana wilt disease and reduces the economic losses caused to growers by banana wilt pathogen infection. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 Schematic diagram of the construction of the knockout vector for the banana Fusarium wilt pathogen gene FoUPE8.
[0035] Figure 2 This is a schematic diagram of the structure of the complementation vector for the banana Fusarium wilt pathogen gene FoUPE8.
[0036] Figure 3 The results of PCR amplification of the A-hph gene fragment in some hygromycin-resistant transformants are shown.
[0037] Figure 4 The results of PCR amplification of the FoUPE8 gene fragment in some hygromycin-resistant transformants.
[0038] Figure 5 These are the results of Southern blot analysis of the knockout mutant ΔFoUPE8 using the FoUPE8 gene fragment as a probe.
[0039] Figure 6 Figure 3 shows the results of Southern blot analysis of the knockout mutant ΔFoUPE8 using the hph gene fragment as a probe.
[0040] Figure 7 The results of PCR amplification of the FoUPE8 gene fragment in some bleomycin-resistant transformants.
[0041] Figure 8 Shown are the growth conditions of the knockout mutant ΔFoUPE8 and the complement mutant ΔFoUPE8-com under different stress conditions.
[0042] Figure 9 Results of pathogenicity analysis of the knockout mutant ΔFoUPE8 and the complement mutant ΔFoUPE8-com on banana.
[0043] Figure 10 Statistical analysis results of the disease index of the knockout mutant ΔFoUPE8 and the complement mutant ΔFoUPE8-com. DETAILED DESCRIPTION
[0044] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0045] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0046] The banana wilt pathogen used in the present invention is banana wilt pathogen race 4 (Foc TR4), and the test plant is a Brazilian banana (Cavendish, AAA) with 4 to 5 leaves.
[0047] The host bacteria used in the present invention is Escherichia coli DH5α; the cloning vector used is pMD18T vector; the gene knockout vector used is the filamentous fungus expression vector pCT74; and the gene complementation vector used is pCTZN, which is obtained by replacing the fluorescent protein gene (SGFP) and hygromycin phosphotransferase gene (hph) on the vector pCT74 with the bleomycin gene.
[0048] Czapek medium: FeSO4.7H2O 0.018 g, KCl 0.5 g, K2HPO4.3H2O 1 g, MgSO4.7H2O 0.5 g, NaNO3 3 g, sucrose 30 g, and distilled water to 1 L.
[0049] NCM medium: 10 g glucose, 4 g aspartic acid, 50 mL 20× nitrate, 1 mL 1000× vitamins, 1 mL 1000× trace elements, 5 mL 200× iron salts, dilute to 1 L, pH 6.5.
[0050] STC solution: 10 mmol / L Tris-HCl pH 7.5, 1.2 mol / L sorbitol, 50 mmol / L CaCl2.
[0051] PTC conversion buffer: 40% PEG4000, 1.2 mol / L sorbitol, 50 mmol / L CaCl2, 10 mmol / LTris-HCl, pH 7.5.
[0052] PDA medium: 200.0 g potato, 20.0 g anhydrous glucose, 15.0 g agar, and distilled water to 1 L.
[0053] PDB regeneration medium: 200.0 g potato, 273.6 g sucrose, distilled water to 1 L. Example 1 Construction of knockout mutants and complementing mutants of the banana wilt pathogen FoUPE8
[0054] The present invention utilizes the principle of homologous recombination to knock out the gene FoUPE8 of banana wilt pathogen. The schematic diagram of the construction of the knockout vector of banana wilt pathogen gene FoUPE8 is shown in FIG. Figure 1 As shown. Figure 1 It can be seen that the present invention replaces the gene FoUPE8 in banana wilt pathogen with hph and gfp through homologous recombination, thereby achieving the knockout of the gene FoUPE8.
