Nucleic acid U-shaped self-rotation amplification method and application thereof
By adding a specific linker to the 3' end of the single-stranded nucleic acid for autorotating amplification, the inefficiency and information loss of single-stranded DNA are solved, and efficient NGS library construction is achieved, especially the stability and information integrity of low amounts and damaged DNA, which simplifies experimental operations.
Patent Information
- Application Number
- CN202510555242.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-09-27
- Filing Date
- 2025-04-29
- Publication Date
- 2025-08-08
AI Technical Summary
The existing methods of converting single-stranded DNA into double-stranded DNA have problems such as difficulty in primer design, DNA polymerase limitation, high template quality dependence, and need to optimize reaction conditions, resulting in low synthesis efficiency and loss of information, and low linker ligation efficiency, non-specific amplification and serious information loss in the construction of next-generation sequencing library.
Using the U-shaped autorotation amplification method of nucleic acid, a specific linker is added to the 3' end of the single-stranded nucleic acid, including the issuing structure and the adapter sequence, extending through the specific linker as a template, forming autorotation amplification, realizing the conversion of single-stranded nucleic acid into double-stranded nucleic acid, and adding a linker sequence to the original strand.
It improves the library construction efficiency of single-stranded or damaged nucleic acid molecules, saves sequencing costs, retains original DNA information, and simplifies experimental operations. It is suitable for the construction of NGS libraries of various sample types, especially the stability and information integrity of low amounts and damaged DNA.
Smart Images

Figure BDA0005383240460000141 
Figure BDA0005383240460000151 
Figure BDA0005383240460000171
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, and in particular to a method for nucleic acid U-shaped self-rotation amplification and its application. Background Art
[0002] Single-stranded DNA (ssDNA) plays an important role in molecular biology research, but double-stranded DNA (dsDNA) is a more commonly used form in many experiments. Converting single-stranded DNA to double-stranded DNA is a key step in experiments such as gene cloning, sequencing, and mutation analysis. In vitro synthesis is a classic and efficient method that can convert single-stranded DNA into double-stranded DNA through an enzymatic reaction. It uses single-stranded DNA as a template and primers to guide the synthesis of complementary chains, ultimately forming double-stranded DNA. Its core principle is to synthesize a DNA chain complementary to the template through the catalytic action of DNA polymerase, using single-stranded DNA as a template and deoxynucleoside triphosphates (dNTPs) as raw materials.
[0003] Although in vitro synthesis is an efficient and widely used method for converting single-stranded DNA into double-stranded DNA, it also has some limitations and disadvantages. The following are the main disadvantages of in vitro synthesis:
[0004] 1) Dependence on primer design: Improper primer design may lead to nonspecific amplification or synthesis failure. Primer design can be very difficult for complex templates (such as single-stranded DNA rich in secondary structure). Templates with unknown sequences cannot provide effective primer design. If random primers are used, some single-stranded 3' end sequences may not be converted into double strands.
[0005] 2) DNA polymerase limitations: Some DNA polymerases (e.g., Taq polymerase) lack 3'→5' exonuclease activity, which may lead to synthesis errors; high-fidelity polymerases (e.g., Pfu polymerase) have a low error rate but a slow synthesis rate; polymerases are sensitive to the secondary structure of the template, which may lead to synthesis interruption;
[0006] 3) Dependence on template quality: Impure or degraded templates can significantly reduce synthesis efficiency. The synthesis efficiency of long single-stranded DNA fragments is low, and incomplete products are easily produced.
[0007] 4) Optimization of reaction conditions: Temperature, pH, ion concentration and other conditions must be strictly optimized, otherwise synthesis failure may occur. For different templates, reaction conditions may need to be repeatedly adjusted.
[0008] 5) Nonspecific amplification: Nonspecific amplification will reduce the yield and purity of the target product; gel electrophoresis or purification steps are required to remove nonspecific products, which increases the complexity of the experiment.
[0009] In summary, while in vitro synthesis is a highly efficient method for converting single-stranded DNA to double-stranded DNA, its application is limited by its dependence on primer design, DNA polymerase limitations, high template quality requirements, and the need for optimized reaction conditions. In particular, it is unable to convert some single-stranded 3' ends to double strands, resulting in information loss. Furthermore, the addition of extension primers can generate nonspecific products, complicating subsequent experiments.
[0010] Existing synthesis methods are unable to add a specific linker sequence to the 3' end of the original single-stranded DNA chain and convert it into double-stranded DNA at the same time.
[0011] Next-generation sequencing (NGS) is a high-throughput DNA sequencing technology that can sequence large numbers of DNA molecules in parallel, allowing for rapid and cost-effective acquisition of extensive genetic information. NGS technology has applications in a variety of fields, including but not limited to whole-genome sequencing, targeted region sequencing, RNA sequencing (RNA-Seq), epigenetic research, cancer genomics, and microbiome research.
[0012] The difficulties and challenges currently faced in constructing next-generation sequencing (NGS) libraries are as follows: Constructing next-generation sequencing (NGS) libraries involves attaching adapter sequences to DNA fragments. These adapters provide the key sequences necessary for sequencing primers, sample identification, and PCR amplification to generate sufficient library quantities for sequencing runs. Adding adapters is a major challenge, and high-quality double-stranded DNA is generally required as input to achieve successful results. However, different sample types pose challenges to adding adapters, such as low-quality / low-quantity DNA, formaldehyde-fixed paraffin-embedded (FFPE) DNA or other damaged DNA, and circulating free DNA. These factors may lead to reduced library yields, sequencing failures, or biased results.
[0013] There are two main methods for attaching adapters to DNA molecules:
[0014] 1. Ligation: This can be the ligation of a double-stranded or single-stranded adapter to the template molecule.
[0015] 2. Extension: This involves the use of a primer containing an adapter that binds to the template DNA strand and extends to replicate the template sequence. Sometimes, a combination of extension and ligation is used to attach adapters to both ends.
[0016] However, each of the above methods has its limitations:
[0017] Double-stranded ligation: This requires clean, blunt-ended DNA or DNA with overhanging A bases. Preparing these ends involves a complex, multistep workflow using multiple enzymes. This process can also tamper with the original molecule and introduce mutations, affecting DNA methylation information. Furthermore, ligation requires high concentrations of DNA ligase, which can lead to adapter dimer formation and reduce sequencing efficiency.
[0018] Single-strand ligation: While this method may be necessary for certain applications, such as analyzing archaeological DNA or bisulfite-treated DNA, it is generally less efficient and more laborious than double-strand ligation.
[0019] Random primer extension: This method is simpler and avoids multiple enzymatic reactions. However, it can introduce bias and lack specificity. Additionally, it may not preserve key information from the original DNA molecule, such as fragment length, start / end positions, and DNA methylation patterns.
[0020] In summary, current methods for adding adapters during NGS library preparation have limitations, especially when working with challenging samples. Improved technologies are needed to provide higher efficiency, reduce bias, and better preserve the original DNA information.
[0021] Constructing next-generation sequencing (NGS) libraries from double-stranded DNA (dsDNA) is a common method in genomic research. However, there are potential issues that may be encountered during library preparation that can affect the quality and usability of sequencing data. The following are some common issues encountered when preparing dsDNA NGS libraries:
[0022] 1.Joint connection efficiency:
[0023] Inefficient adapter ligation can result in low yields of usable library fragments. This can occur if sequence-specific end-repair affects the adapters, preventing them from ligating properly, or due to issues with the ligation reaction itself, such as suboptimal ligation conditions across different samples.
[0024] 2. End repair issues:
[0025] The end repair step may generate sequence errors when repairing the DNA chain through polymerase extension, nick translation, etc., and may cause the loss of DNA methylation status.
[0026] 3. Low DNA input amount:
[0027] Libraries prepared from small amounts of starting material may suffer from issues such as higher error rates and lower complexity due to the excessive PCR cycles required.
[0028] 4. Adaptor dimer formation:
[0029] Adapter dimers may form during PCR and be amplified along with the library. They consume sequencing capacity and do not contain useful sequence information.