[0055] 1. Amplification of upstream and downstream homologous fragments of the FoUPE8 gene
[0056] The nucleotide sequence of the gene FoUPE8 described in the present invention is shown in SEQ ID NO. 2, and the amino acid sequence of the protein FoUPE8 encoded by it is shown in SEQ ID NO. 1. Sequences approximately 1500 bp in length were selected upstream and downstream of the FoUPE8 gene (respectively designated as homology arm A fragment and homology arm B fragment), and corresponding amplification primers were designed, incorporating appropriate restriction sites. The nucleotide sequences of the resulting primers are shown in Table 1.
[0057] Table 1 Primers for amplification of homology arms A and B fragments of gene FoUPE8
[0058] Primer name Primer sequence (5'-3') Restriction site FoUPE8-AF (SEQ ID NO. 3) GG GGTACCTGGGCATGGCATGTTTTGCT Kpn I FoUPE8-AR (SEQ ID NO. 4) CCG CTCGAGAGTGTCAGATTCAATTGCGGTC Xho I FoUPE8-BF (SEQ ID NO. 5) G GAATTCGTTGCACTTGTGTGCCGTCG EcoR I FoUPE8-BR (SEQ ID NO. 6) GACTAGTCCATACCACCATAATCAGCCCAAT Spe I
[0059] Note: The underlined position is the restriction enzyme cutting site.
[0060] The genomic DNA of Foc TR4 was extracted using an OMEGA Fungal DNA Kit. The obtained genomic DNA was used as a template and PCR amplified with primers FoUPE8-AF and FoUPE8-AR to obtain the homology arm A fragment (FoUPE8-A) of the FoUPE8 gene. The homology arm B fragment (FoUPE8-B) of the FoUPE8 gene was obtained by PCR amplification with primers FoUPE8-BF and FoUPE8-BR.
[0061] The PCR reaction system used to amplify the homology arm A and B fragments is shown in Table 2.
[0062] Table 2 PCR reaction system used to amplify homology arm A and B fragments
[0063] Template DNA 1.0 μL FoUPE8-AF / BF (10 μmol / L) 1.0 μL FoUPE8-AR / BR (10 μmol / L) 1.0 μL <![CDATA[10×Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Taq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL
[0064] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 90 s, for a total of 35 cycles; and 72°C for 10 min.
[0065] After the PCR reaction was completed, the PCR amplification product was cleaned and recovered using the OMEGA Cycle Pure Kit.
[0066] 2. Construction of knockout vector for gene FoUPE8
[0067] Refer to the instructions for the pMD18-T Vector Cloning Kit (TakaRa) to ligate FoUPE8-A and FoUPE8-B into the pMD18T vector, respectively, to obtain the recombinant vectors pMD18T-FoUPE8-A and pMD18T-FoUPE8-B. Add 4 μL of the PCR product (homologous arm A fragment or homology arm B fragment) and 5 μL of solution I to 1 μL of the pMD18T vector. Ligate overnight at 16°C. Transform the ligated product into Escherichia coli DH5α and plate onto solid LB medium (containing 50 μg / mL Amp). Incubate at 37°C for 8–12 hours.
[0068] Positive transformants with Amp resistance were selected, and recombinant vector DNA was extracted for restriction digestion and sequencing. pMD18T-FoUPE8-A and the pCT74 vector were double-digested with restriction endonucleases Kpn I and Xho I, respectively, to recover the homology arm A fragment and the linearized pCT74 vector. The homology arm A fragment was ligated with the digested pCT74 vector using T4 DNA ligase and transformed into Escherichia coli DH5α to obtain the recombinant plasmid pCT74-FoUPE8-A. Similarly, pMD18T-FoUPE8-B and the recombinant vector pCT74-FoUPE8-A were double-digested with EcoR I and Spe I, and the homology arm B fragment and the recombinant vector were recovered. The homology arm B fragment was ligated with pCT74-FoUPE8-A using T4 DNA ligase and transformed into Escherichia coli DH5α. After enzyme digestion and sequencing, the knockout vector pCT74-FoUPE8-KO of the FoUPE8 gene was obtained.