[0030] 5. Fragment loss:
[0031] Fragile, degraded DNA (e.g., FFPE DNA, which also contains a large amount of single-stranded DNA) can lead to significant material loss during library preparation, resulting in reduced library yield.
[0032] 6. Single-stranded DNA (ssDNA) loss:
[0033] The ssDNA in the sample cannot be connected in the double-stranded system, resulting in information loss, which affects the research results.
[0034] Preparing NGS libraries from single-stranded DNA (ssDNA) can present additional challenges compared to preparing libraries from double-stranded DNA (dsDNA). The following are some common issues encountered when preparing ssDNA NGS libraries:
[0035] 1. Adapter ligation efficiency:
[0036] Adapters are typically designed to ligate efficiently to dsDNA ends. Ligating adapters to ssDNA is generally less efficient due to differences in the structural and kinetic properties between ssDNA and dsDNA.
[0037] 2. Secondary structure formation:
[0038] Single-stranded DNA can form hairpin loops and other secondary structures that may hinder adaptor ligation or PCR amplification.
[0039] 3. Low yield:
[0040] ssDNA is more susceptible to degradation than dsDNA and may result in lower yields during library preparation.
[0041] 4. Processing and Operation:
[0042] ssDNA is more susceptible to nuclease degradation and requires careful handling to prevent damage during preparation.
[0043] 5.Conversion to double-stranded DNA:
[0044] Some library preparation protocols require conversion of ssDNA to dsDNA, which can introduce errors during the synthesis step.
[0045] 6. Aptamer dimer formation:
[0046] ssDNA may increase the formation of adapter dimers during PCR amplification, which wastes sequencing capacity.
[0047] 7. Complexity of the library:
[0048] If the ssDNA is derived from a complex mixture, maintaining library complexity during preparation may be difficult because of potential loss of sequence representation.
[0049] Current library construction methods require separate DNA extraction and quantification steps before processing the original sample (such as cell lysate, blood or plasma). This adds significant workload and cost and can become a bottleneck for large-scale studies. Summary of the Invention
[0050] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a method for nucleic acid U-shaped self-rotation amplification and its use, so as to solve the problems in the prior art.
[0051] To achieve the above-mentioned purpose and other related purposes, the present invention first provides a method for U-shaped self-rotation amplification of nucleic acid, wherein the method comprises adding a specific linker to the 3' end of a single-stranded nucleic acid, wherein the specific linker comprises a hairpin structure and an adapter sequence, and the adapter sequence is used to complementary bind to the 3' end of the single-stranded nucleic acid; after the single-stranded nucleic acid binds to the specific linker, the specific linker is used as a template to extend from the 3' end of the single-stranded nucleic acid, and the extended single-stranded nucleic acid has a hairpin structure to form a self-rotation, and then the original single-stranded nucleic acid is used as a template to extend and amplify to form an amplified product.
[0052] The present invention also provides uses of the above method in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.
[0053] The present invention also provides a nucleic acid molecule linker, which includes a first linker, the first linker including a hairpin structure and a random sequence, the hairpin structure including a stem region and a loop region, the two chains of the stem region are complementary, the two chains of the stem region are a linker template and a linker sequence complementary to the linker template, the random sequence is connected to the end of the linker template, and the random sequence includes a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested.
[0054] The present invention also provides use of the nucleic acid molecule linker in adding a linker to a nucleic acid molecule to be tested or in preparing a DNA library construction product.
[0055] The present invention also provides a DNA library construction kit, which includes the nucleic acid molecule linker and any one or more of the following: nucleic acid polymerase, library construction reagents, nucleic acid purification reagents, and single-stranded nuclease.
[0056] The present invention also provides a method for constructing an NGS library by U-shaped self-rotation amplification of nucleic acid, the method comprising the following steps:
[0057] 1) mixing the nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and a first adapter and reacting the mixture to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested;
[0058] 2) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;
[0059] 3) mixing the product of step 2), the second linker, and DNA ligase and reacting them to add the second linker to the original strand and / or synthesized strand of the nucleic acid molecule to be tested;
[0060] 4) Purifying the product in step 3) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
[0061] The present invention also provides a method for constructing an NGS library by U-shaped self-rotation amplification of nucleic acid, the method comprising the following steps:
[0062] 1) mixing a double-stranded test nucleic acid molecule, a transposase, and a second adapter and reacting the mixture to add the second adapter sequence to the 5' end of the test nucleic acid molecule; the second adapter is a hairpin structure and has an ME sequence;
[0063] 2) denaturing to convert the product in step 1) into a single strand, thereby obtaining a single-stranded nucleic acid molecule to be detected with a second linker;
[0064] 3) mixing the single-stranded nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter and reacting the mixture to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested;
[0065] 4) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;
[0066] 5) Purifying the product in step 4) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
[0067] The present invention also provides an NGS library prepared by the method for constructing an NGS library.
[0068] As described above, the method and use of nucleic acid U-shaped self-rotation amplification of the present invention have the following beneficial effects: unlike the prior art which has only two methods for adding adapter sequences, namely double-strand / single-strand connection, or extending random primers or sequence-specific primers with adapter sequences to add adapter sequences to the replicated strand rather than the original strand, the present invention extends the nucleic acid molecule to be tested on the adapter with the random primer, thereby adding the adapter sequence to the original strand of the nucleic acid molecule to be tested rather than the replicated strand.
[0069] The present invention can efficiently convert single-stranded DNA molecules into double-stranded DNA molecules, and at the same time convert the original single-copy DNA into double copies; when converting single-stranded DNA molecules into double-stranded DNA molecules, all sequence information of the single-stranded DNA molecules, including the 5' and 3' ends, is completely retained; when converting single-stranded DNA molecules into double-stranded DNA molecules, no amplification primers need to be added, completely avoiding the appearance of primer dimers and polymers; when converting single-stranded DNA molecules into double-stranded DNA molecules, the 3' end sequence extension of the single-stranded DNA molecules themselves is completely relied upon to achieve self-amplification without primers; for a double-stranded DNA molecule, the present invention can amplify the two single strands separately to obtain two double-stranded DNA molecules without adding amplification primers, and retain all sequence information of the two single-stranded DNA molecules, including the 5' and 3' ends. This application is of great significance for the study of damaged double-stranded DNA; it also includes:
[0070] 1) Compared with traditional single-strand library construction methods, the present invention significantly improves the efficiency of linker addition or library construction of single-stranded or damaged nucleic acid molecules;
[0071] 2) Single-tube library construction is possible, eliminating the need to transfer tubes during the experiment, greatly facilitating experimental operations. Convenient and efficient automated operation;
[0072] 3) The prepared library does not produce primer dimers, which greatly saves sequencing costs;
[0073] 4) The present invention can be used for DNA methylation research. Sulfite-treated DNA is very easy to break. The present invention converts the single-stranded DNA after sulfite treatment into double-stranded DNA, making the structure of the sulfite-treated DNA more stable and thus protected. At the same time, the extended complementary chain completely retains the information after the original chain DNA is treated with sulfite. The extended complementary chain has not been treated with sulfite and has not been subjected to harsh chemical damage. Its structure is more stable than that of sulfite-treated DNA.
[0074] 5) Can be used to construct NGS libraries from FFPE DNA;
[0075] 6) The present invention can be used to construct NGS libraries for ancient DNA, which has extremely low ancient DNA content, extensive damage, and high degradation: ancient DNA is often broken down into short fragments, usually between 50-200 nucleotides in length. The present invention converts single-stranded ancient DNA into double-stranded DNA, multiplying the ancient DNA information. At the same time, the conversion into a double-stranded DNA structure makes the ancient DNA structure more stable, thereby protecting it. The extended complementary chain completely retains the information of the ancient DNA. The extended complementary chain is a newly synthesized chain that has not been severely damaged and has a more stable structure than the ancient DNA structure; it greatly improves the success rate of research;
[0076] 7) It can directly construct whole-genome NGS libraries without blood extraction;
[0077] 8) It is possible to directly construct a whole-genome NGS library from blood card samples without extraction;
[0078] 9) It can realize direct NGS library construction without plasma extraction;
[0079] 10) It can realize the construction of maternal plasma libraries without extraction and complete NIPT NGS sequencing testing;
[0080] 11) It can achieve plasma extraction-free and construct plasma cfDNA bisulfite-treated (BS) NGS library for methylation sequencing;
[0081] 12) Direct NGS library construction on FFPE slides is possible. BRIEF DESCRIPTION OF THE DRAWINGS
[0082] Figure 1 Shown is a schematic diagram of the principle of adding a joint of the present invention Figure 1 .