[0069] 3. Amplification of FoUPE8 complementation fragment
[0070] The schematic diagram of the complementation vector for banana Fusarium wilt gene FoUPE8 is shown in the figure. Figure 2 A promoter sequence of approximately 1500 bp in length was selected upstream of the FoUPE8 gene, and a terminator sequence of approximately 500 bp in length was selected downstream. Corresponding amplification primers were designed and suitable restriction sites were introduced. The nucleotide sequences of the designed primers are shown in Table 3.
[0071] Table 3 Primers for amplification of the complemented fragment of gene FoUPE8
[0072] Primer name Primer sequence (5'-3') Restriction site FoUPE8-comF AACTGCAGCATGGGCTTGACGCTACAAC Pst I FoUPE8-comR GCTCTAGAGCTTTGTCACGCCACGATTG Xba I
[0073] Using Foc TR4 genomic DNA as a template, primers FoUPE8-comF and FoUPE8-comR were used for PCR amplification to obtain a complemented fragment of the FoUPE8 gene (FoUPE8-com). The PCR reaction system used to amplify FoUPE8-com is shown in Table 4.
[0074] Table 4 PCR reaction system used to amplify FoUPE8-com
[0075] Template DNA 1.0 μL FoUPE8-comF (10 μmol / L) 1.0 μL FoUPE8-comR (10 μmol / L) 1.0 μL <![CDATA[10×Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL ExTaq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL
[0076] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 150 s, for a total of 30 cycles; and 72°C for 10 min.
[0077] After the PCR reaction was completed, the PCR amplification product was cleaned and recovered using the OMEGA Cycle Pure Kit.
[0078] 4. Construction of the complementation vector for gene FoUPE8
[0079] The complementing fragment FoUPE8-com and pCTZN vector were double-digested with restriction endonucleases Pst I and Xba I, respectively, to recover the FoUPE8-com fragment and the linearized pCTZN vector. The FoUPE8-com fragment was ligated with pCTZN using T4 DNA ligase and transformed into Escherichia coli DH5α. After restriction digestion and sequencing, the FoUPE8 gene complementing vector pCTZN-FoUPE8-com was obtained.
[0080] 5. Preparation of Foc TR4 Protoplasts
[0081] The wild-type Foc TR4 was inoculated into Czapek medium and cultured with shaking at 28°C and 150 rpm for 3 days. The culture was filtered through a 200-mesh cell sieve and centrifuged at 4°C and 10,000 × g for 10 minutes, and the supernatant was discarded. The precipitate was resuspended in CM medium and diluted to obtain a FocTR4 conidia suspension. The prepared conidia suspension was inoculated into CM medium and cultured with shaking at 28°C and 120 rpm for 11-12 hours. The conidia suspension was filtered through a 200-mesh cell sieve and rinsed three times with 0.8 mol / L NaCl solution to obtain fresh mycelium. Enzyme hydrolyzate was added to the suspension and enzymatic hydrolysis was carried out at 30°C and 120 rpm for 3-4 hours to obtain a protoplast hydrolyzate. The suspension was centrifuged at 400 × g for 10 minutes at 4°C and the supernatant was discarded. The precipitate was resuspended in pre-cooled STC solution and centrifuged, and the supernatant was discarded. The precipitate was resuspended in pre-cooled STC again to obtain a FocTR4 protoplast suspension, with a final protoplast concentration of approximately 1×10 7 pieces / mL.
[0082] The protoplasts of the banana Fusarium wilt knockout mutant were prepared by referring to the above preparation steps.
[0083] 6. Protoplast transformation
[0084] The following description takes the protoplast transformation of the knockout vector of the gene FoUPE8 as an example.
[0085] The knockout vector pCT74-FoUPE8-KO was digested with Xho I to obtain a linearized pCT74-FoUPE8-KO fragment, which was mixed with 200 μL of Foc TR4 protoplasts and placed on ice for 20 min; 200 μL of PTC transformation buffer was added, mixed, and placed on ice for 7 min; 800 μL of PTC transformation buffer was mixed and placed on ice for 7 minutes; 25 mL of pre-cooled STC solution was added and mixed; centrifuged at 4°C and 4000 rpm for 15 minutes, and the supernatant was removed; PDB regeneration medium was added to resuspend the precipitate, and the culture was shaken at 28°C and 100 rpm for 16 hours. After that, the culture was centrifuged at 4°C and 4000 rpm for 15 minutes, and the supernatant was removed. PDA regeneration medium (1.5% agar powder and 150 μg / mL hygromycin were added to the PDB regeneration medium) was added and mixed, and the culture was poured into a plate, and the culture was carried out in the dark at 28°C for 2-3 days; hygromycin-resistant transformants were picked and transferred to PDA medium containing 150 μg / mL hygromycin, and the culture was carried out in the dark at 28°C for 3-4 days, and a single colony was picked for identification.
[0086] The transformation of the complementing vector of gene FoUPE8 was the same as above. The protoplasts used for transformation were protoplasts of the banana wilt pathogen knockout mutant. The antibiotic used for screening positive transformants was bleomycin at a concentration of 200 μg / mL.
[0087] 7. PCR detection of knockout mutants of the FoUPE8 gene
[0088] The genomic DNA of a single colony of the obtained hygromycin-resistant transformant was extracted and PCR amplified using primers A-hph-F / R and then primers FoUPE8-F / R to detect whether the obtained hygromycin-resistant transformant was a knockout mutant of the gene FoUPE8.
[0089] The nucleotide sequences of the primers are shown in Table 5, and the PCR reaction system used is shown in Table 6.
[0090] Table 5 PCR detection of knockout mutants of gene FoUPE8
[0091] Primer name Primer sequence (5'-3') A-hph-F GCCTGAAGAAGTTCTGCTACCGCCG A-hph-R TGGCAAACTGTGATGGACGACACCG FoUPE8-F ATGACCCTCATAACATCACTCG FoUPE8-R CTAATCCGCACTTCTCCAACGG
[0092] Table 6 PCR reaction system used for PCR detection of knockout mutants of the gene FoUPE8
[0093] Template DNA 1 μL FoUPE8-F / A-hph-F (10 μmol / L) 0.5μL FoUPE8-R / A-hph-R (10 μmol / L) 0.5μL <![CDATA[10×Taq Buffer(Mg 2+ plus)]]> 2.5 μL dNTPs (2.5 mmol / L) 2.0 μL ExTaq (5U / μL) 0.25 μL <![CDATA[ddH2O]]> 18.75μL Total 25.0μL
[0094] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 90 s, for a total of 35 cycles; and 72°C for 10 min to obtain the amplified product.
[0095] The present invention used homologous recombination to transform the constructed knockout vector of gene FoUPE8 into the protoplasts of Foc TR4, and obtained 26 hygromycin-resistant transformants. DNA of the transformants was extracted, and 12 hygromycin-resistant transformants were verified by PCR analysis using A-hph gene specific primers. The results are as follows: Figure 3 As shown. Figure 3 It can be seen that the A-hph gene was amplified in all the above 12 transformants. Further PCR amplification was performed on the 12 transformants in which the A-hph gene was amplified using the FoUPE8 gene specific primers. The results are as follows: Figure 4 As shown. Figure 4 It can be seen that no FoUPE8 gene fragment was amplified in any of the 12 transformants, further indicating that these 12 transformants were all positive transformants.