[0083] Figure 2 Shown is a schematic diagram of the principle of adding a joint of the present invention Figure 2 .
[0084] Figure 3 Schematic diagram showing the results of the NGS library constructed in Example 1; qsep400 map (A); and the result of no dimer generation (B).
[0085] Figure 4 Flowchart showing direct library construction for FFPE raw samples.
[0086] Figure 5 Shown are the qsep400 maps of the constructed NGS libraries; the qsep400 map of the NGS library constructed in Example 2 (A); and the qsep400 map of the NGS library constructed in Example 3 (B).
[0087] Figure 6Flowchart showing direct library creation for blood samples.
[0088] Figure 7 Shown are schematic diagrams of the NGS library results constructed in Example 4; qsep400 map (A); and agarose gel electrophoresis results (B).
[0089] Figure 8 Flowchart showing direct library construction for plasma samples.
[0090] Figure 9 Shown are the agarose gel electrophoresis results of the NGS library constructed in Example 5.
[0091] Figure 10 Shown is a schematic diagram of the principle of adding a joint of the present invention Figure 3 .
[0092] Figure 11 Shown is a schematic diagram of the principle of adding a joint of the present invention Figure 4 .
[0093] Figure 12 Shown are the agarose gel electrophoresis results of the NGS library constructed in Example 6.
[0094] Figure 13 Schematic diagram showing the results of the NGS library constructed in Example 7; agarose gel electrophoresis results (A); and the constructed NGS library qsep400 map (B).
[0095] Figure 14 Schematic diagram showing the results of the NGS library constructed in Example 8; agarose gel electrophoresis results (A); NIPT positive DNA library qsep400 map (B); NIPT negative DNA library qsep400 map (C).
[0096] Figure 15 Shown is the direct construction of methylation sequencing library for plasma original samples.
[0097] Figure 16 Schematic diagram showing the results of the NGS library constructed in Example 9; agarose gel electrophoresis results (A); qsep400 map of the NGS library (B).
[0098] Figure 17 This shows the second method for FFPE DNA library construction.
[0099] Figure 18 A shows the agarose gel electrophoresis results of the NGS library constructed in Example 10.
[0100] Figure 18 B shows the agarose gel electrophoresis results of the NGS library constructed in Example 11.
[0101] Figure 19 Schematic diagram showing the results of the NGS library constructed in Example 11; qsep400 map (A); and length distribution diagram of the constructed NGS library (B). DETAILED DESCRIPTION
[0102] The present invention first provides a method for nucleic acid U-shaped self-rotation amplification, wherein a specific adapter is added to the 3' end of a single-stranded nucleic acid, wherein the specific adapter comprises a hairpin structure and an adapter sequence, and the adapter sequence is used to complementarily bind to the 3' end of the single-stranded nucleic acid;
[0103] After the single-stranded nucleic acid is combined with the specific linker, it is extended from the 3' end of the single-stranded nucleic acid using the specific linker as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation, and then the original single-stranded nucleic acid is used as a template for extension and amplification to form an amplified product.
[0104] In certain embodiments of the present invention, the hairpin structure comprises a stem region and a loop region, wherein the two strands of the stem region are complementary. Preferably, the stem region sequence is 5 to 40 bp in length; preferably, the loop region sequence is TTTTT, AAAAAA, ACTCTTTCCCTA, or AATAA.
[0105] In a preferred embodiment of the present invention, the two chains of the stem region are a linker template and a linker sequence, respectively. The linker template is complementary to the linker sequence, and the linker sequence is connected to the end of the linker template.
[0106] In certain embodiments of the present invention, the single-stranded nucleic acid is selected from DNA or RNA.
[0107] In certain embodiments of the present invention, the 3' end of the single-stranded nucleic acid includes the natural 3' end of the single-stranded nucleic acid or the 3' end modified by extension. Figure 1 In the embodiment shown, the natural 3' end of the single-stranded nucleic acid is complementary to the adapter sequence. After complementary binding, the single-stranded nucleic acid is extended using the hairpin structure as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation, and then the original single-stranded nucleic acid is used as a template for extension and amplification to form an amplified product. Figure 10 or Figure 11 In the embodiment shown, the end of the single-stranded nucleic acid is first extended, and the extended and modified 3' end is complementary to the adapter sequence. After complementary binding, the single-stranded nucleic acid is extended using the hairpin structure as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation, and then the original single-stranded nucleic acid is extended and amplified using it as a template to form an amplified product.
[0108] In certain embodiments of the present invention, the adapter template is selected from a sequencing primer binding site, a protein binding sequence, or a promoter sequence. Preferably, the sequencing primer binding site sequence is selected from a partial sequence or the full-length sequence of sequencing primer binding sites R1, R2, or their respective complementary sequences R1', R2'.
[0109] In certain embodiments of the present invention, the adapter sequence consists of 6 to 25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G.
[0110] In certain embodiments of the present invention, the 3' end of the adapter sequence is provided with a blocking group, wherein the blocking group is a 3' terminal hydroxyl reactive blocking group. Preferably, the blocking group is selected from NH2 modification, MGB modification, spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1, or BHQ2.
[0111] The specific linker includes a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, an adapter sequence and a blocking group; or, the specific linker includes a sequencing primer binding site R2, a loop structure, a sequence R2' complementary to the sequencing primer binding site R2, an adapter sequence and a blocking group.
[0112] The present invention also provides uses of the above method in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.
[0113] The present invention also provides a nucleic acid molecule linker, which includes a first linker, the first linker including a hairpin structure and a random sequence, the hairpin structure including a stem region and a loop region, the two chains of the stem region are complementary, the two chains of the stem region are a linker template and a linker sequence, respectively, the linker template is complementary to the linker sequence, the random sequence is connected to the end of the linker template, and the random sequence includes a sequence complementary to the 3' end portion of the nucleic acid molecule to be tested.
[0114] In the present invention, the "random sequence includes a sequence that is partially complementary to the 3' end of the nucleic acid molecule to be tested" means that the random sequence can bind to the 3' end of the nucleic acid molecule to be tested through base pairing, that is, the random sequence is used to complementarily bind to the 3' end of the nucleic acid molecule to be tested. Depending on the specific application, the random sequence can be designed in the following two ways:
[0115] In certain embodiments, the random sequence is completely randomized. In this embodiment, a sufficient number of random sequence combinations are designed to ensure that the nucleic acid molecule to be tested can find a matching complementary sequence. When the random sequence binds to the 3' end of the nucleic acid molecule to be tested, the two form a partially double-stranded structure, allowing the nucleic acid molecule to extend from the 3' end using the hairpin structure as a template.
[0116] In other embodiments, the random sequence is designed to be complementary based on the 3' end sequence of the nucleic acid molecule to be tested, and its sequence composition has a definite complementary relationship with the 3' end extension sequence of the target nucleic acid molecule. When the random sequence combines with the 3' end extension sequence of the nucleic acid molecule to be tested, the two form a local double-stranded structure, so that the nucleic acid molecule to be tested can extend from the 3' end using the hairpin structure as a template.
[0117] The 3' end of the nucleic acid molecule to be tested includes the natural 3' end of the nucleic acid molecule to be tested or the 3' end that has been modified by extension. The natural 3' end refers to the 3' end of the nucleic acid molecule to be tested without any artificial modification; the modified 3' end refers to the structure formed by adding nucleotides to the natural 3' end by a polymerase (such as terminal transferase), a ligase, or chemical synthesis.
[0118] In certain embodiments of the present invention, the extended modified sequence consists of 2 to 30 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G.
[0119] The nucleic acid molecule to be detected is selected from DNA or RNA.
[0120] The linker template is any sequence, that is, any sequence that is desired to be connected to the nucleic acid molecule to be tested according to the experimental purpose.
[0121] The linker template is selected from a sequencing primer binding site, a protein binding sequence or a promoter sequence, etc. The promoter sequence is, for example, a partial or complete sequence of a T7 promoter.
[0122] The sequencing primer binding site is the region to which the sequencing primer binds during the sequencing process and is used to indicate the position where the sequence reading begins.
[0123] The sequencing primer binding site is selected from the sequencing primer binding site R1, R2 or their respective complementary sequences R1' or R2'. Figure 1 、 Figure 2 、 Figure 10 and Figure 11 In the embodiment shown, the sequencing binding site R1 or R2 is an adapter sequence, and the respective complementary sequence R1' or R2' is an adapter template.
[0124] R1 is Rd1 SP. In the prior art, Rd1 SP (Read1 Sequencing Primer) is the primer binding site for first-strand sequencing, usually located at one end of a DNA fragment. During the sequencing process, the sequencing primer will bind to this site and begin sequencing the first strand of the DNA fragment.
[0125] R2 is Rd2 SP. In the prior art, Rd2 SP (Read2 Sequencing Primer) is the primer binding site for second-strand sequencing, usually located at the other end of the DNA fragment. In paired-end sequencing, this site is used to read the DNA information complementary to the first strand.
[0126] The sequence of the sequencing primer binding site is selected from a partial sequence or full-length sequence of the sequencing primer binding sites R1, R2 or their respective complementary sequences R1', R2', preferably a partial sequence.
[0127] In certain embodiments of the present invention, the random sequence consists of 6 to 25 degenerate bases N. The degenerate base "N" can represent any one of A, T, C or G. Figure 1 、 Figure 2 、 Figure 10 、 Figure 11 In the embodiments shown in other flow charts, a blocking group is provided at the 3' end of the random sequence, and the blocking group is a hydroxyl active blocking group at the 3' end of the nucleic acid molecule linker.
[0128] In certain embodiments of the present invention, the blocking group is linked to the last base at the 3' end of the random sequence.
[0129] The blocking group is selected from NH2 modification, MGB modification, spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2. The NH2 modification is exemplified by NH2-C6 modification, NH2-C7 modification, NH2-C12 modification, etc. The MGB (Minor Groove Binder) is a minor groove binder in the DNA helix and is a dihydrocyclopyrrole tripeptide that can selectively bind to the minor groove of the DNA molecule, i.e., the shallow groove in the DNA helix. The spacer modification is exemplified by Spacer C3 modification.
[0130] like Figure 1 or Figure 2 As shown in Step 1 in , in certain embodiments of the present invention, the first adapter includes a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group.
[0131] In certain embodiments of the present invention, the first linker comprises, from the 5' end to the 3' end, a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group.
[0132] like Figure 1 or Figure 2 As shown, a first adapter with a hairpin structure forms partial complementarity with the 3' end of the nucleic acid molecule to be tested and is extended. The sequencing primer binding site R1 in the first adapter (R1 is used as an example in this paragraph, and R2 is similar) is copied to the end of the original strand of the nucleic acid molecule to be tested. The resulting template sequence has a hairpin structure. The hairpin structure allows the nucleic acid molecule to synthesize a second strand by rotating the extended hairpin, thereby allowing the nucleic acid molecule to synthesize the opposite adapter through methods such as double-strand ligation. Nucleic acid molecules with double-sided adapters can be amplified and sequenced using universal primers.
[0133] like Figure 10 As shown in Steps 1 and 2 in 14, the first adapter with a hairpin structure is complementary to the 3'-end extension sequence of the nucleic acid molecule to be tested and extended. The sequencing primer binding site R1 in the first adapter (R1 is used as an example in this paragraph, and R2 is the same) is copied to the end of the original strand of the nucleic acid molecule to be tested. The resulting template sequence has a hairpin structure. The hairpin structure allows the nucleic acid molecule to be tested to synthesize a second strand by rotating the extended hairpin structure, thereby allowing the nucleic acid molecule to be tested to synthesize the opposite adapter by methods such as double-strand ligation. Nucleic acid molecules with double-sided adapters can be amplified and sequenced using universal primers.
[0134] In certain embodiments of the present invention, the sequence length of the first linker stem region is 5-40 bp, for example, 5-10 bp, 10-15 bp, 15-20 bp, 20-25 bp, 25-30 bp, 30-35 bp, or 35-40 bp.
[0135] The loop sequence of the first linker generally comprises 3 to 20 nucleotides or more, such as 3 to 5, 5 to 7, 7 to 10, 10 to 15, 15 to 20, 20 to 25 or more nucleotides.
[0136] In certain embodiments of the present invention, the loop sequence only needs to be non-complementary, for example, TTTTT, AAAAAA, ACTCTTTCCCTA, AATAA, etc.
[0137] In certain embodiments of the present invention, the nucleic acid molecule linker further comprises a second linker.
[0138] exist Figure 1 or Figure 11In the illustrated embodiment, the second adapter is a hairpin structure, comprising a stem region and a loop region, the two chains of the stem region being complementary, the two chains of the stem region being sequencing primer binding sites, the sequencing primer binding sites being selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2', the sequencing primer binding sites being different from the sequencing primer binding sites in the first adapter, that is, when the sequencing primer binding sites in the first adapter are R1 and / or R1', the sequencing primer binding sites in the second adapter are R2 and R2', and when the sequencing primer binding sites in the first adapter are R2 and / or R2', the sequencing primer binding sites in the second adapter are R1 and R1'.
[0139] In certain embodiments of the present invention, the second linker has a blunt end or a sticky end.
[0140] In certain embodiments of the present invention, the second linker with a sticky end ends with a T and / or C. In a specific embodiment, the 3' end of the second linker with a sticky end protrudes a T.
[0141] In certain embodiments of the present invention, the length of the stem region of the second linker is generally 5-40 bp, for example, 5-10 bp, 10-15 bp, 15-20 bp, 20-25 bp, 25-30 bp, 30-35 bp, or 35-40 bp.
[0142] In certain embodiments of the present invention, the loop region of the second linker generally comprises 3 to 10 nucleotides, such as 3 to 5, 5 to 7 or 7 to 10 nucleotides.
[0143] In certain embodiments of the present invention, the loop sequence of the second linker only needs to be non-complementary, for example, TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT or AAAAAA.
[0144] exist Figure 2 or Figure 10 In the illustrated embodiment, the second adapter is a Y-shaped adapter, which includes a head and a tail, each of which includes two chains. The head is two chains with non-complementary bases, and the two chains of the tail are complementary. The two chains of the tail are sequencing primer binding sites, and the sequencing primer binding sites are selected from sequencing primer binding sites R1, R2, or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first adapter. That is, when the sequencing primer binding sites in the first adapter are R1 and / or R1', the sequencing primer binding sites in the second adapter are R2 and R2'; when the sequencing primer binding sites in the first adapter are R2 and / or R2', the sequencing primer binding sites in the second adapter are R1 and R1'.
[0145] The length of the head is 2-15 nucleotides or more, and the length of the tail is 15-30 nucleotides or more.
[0146] In some embodiments, the tail is blunt-ended, meaning both strands are the same length. In other embodiments, the tail is sticky-ended, with one strand of the tail projecting a single T nucleotide from its end. Preferably, the 3' end of the tail projects a single T nucleotide; for example, the 3' end of the sequencing primer binding site R2 or R1 of the tail projects a single T nucleotide.
[0147] In certain embodiments of the present invention, the second linker is not phosphorylated; in other embodiments of the present invention, the second linker is phosphorylated. This can be flexibly adjusted based on the sample size and specific circumstances during the experiment.