[0096] 8. PCR detection of complement mutants of the FoUPE8 gene
[0097] The genomic DNA of a single colony of the obtained bleomycin-resistant transformant was extracted, and the FoUPE8 gene fragment was amplified by PCR using primers FoUPE8-F / FoUPE8-R. The PCR reaction system used is shown in Table 7.
[0098] Table 7 PCR reaction system used for PCR detection of complementation mutants of gene FoUPE8
[0099] Template DNA 1 μL FoUPE8-F (10 μmol / L) 0.5μL FoUPE8-R (10 μmol / L) 0.5μL <![CDATA[10×Taq Buffer(Mg 2+ plus)]]> 2.5 μL dNTPs (2.5 mmol / L) 2.0 μL ExTaq (5U / μL) 0.25 μL <![CDATA[ddH2O]]> 18.75μL Total 25.0μL
[0100] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 55°C for 30 s, and 72°C for 150 s, for a total of 30 cycles; and 72°C for 10 min to obtain the amplified product.
[0101] The present invention uses the random insertion method to transform the constructed gene FoUPE8 complement vector into the protoplasts of the knockout mutant ΔFoUPE8, and obtains 18 bleomycin-resistant transformants. PCR amplification of some of the resistant transformants is performed, and the results are as follows: Figure 7 As shown. Figure 7 It can be seen that 7 resistant transformants can amplify the target gene fragment, indicating that these 7 transformants contain the gene FoUPE8, confirming that these 7 transformants are positive transformants.
[0102] 9. Southern blot analysis of FoUPE8 knockout mutants
[0103] Southern blot analysis was performed on three knockout-positive transformants (ΔFoUPE8-2, ΔFoUPE8-5, and ΔFoUPE8-8) that amplified the A-hph gene but not the FoUPE8 gene. Southern blot hybridization was performed according to the instructions for the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche). The target gene probe was amplified using primers FoUPE8-F / FoUPE8-R, and the hph gene probe was amplified using primers hph-F / hph-R. The primers used to amplify the gene probes are shown in Table 8, and the PCR reaction system used is shown in Table 9.
[0104] Table 8 Primers used to amplify target gene probes and hph gene probes
[0105] Primer name Primer sequence (5'-3') hph-F TGCTGCTCCATACAAGCCAA hph-R GACATTGGGGAGTTCAGCGA FoUPE8-F ATGACCCTCATAACATCACTCG FoUPE8-R CTAATCCGCACTTCTCCAACGG
[0106] Table 9 PCR reaction system used to amplify target gene probe and hph gene probe
[0107] Template DNA 1.0μL FoUPE8FoUPE8-F / hph-F(20μmol / L) 1.0μL FoUPE8FoUPE8-R / hph-R(20μmol / L) 1.0μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Ex Taq (5U / μL) 0.5μL <![CDATA[ddH2O]]> 37.5μL Total 50.0μL
[0108] The PCR reaction conditions were as follows: 94°C for 5 min; 98°C for 10 s, 56°C for 30 s, and 72°C for 30 s, for a total of 30 cycles; 72°C for 10 min to obtain the amplified product, which was purified and recovered and then used as a template for re-amplification using DIG Labeling Mix. The probe was obtained after verification by gel electrophoresis.
[0109] The results of Southern blot analysis of knockout mutants using the FoUPE8 gene fragment as a probe are shown in the following figure. Figure 5 The results of Southern blot analysis of the knockout mutant using the hph gene fragment as a probe are shown in Figure 6 As shown. Figure 5 and Figure 6 It can be seen that when the gene (FoUPE8) was used as a probe for hybridization, none of the three transformants had hybridization bands ( Figure 5 ). Hybridization was performed using gene hph as a probe, and single copy bands appeared in all three transformants ( Figure 6 ), further proving that the three transformants tested were positive transformants. Example 2 Phenotypic observation and stress resistance analysis of knockout mutants and complement mutants of gene FoUPE8
[0110] 1. Phenotypic observation of knockout mutants and complement mutants of the FoUPE8 gene
[0111] (1) Colony morphology observation and growth rate determination
[0112] The wild type Foc TR4, knockout mutant ΔFoUPE8 and complemented mutant ΔFoUPE-com were inoculated on PDA, CM and MM culture media, respectively, and cultured at 28°C in the dark. The colony diameter was measured on the 5th day and its colony morphology was observed.