[0148] In the present invention, the linker added to the 3' end of the original chain is the first linker, and the linker added to the 5' end of the original chain is the second linker.
[0149] like Figure 2 and Figure 17 In the embodiment shown, the second linker does not contain phosphorylation modification, and the second linker is added to the nucleic acid molecule to be tested, but not to the copy strand of the nucleic acid molecule to be tested. The second linker works by the following principle, see Figure 2 In Step 3, the 5' end of the nucleic acid molecule to be tested (original strand) and the replica strand of the nucleic acid molecule to be tested (synthetic strand) generated by the random primer form a double-stranded structure. The sequencing primer binding site R2 in the unphosphorylated second adapter is added to the original strand by blunt-end or A / T sticky-end double-stranded ligation method; or see for details. Figure 17 In Step 1 and Step 2, the transposition function of Tn5 transposase is used to add the unphosphorylated second linker to the 5' end of the DNA sequence (ME sequence). Since the second linker is not phosphorylated, only the original chain can be connected, and a nick is formed between the synthetic chain and the second linker. Since the second linker is designed as a Y-shaped structure, the R2 sequence in the correct direction (instead of the complementary sequence R2') can be added to the original chain, or the method of blocking the 3' end of a certain chain can also ensure that the R2 sequence in the correct direction (instead of the complementary sequence R2') is added to the original chain. Figure 1 As shown in step 4 in the previous section, the original chain now has a complete double-end adapter structure and can be amplified and library constructed using universal primer PCR.
[0150] like Figure 15In the embodiment shown, the second linker contains a phosphorylation modification, and the second linker is added to the nucleic acid molecule to be tested and the copy strand of the nucleic acid molecule to be tested. The second linker works by the following principle, see Figure 15 In Step 7, the 5' end of the original strand and the synthetic strand generated by the random primer form a double-stranded structure. Through blunt-end or A / T sticky-end double-stranded ligation, the sequencing primer binding site R2 in the second adapter is added to the original strand, and the sequencing primer binding site R2' in the second adapter is added to the synthetic strand. This completes the double-ended adapter structure on both the original strand and the synthetic strand, allowing both to serve as templates for PCR amplification and library construction using universal primers.
[0151] The present invention also provides use of the nucleic acid molecule linker in adding a linker to a nucleic acid molecule to be tested or in preparing a DNA library construction product.
[0152] The nucleic acid molecule to be detected is single-stranded DNA, double-stranded DNA or RNA.
[0153] The nucleic acid molecules to be detected are derived from blood, plasma, FFPE samples, cell lysates, trace and damaged DNA samples.
[0154] The present invention also provides a DNA library construction kit, which includes the nucleic acid molecule linker and any one or more of the following: nucleic acid polymerase, library construction reagents, nucleic acid purification reagents, and single-stranded nuclease.
[0155] The nucleic acid polymerase is a nucleic acid polymerase with strand displacement activity and / or a nucleic acid polymerase without strand displacement activity.
[0156] The nucleic acid polymerase having strand displacement activity can be purchased, for example, Vent (exo-) DNA Polymerase (NEB), SD Polymerase (BIORON), DoGene Waq Polymerase (DoGene), Deep (exo–)DNA Polymerase(NEB), Klenow Fragment(3′→5′exo-)(NEB), Bst DNAPolymerase, Large Fragment(NEB), Bst DNA Polymerase(NEB), Bst 3.0DNA Polymerase(NEB).
[0157] The library construction reagents include any one or more of the following: nucleic acid fragmentation reagents, end-filling reagents, A-addition reagents, DNA ligase, Tn5 transposase, phosphorylation reagents, and PCR amplification reagents.
[0158] The PCR amplification reagents include a primer set and a PCR reaction premix.
[0159] The library construction reagents can be commercial kits, such as Hua Rui Kang HRK-CC220-24.
[0160] The nucleic acid purification reagent is, for example, magnetic beads, specifically, AMPure XP magnetic beads.
[0161] The single-stranded nuclease is, for example, nuclease S1, mung bean nuclease, etc., which has endo- and exo-hydrolysis activity on the phosphodiester bonds of single-stranded DNA and RNA, producing 5'-phosphate mononucleotides and 5'-phosphate oligonucleotide end products, which can be used to digest unannealed polynucleotide tails and hairpin loops in RNA and DNA duplexes, and can be used to convert supercoiled DNA into a linear form.
[0162] The Tn5 transposase can efficiently and randomly insert the adapter sequence (Adapter with ME sequence) into the target DNA fragment, so that the 5' end of each DNA fragment has the adapter sequence.
[0163] The present invention also provides a method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, the method comprising the following steps:
[0164] 1) mixing the nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and a first adapter and reacting the mixture to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested;
[0165] 2) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;
[0166] 3) mixing the product of step 2), the second linker, and DNA ligase and reacting them to add the second linker to the original strand and / or synthesized strand of the nucleic acid molecule to be tested;
[0167] 4) Purifying the product in step 3) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
[0168] In certain embodiments of the present invention, step 1) further comprises extending and modifying the 3' end of the nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, and dNTPs separately or in combination.
[0169] In certain embodiments of the present invention, in step 1), the molar ratio of the nucleic acid molecule to be tested to the terminal deoxynucleotidyl transferase is 1:(0.5-2).
[0170] In certain embodiments of the present invention, in step 1), the molar ratio of the nucleic acid molecule to dNTPs is 1:(10-100). The molar ratio of the nucleic acid molecule to dNTPs is selected from any of the following ranges: 1:(10-30), 1:(30-50), 1:(50-70), 1:(70-90), and 1:(90-100).
[0171] In certain embodiments of the present invention, in step 1), the amount of the nucleic acid molecule to be detected is 1 pg to 1000 ug.
[0172] In certain embodiments of the present invention, in step 1), the concentration of the nucleic acid polymerase having strand displacement activity is 0.5U to 20U.
[0173] In certain embodiments of the present invention, in step 1), the concentration of the first linker is 0.5 μM to 5 μM.
[0174] In the present invention, Figure 1 In the illustrated embodiment, denaturation is first performed to open the junction between the first adapter and the original strand of the test nucleic acid molecule, and then a nucleic acid polymerase is used to extend and synthesize a complementary strand to form a double strand. Specifically, in step 2), denaturation is first performed to open the junction between the first adapter and the original strand of the test nucleic acid molecule, allowing the hairpin sequence carried on the original strand of the test nucleic acid molecule to undergo a U-turn to form the hairpin structure. The 3' end of the strand is then extended by a nucleic acid polymerase to synthesize a complementary strand to form a double strand.
[0175] In certain embodiments of the present invention, step 3) may further include a DNA ligation buffer for providing a reaction environment for ligating the second linker. The DNA ligation buffer may be a commercial reagent, such as Hua Rui Kang HRK-CC220-24.
[0176] In certain embodiments of the present invention, in step 3), the second linker is a second linker with a blunt end or a second linker with a sticky end.
[0177] In the present invention, when the second linker has a blunt end, the molar ratio of the second linker to the nucleic acid molecule to be detected is (20-100):1.
[0178] In the present invention, when the second linker is a sticky end, the molar ratio of the second linker to the nucleic acid molecule to be detected is (10-50):1.
[0179] In certain embodiments of the present invention, in step 3), the reaction conditions are placing the reaction in a PCR instrument at 20° C. for 25 minutes.
[0180] In certain embodiments of the present invention, step 3) further includes mixing the test nucleic acid molecule with the second adapter with a single-stranded nuclease to remove the single-stranded portion (i.e., the loop region of the hairpin structure or the head of the Y-shaped structure) from the first adapter and / or the second adapter. In this embodiment, the reaction buffer is further mixed with the test nucleic acid molecule with the second adapter and the single-stranded nuclease. The final concentration of the nuclease is 0.3 to 3 U / ul based on the total volume of the reaction system.
[0181] In certain embodiments of the present invention, in step 4), after the PCR reaction is completed, the PCR product is further mixed with magnetic beads for purification.
[0182] The present invention also provides another method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, the method comprising the following steps:
[0183] 1) mixing a double-stranded test nucleic acid molecule, a transposase, and a second adapter and reacting the mixture to add the second adapter sequence to the 5' end of the test nucleic acid molecule; the second adapter is a hairpin structure and has an ME sequence;
[0184] 2) denaturing to convert the product in step 1) into a single strand, thereby obtaining a single-stranded nucleic acid molecule to be detected with a second linker;
[0185] 3) mixing the single-stranded nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter and reacting the mixture to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested;
[0186] 4) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand;
[0187] 5) Purifying the product in step 4) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
[0188] In certain embodiments of the present invention, in step 3), before the mixing reaction, the single-stranded nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, and dNTPs are mixed to extend and modify the 3' end of the nucleic acid molecule to be tested.
[0189] In certain embodiments of the present invention, in step 4), the nucleic acid molecule to be tested with the first adapter is mixed with a single-stranded nuclease to remove the single-stranded portion in the first adapter and / or the second adapter.
[0190] The reaction procedures or conditions of each step in the method of constructing an NGS library by adding linkers to the nucleic acid molecules to be tested are not particularly limited, and only need to meet the corresponding effects such as denaturation, extension, and digestion effects. The specific steps can be carried out according to the instructions provided by the reagent manufacturer.
[0191] The present invention also provides an NGS library prepared by the method for constructing an NGS library.
[0192] The present invention also provides uses of the method for constructing an NGS library in any one or more of the following:
[0193] 1. Used for constructing NGS libraries from FFPE DNA;
[0194] II. Used for ancient DNA construction NGS library;
[0195] III. Realize blood extraction-free and directly construct whole-genome NGS libraries;
[0196] IV. Realize the extraction-free operation of blood card samples for direct construction of whole-genome NGS libraries;
[0197] V. Realize plasma extraction-free and directly construct cfDNA NGS libraries;
[0198] VI. Achieve plasma extraction-free and construct a plasma cfDNA bisulfite-treated NGS library for methylation sequencing;
[0199] VII. Achieve the elimination of maternal plasma extraction for the construction of cffDNA NGS libraries;
[0200] VIII. Directly construct NGS libraries from FFPE slides.
[0201] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.
[0202] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.
[0203] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.
[0204] Example 1 Short-chain DNA fragment library construction method 1
[0205] like Figure 1 or Figure 2 As shown, the process includes the following steps: Step 1: Under the action of a strand-displacing nucleic acid polymerase, the 3' end of the single-stranded DNA (original strand) forms partial complementarity with a hairpin-structured adapter template R1' having a 3' random sequence and extends, copying the adapter sequence R1 to the end of the original strand. Because the 3' end of the adapter template R1' is blocked by a blocking group, the adapter template will not undergo random extension. The hairpin structure further ensures that random extension between adapter templates will not occur, resulting in adapter dimers.
[0206] Step 2: Denaturing the nucleic acid molecules separates the double-stranded structure of the original chain / adapter template generated in the previous step. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic chain.
[0207] The experimental steps of Step 1 and Step 2 are as follows: Take 2 μl 10X To the reaction buffer, add 2 μl of 2.5 mM dNTP Mix and 1 μl of Vent (exo-) DNA Polymerase (NEB), mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO. 1), and add 9.5 μl of water. Incubate at 94°C for 30 seconds on a PCR machine, then cool to 55°C for 1 minute, and then to 4°C for 1 minute.
[0208] SEQ ID NO.1:
[0209] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0210] Add 2 μL of water containing 10 ng of a 160 bp DNA fragment (the product of cell DNA digestion) to a total of 20 μL of reaction solution. Place the reaction on a PCR instrument and follow the following procedure:
[0211]
[0212] Step 3: The U-turn of the 5' end and 3' end of the original chain forms a double-stranded structure. The unphosphorylated second linker R2 (the second linker is a hairpin structure) is connected by blunt end or A / T or G / C sticky end double-stranded connection. Figure 1 ); the second connector is a Y-type connector ( Figure 2 )) is added to the original strand. Because the second linker is not phosphorylated, only the original strand can be ligated, forming a nick between the synthesized strand and the second linker. The second linker can be designed with a Y-shaped structure or by blocking the 3' end of a strand, allowing the R2 sequence (rather than the complementary sequence R2') to be added to the original strand in the correct orientation.
[0213] Step 3: Add 9 μl of Ligation Buffer and 1.5 μl of DNAligase V3 (Hua Rui Kang HRK-CC220-24) to a 20 μl reaction. Also add 1 μl of the TP72 adapter (SEQ ID NO. 2, final concentration: 1 μM) and 1.5 μl of the TP7B2 adapter (SEQ ID NO. 3, final concentration: 1.5 μM). Incubate in a PCR machine at 20°C for 25 minutes, then cool to 4°C until proceeding to the next step.
[0214] SEQ ID NO.2:
[0215] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT
[0216] SEQ ID NO.3:
[0217] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG
[0218] Step 4: Remove the single-stranded portion of the hairpin structure and the single-stranded portion of the second adapter through single-stranded nuclease digestion, so that the template strand and the synthetic strand can be separated during denaturation in the next step;
[0219] Step 4: Add 8 μl of 5X Reaction Buffer (ThermoScientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to a 33 μl reaction. Incubate in a PCR machine at 23°C for 20 minutes, then cool to 4°C until the next step.
[0220] Step 5: The template chain and the synthetic chain are separated during PCR denaturation. The original chain now has a complete double-end adapter structure and is amplified and library constructed using universal primer PCR.
[0221] Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes;
[0222] To the Ampure beads, 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021, 10 μM each, sequences shown in SEQ ID NOs. 4 and 5, respectively), and 19 μl of 2X HiFiPCR MasterMix (Hua Rui Kang HRK-CC220-24) were added in sequence;
[0223] SEQ ID NO.4:
[0224] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0225] SEQ ID NO.5:
[0226] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0227] Place on the PCR instrument and the reaction procedure is as follows:
[0228]
[0229] 54 μL of Ampure beads were added to purify the PCR product and eluted with 50 μL of water to obtain an NGS library with a complete double-end adapter structure. The constructed NGS library qsep400 map is shown in the figure. Figure 3 As shown in A.
[0230] Take 8μl NGS library and run it on 1% agarose gel electrophoresis with voltage of 100V and electrophoresis time of 20 minutes. Figure 3As shown in B, it was demonstrated that the constructed NGS library did not produce primer dimers.
[0231] The library was sequenced using the NovaSeq X Plus, successfully splitting the data. Sequence analysis showed that the library sequence was consistent with human cell sequences.
[0232] Sequencing analysis of the read2 data revealed that 46.05% of the start positions contained the sequence TGGTCAT, and 47.62% contained the sequence TGACTG. According to the experimental design, the sequence TGGTCAT is the product of TA ligation, while the sequence TGACTG is the product of blunt-end ligation. This result strongly demonstrates that our method is capable of ligating DNA products with both blunt-end and 3'-terminal A overhangs.
[0233] Example 2: Direct FFPE DNA library construction
[0234] like Figure 4 As shown, Step 1: Pre-treat the original sample by treating the sample with chemical reagents to denature proteins and release nucleic acids; remove proteins and chemical reagents, and retain DNA;
[0235] Step 2: Use the primer OH-NNNNUNN to randomly bind to the sample DNA and use a polymerase with strand displacement activity to extend the NNNNUNN binding site. This copies the sample sequence, and each molecule ends with NNNNUNN at the 5' end.