[0113] Observation and growth rate determination results showed that there was no significant difference in colony morphology and growth rate between the knockout mutant ΔFoUPE8 and the wild type Foc TR4.
[0114] (2) Spore production analysis
[0115] Conidia of the wild type Foc TR4, the knockout mutant ΔFoUPE8, and the complemented mutant ΔFoUPE-com were inoculated into Czapek medium, respectively, and cultured in a shaker at 28°C and 120 rpm for 3 days. The conidia production was counted using a hemocytometer.
[0116] Compared with the wild-type Foc TR4, the conidia production of the knockout mutant ΔFoUPE8 was not significantly different.
[0117] (3) Observation of conidia germination
[0118] Wild-type Foc TR4, the knockout mutant ΔFoUPE8, and the complemented mutant ΔFoUPE-com were inoculated into Czapek medium and cultured at 28°C with shaking at 120 rpm for 3 days. Conidia were then collected after 3 days. The conidial suspension was inoculated into CM medium and cultured at 28°C with shaking at 120 rpm for 11 hours. Samples were collected and observed for conidial germination.
[0119] Compared with the wild type Foc TR4, there was no significant difference in the conidia germination of the knockout mutant ΔFoUPE8, indicating that knocking out the gene FoUPE8 did not affect the germination of conidia of banana wilt pathogen.
[0120] 2. Stress resistance analysis of knockout and complement mutants of FoUPE8
[0121] (1) Analysis of hyperosmotic stress
[0122] The wild type Foc TR4, the knockout mutant ΔFoUPE8, and the complemented mutant ΔFoUPE-com were inoculated on PDA medium containing 1 mol / L NaCl and 1 mol / L sorbitol, respectively. After inverted culture in a 28°C incubator for 5 days, the colony growth of the strains was observed.
[0123] (2) Oxidative stress analysis
[0124] The wild type Foc TR4, the knockout mutant ΔFoUPE8 and the complemented mutant ΔFoUPE-com were inoculated on PDA medium containing 30 mmol / L H2O2, respectively, and cultured in an inverted manner at 28°C incubator for 5 days, and then the colony growth of the strains was observed.
[0125] (3) Cell wall integrity analysis
[0126] The wild type Foc TR4, the knockout mutant ΔFoUPE8, and the complemented mutant ΔFoUPE-com were inoculated on PDA medium containing 100 μg / mL CR, 50 μg / mL CFW, and 0.02% SDS, respectively. After inverted culture in a 28°C incubator for 5 days, the colony growth of the strains was observed.
[0127] The growth of knockout mutants and complement mutants of FoUPE8 under different stress conditions is shown in Figure 2. Figure 8 As shown. Figure 8Results showed that: ① In PDA medium containing NaCl and sorbitol, ΔFoUPE8 showed no significant difference in growth compared with the wild type and ΔFoUPE8-com, indicating that the FoUPE8 gene has no effect on the hyperosmotic stress resistance of Foc TR4. ② In PDA medium containing 100 μg / mL CR, 50 μg / mL CFW, and 0.02% SDS, ΔFoUPE8 showed no significant difference in sensitivity to SDS and CFW compared with the wild type and ΔFoUPE8-com, but showed significantly enhanced sensitivity to CR, suggesting that the deletion of the FoUPE8 gene may affect the cell wall integrity of Foc TR4. ③ Under oxidative stress conditions, the colony growth of ΔFoUPE8 was not significantly different from that of the wild type and ΔFoUPE8-com, indicating that the FoUPE8 gene has no effect on the oxidative stress resistance of Foc TR4.