[0236] The experimental steps of Step 2 are as follows: Take 1 μl 10X To the reaction buffer, add 1 μl of 2.5mM dNTPMix and 0.5 μl of Vent (exo-) DNA Polymerase (NEB), mix with 0.5 μl of 20 μM N8U (sequence: NNNNUNUN), add 4 μl of water, and then add 3 μl of FFPE DNA (16 ng / μl). A total of 10 μl of reaction solution was prepared. The reaction was performed on a PCR instrument using the following protocol:
[0237] temperature time 98℃ 70s 10℃ 10s 60℃ 10s 72℃ 10s 37℃ 10s
[0238] Step 3: Treat the sample amplification product with UDG and Endonuclease VIII. Each molecule is cleaved at the U position. The extended copy molecule is cleaved to produce an OH-NNNN-P molecule and an extended copy of the 5' phosphate structure. The random primer OH-NNNNUNN fails to extend, and enzyme digestion yields an OH-NNNN-P molecule and P-NN. After treatment, only the extended copy of the 5' phosphate structure can be used in subsequent experiments.
[0239] Step 3 The experimental steps are as follows: add 1 μl USER (NEB, M5505S) and place at 37°C for reaction for 20 minutes.
[0240] Step 4: Under the action of a strand-displacing polymerase, the 3' end of the extended copy of the 5' phosphate structure forms partial complementarity with the hairpin adapter template R1' with a 3' random sequence and is extended, copying the adapter sequence R1 to the end of the original strand. Because the 3' end of the adapter template R1' is blocked by a blocking group, the adapter template does not undergo random extension. The hairpin structure further ensures that random extension between adapter templates does not occur, resulting in adapter dimers.
[0241] Step 5: The double-stranded structure of the original chain / adapter template generated in the previous step is separated by nucleic acid denaturation. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin structure can be further extended by polymerase to synthesize a complementary synthetic chain.
[0242] The experimental steps are as follows: add 1 μl 10X To the reaction buffer, add 1 μl of dNTP Mix (2.5 mM) and 0.5 μl of Vent (exo-) DNA Polymerase (NEB), mixed with 3.5 μl of 20 μM NTP5-N15 NH2 (nucleotide sequence shown in SEQ ID NO. 6), and then add 4 μl of water to make a total of 20 μl of reaction solution;
[0243] SEQ ID NO.6 (NTP5-N15 NH2):
[0244] AGATCGGAAGAGCGTCGTTTTTTACGACGCTCTTCCGATCTANNNNNNNNNNNNNNN-(NH2-C6)
[0245] Place on the PCR instrument and the reaction procedure is as follows:
[0246]
[0247] Next, the second linker was connected and the library was amplified by PCR in the same manner as in Example 1.
[0248] The experimental steps are as follows:
[0249] 1) To a 20 μl reaction, add 9 μl Ligation Buffer and 1.5 μl DNA ligase V3 (Hua Rui Kang HRK-CC220-24). Also add 1 μl TP72 adapter (30 μM) and 1.5 μl TP7B2 adapter (30 μM). Incubate in a PCR machine at 20°C for 25 minutes, then cool to 4°C until the next step.
[0250] 2) Add 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to the 33 μl reaction. Incubate in a PCR machine at 23°C for 20 minutes, then cool to 4°C until the next step.
[0251] 3) Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes;
[0252] 4) Add 18 μl of water, 1.5 μl of mixed primers (10 μM each of LP5-UDI0021 and LP7-UDI0021), and 19 μl of 2X HiFiPCR MasterMix (Hua Rui Kang HRK-CC220-24) to the Ampure beads in sequence;
[0253] Place on the PCR instrument and the reaction procedure is as follows:
[0254]
[0255] 5) Purify the PCR product by adding 54 μL of Ampure beads and elute with 50 μL of water;
[0256] The constructed NGS library qsep400 map is as follows Figure 5 As shown in A, the map shows that the DNA length is distributed in the range of 100bp-1000bp.
[0257] The library was sequenced using the NovaSeq X Plus, successfully splitting the data. Sequence analysis showed that the library sequence matched the human genome sequence.
[0258] Example 3 Adding a linker sequence to the 3' end of a DNA fragment
[0259] Take 1.5μl 10X Mix 3 μl of 20 μM UT7-N15 NH2 Reaction Buffer, 1.2 μl of 2.5 mM dNTP Mix, and 5.8 μl of water. Incubate at 94°C for 30 seconds in a PCR instrument, then cool to 55°C for 1 minute, and then to 4°C for 1 minute. Add approximately 10 ng of a 160 bp DNA fragment in 2.5 μl of water and 1 μl of Vent (exo-) DNA Polymerase (NEB); the total reaction volume is 15 μl.
[0260] Place on the PCR instrument and the reaction procedure is as follows:
[0261]
[0262] The above steps correspond to Figure 2 Step 1 and step 2;
[0263] Add 4 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μl of S1 nuclease (10 U / μl) to the 15 μl reaction. Incubate the reaction in a PCR machine at 23°C for 20 min, then cool to 4°C until the next step.
[0264] The above steps correspond to Figure 2 In step 4, the hairpin structure and the single-stranded portion of the second linker are removed by digestion with single-stranded nuclease, so that the template chain and the synthetic chain can be separated during denaturation;
[0265] Add 32 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes;
[0266] Add 20 μl of water to the Ampure beads for elution;
[0267] The sequencing library was constructed using the Rapid DNA library Kit (Hua Rui Kang HRK-CC220-24) according to the instructions.
[0268] Sequencing and analysis were performed using NovaSeq X Plus.
[0269] The qsep400 map of the library is as follows Figure 5 As shown in B, analysis of the sequencing results showed that the T7 adapter appeared at the very beginning of sequencing Read 1 or at the very beginning of sequencing Read 2, and there was no case where Read 1 and Read 2 appeared at the same time.
[0270] The sequencing results were consistent with Figure 2A T7 linker sequence was added to the 3' end of the PCR product.
[0271] T7 adapter: TCCACTTTGCCTTTCT
[0272] read1 adapter proportion: 0.12
[0273] read2 adapter proportion: 0.08
[0274] This data confirmed that only a portion of the 3' end had the T7 linker sequence added.
[0275] Example 4 Directly constructing a blood sample library
[0276] like Figure 6 As shown,
[0277] Step 1: Pre-treat the original sample: add lysis buffer to the blood sample to lyse the cells; add nuclease to cleave DNA; remove protein and retain DNA;
[0278] Step 2: The 3' end sequence of the single-stranded DNA (original chain) is complementary to the 3' random sequence of the first adapter of the hairpin structure. Under the action of a strand-displacing nucleic acid polymerase, the 3' end of the single-stranded DNA (original chain) continues to extend, copying the first adapter sequence R1 to the end of the original chain. Because the 3' end of the first adapter is blocked by a blocking group, the first adapter will not be extended. The hairpin structure further ensures that random extension between the adapter templates will not occur, resulting in adapter dimers.
[0279] Step 3: The double-stranded structure of the original chain / adapter template generated in the previous step is separated by nucleic acid denaturation. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic chain.
[0280] Next, the second linker was connected and the library was amplified by PCR in the same manner as in Example 1.
[0281] The specific experimental steps are as follows:
[0282] 1) Collect 20 μl of peripheral blood from the finger.
[0283] 2) Add 100 μl of 0.1% Tween 20, mix well, and place on ice for 1 minute. Centrifuge at 3000 g for 2 minutes and discard the supernatant.
[0284] 3) Add 100 μl of 0.1% Tween 20 again, mix well, and place on ice for 1 minute. Centrifuge at 3000 g for 2 minutes and discard the supernatant.
[0285] 4) Wash the cells with 100 μl of Atlantis Digestion Buffer (ZYMO Cat: D5220), centrifuge at 3000 g for 2 minutes, and discard the supernatant.
[0286] 5) Resuspend the cell lysate in 10 μl Atlantis Digestion Buffer, and add 0.3 U of Atlantis dsDNase (ZYMO Cat: D5220) and 1 μl RNase A (Thermo Scientific EN0531).
[0287] 6) Incubate at 42°C for 30 minutes.
[0288] 7) Add 10 μl of magnetic beads (Apostle A17622-250) and 32 μl of lysis and binding solution (Apostle A17622-250).
[0289] 8) Incubate at room temperature for 30 minutes, shaking every 5 minutes to mix thoroughly.