[0128] Example 3 Pathogenicity Analysis of Knockout and Complementary Mutants of FoUPE8
[0129] Brazilian bananas at the 4th to 5th stage with consistent growth were selected and conidia (1×10 5 The roots of Brazilian bananas were inoculated with a suspension of Psoralea coli (Psoralea coli) per mL, and the water treatment group served as a control. After 40 minutes of treatment, the bananas were transplanted into sterile nutrient soil and cultured in a plant culture room at 25±1°C with a 12h / 12h light / dark alternating system. After 28 days, the disease conditions of the leaves and bulbs of the banana seedlings were observed, the disease index was calculated, and the disease index was statistically analyzed.
[0130] The disease classification standard refers to the method of Huang Yonghui (2016) (Table 10).
[0131] Table 10 Banana wilt disease classification standard (Huang Yonghui, 2016)
[0132]
[0133]
[0134] The disease index is calculated as follows: disease index = ∑ (disease level × number of plants with disease level) / (highest level × total number of plants surveyed) × 100
[0135] The results of pathogenicity analysis of knockout mutants and complement mutants of FoUPE8 gene are as follows Figure 9 As shown. Figure 9It can be seen that the Brazilian banana seedlings in the water control group did not show any leaf yellowing, and the bulbs did not change color. After inoculation with the wild type Foc TR4, the leaves of the entire banana plant showed obvious yellowing, and more than 50% of the bulb area showed browning. After inoculation with ΔFoUPE8, only the lower leaves of the banana plant showed yellowing, and the bulb area did not exceed 20%; after inoculation with ΔFoUPE8-com, the upper and lower leaves of the banana plant also showed large areas of yellowing, and more than 50% of the bulb area showed browning. Further statistical analysis of the disease index was conducted, and the results are as follows. Figure 10 As shown. Figure 10 It can be seen that the disease index of ΔFoUPE8 is significantly lower than that of the Foc TR4 wild type, while the disease index of ΔFoUPE8-com is similar to that of the Foc TR4 wild type, indicating that the pathogenicity of banana Fusarium wilt is significantly reduced after knocking out the gene FoUPE8.
[0136] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Application of gene FoUPE8 in regulating the pathogenicity of banana wilt pathogen, characterized in that: The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that The application is the application of the gene FoUPE8 in reducing the pathogenicity of banana Fusarium wilt pathogen; the application is achieved by knocking down or knocking out the gene FoUPE8 in banana Fusarium wilt pathogen.
3. The application according to claim 2, characterized in that: The nucleotide sequence of the gene FoUPE8 is shown in SEQ ID NO.
2.
4. Use of an agent for knocking down or knocking out the gene FoUPE8 according to claim 1 in reducing the pathogenicity of banana wilt fungus.
5. Use of an agent for knocking down or knocking out the gene FoUPE8 as claimed in claim 1 in the preparation of a product for reducing the pathogenicity of banana wilt pathogen.
6. The use according to claim 4 or 5, characterized in that: The reagent for knocking down the gene FoUPE8 is siRNA, dsRNA, shRNA, miRNA or antisense nucleic acid that uses the transcript of the gene FoUPE8 as the target sequence and can inhibit the expression or transcription of the gene FoUPE8; the reagent for knocking out the gene FoUPE8 is a knockout vector of the gene FoUPE8 constructed based on homologous recombination.
7. An agent for reducing the pathogenicity of banana wilt pathogen, characterized in that The reagent can knock down or knock out the gene FoUPE8 in banana wilt pathogen; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
1.
8. The reagent according to claim 7, characterized in that The nucleotide sequence of the gene FoUPE8 is shown in SEQ ID NO.
2.
9. Use of the agent according to claim 7 or 8 in preventing and / or treating banana wilt.
10. Use of the agent according to claim 7 or 8 in the preparation of a product for preventing and / or treating banana wilt.