[0290] 9) Place the tube on a magnetic rack and let it stand for 5 minutes, then discard the supernatant.
[0291] 10) Add 100 μl of washing buffer (Apostle A17622-250) for washing, then magnetically adsorb. Discard the supernatant.
[0292] 11) Wash with 100 μl of 85% ethanol. Adsorb magnetically. Discard the supernatant.
[0293] 12) Wash again with 100 μl of 85% ethanol. Apply magnetic adsorption. Discard the supernatant. Air dry for 5 minutes.
[0294] 13) Take 2 μl 10X To the reaction buffer, add 2 μl of dNTP Mix (2.5 mM) and 1 μl of Vent (exo-) DNA Polymerase (NEB), mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO. 1), and add 11.5 μl of water, for a total of 20 μl.
[0295] SEQ ID NO.1:
[0296] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0297] 14) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0298]
[0299] 15) To the 20 μl reaction solution, add 9 μl of Ligation Buffer and 1.5 μl of DNA Ligase V3 (Hua Rui Kang HRK-CC220-24). Also add 1 μl of the TP72 adapter (SEQ ID NO. 2, final concentration 1 μM) and 1.5 μl of the TP7B2 adapter (SEQ ID NO. 3, final concentration 1.5 μM). Incubate at 20°C for 25 minutes in a PCR machine, then cool to 4°C until proceeding to the next step.
[0300] SEQ ID NO.2:
[0301] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT
[0302] SEQ ID NO.3:
[0303] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG
[0304] 16) Add 8 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10
[0305] U / μl). Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step.
[0306] Step 5: The template chain and the synthetic chain are separated during PCR denaturation. The original chain now has a complete double-end adapter structure and is amplified and library constructed using universal primer PCR.
[0307] Add 69 μl of Ampure beads to bind DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0308] 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021 at a concentration of 10 μM each, with sequences shown in SEQ ID NOs. 4 and 5, respectively), and 19 μl of 2X HiFiPCR MasterMix (Hua Rui Kang HRK-CC220-24) were added to the Ampure beads in sequence.
[0309] SEQ ID NO.4:
[0310] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0311] SEQ ID NO.5:
[0312] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0313] Place on the PCR instrument, the reaction procedure is as follows:
[0314]
[0315] 54 μL of Ampure beads were added to purify the PCR product and eluted with 50 μL of water to obtain an NGS library with a complete double-end adapter structure. The constructed NGS library qsep400 map is shown in the figure. Figure 7 A.
[0316] Take 8μl NGS library and run it on 1% agarose gel electrophoresis with voltage of 100V and electrophoresis time of 20 minutes. Figure 7 As shown in B, the DNA length is concentrated between 250 bp and 750 bp.
[0317] Example 5 Direct library construction of plasma samples
[0318] like Figure 8 As shown, Step 1: Pre-treat the original sample: add lysis buffer to the plasma sample to remove protein and retain DNA;
[0319] Step 2: The 3' end sequence of the single-stranded DNA (original strand) is complementary to the 3' random sequence of the first adapter of the hairpin structure. Under the action of a strand-displacing nucleic acid polymerase, the 3' end of the single-stranded DNA (original strand) continues to extend, copying the first adapter sequence R1 to the end of the original strand. Because the 3' end of the first adapter is blocked by a blocking group, the first adapter will not be extended. The hairpin structure further ensures that random extension between the adapter templates will not occur, resulting in adapter dimers.
[0320] Step 3: The double-stranded structure of the original chain / adapter template generated in the previous step is separated by nucleic acid denaturation. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic chain.
[0321] Next, the second linker was connected and the library was amplified by PCR in the same manner as in Example 1.
[0322] 1) Add 8 μl proteinase K and 20 μl sample lysis buffer (Apostle A17622-250) to 190 μl human plasma.
[0323] 2) Incubate at 60°C for 20 minutes, add 10 μl of magnetic beads (Apostle A17622-250), and then add 125 μl of lysis and binding solution (Apostle A17622-250).
[0324] 3) Mix on an oscillator at 2000 rpm for 10 minutes.
[0325] 4) Place the tube on a magnetic rack and let it stand for 5 minutes, then discard the supernatant.
[0326] 5) Add 500 μl of washing buffer (Apostle A17622-250) for washing, then magnetically adsorb. Discard the supernatant.
[0327] 6) Wash with 500 μl of 85% ethanol; adsorb magnetically; and discard the supernatant.
[0328] 7) Wash again with 500 μl of 85% ethanol. Apply magnetic adsorption. Discard the supernatant. Air dry for 5 minutes.
[0329] 8) Take 2 μl 10X To the reaction buffer, add 2 μl of dNTP Mix (2.5 mM) and 1 μl of Vent (exo-) DNA Polymerase (NEB), mix with 3.5 μl of 20 μM NAP5-N15 NH2 (sequence shown in SEQ ID NO. 1), and add 11.5 μl of water, for a total of 20 μl.
[0330] SEQ ID NO.1:
[0331] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0332] 9) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0333]
[0334] 10) To the 20 μl reaction solution, add 9 μl of Ligation Buffer and 1.5 μl of DNA Ligase V3 (Hua Rui Kang HRK-CC220-24). Also add 1 μl of the TP72 adapter (SEQ ID NO. 2, final concentration 1 μM) and 1.5 μl of the TP7B2 adapter (SEQ ID NO. 3, final concentration 1.5 μM). Incubate at 20°C for 25 minutes in a PCR machine, then cool to 4°C until proceeding to the next step.
[0335] SEQ ID NO.2:
[0336] TGACCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGGTCAT
[0337] SEQ ID NO.3:
[0338] CAGTCAAGATCGGAAGAGCACACGTCTGTTTTTCAGACGTGTGCTCTTCCGATCTTGACTG
[0339] 11) Add 8 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to the 33 μl reaction solution. Incubate in a PCR machine at 23°C for 20 min, then cool to 4°C until the next step.
[0340] 12) Add 69 μL of Ampure beads to bind DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0341] 13) Add 18 μl of water, 1.5 μl of mixed primers (LP5-UDI0021 and LP7-UDI0021, each at a concentration of 10 μM, with sequences as shown in SEQ ID NOs. 4 and 5, respectively), and 19 μl of 2X HiFiPCR MasterMix (Hua Rui Kang HRK-CC220-24) to the Ampure beads in sequence.
[0342] SEQ ID NO.4:
[0343] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0344] SEQ ID NO.5:
[0345] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0346] 14) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0347]
[0348] 15) Add 54 μL of Ampure beads to purify the PCR product, and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure.
[0349] 16) Take 8 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 9 As shown, the DNA length is concentrated between 100 bp and 750 bp.
[0350] Example 6 Short-chain DNA fragment library construction method 2
[0351] like Figure 10 or Figure 11 As shown, the process includes the following steps: Step 1: Under the action of TdT (terminal deoxynucleotidyl transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), the corresponding single nucleotide is added to the 3' end of the single-stranded DNA (original chain), thereby forming a 3' extended end of the single-stranded DNA.
[0352] Step 2: The 3' extended end sequence of the single-stranded DNA (original chain) is complementary to the 3' sequence of the first adapter of the hairpin structure. Under the action of base complementary matching, the 3' extended end of the single-stranded DNA (original chain) specifically binds to the 3' sequence of the first adapter of the hairpin structure. Under the action of a nucleic acid polymerase with chain displacement activity, the 3' extended end of the single-stranded DNA (original chain) continues to extend, copying the first adapter sequence R1 to the end of the original chain. Since the 3' end of the first adapter is blocked by a blocking group, the first adapter will not produce random extension. The hairpin structure further ensures that random extension will not occur between the adapter templates to cause adapter dimers.
[0353] Step 3: Denaturing the nucleic acid molecules separates the double-stranded structure of the original strand / adapter template generated in the previous step. The hairpin sequence on the original strand undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic strand.
[0354] Step 4: The U-turn of the 5' end and 3' end of the original chain forms a double-stranded structure. The unphosphorylated second linker R2 (the second linker is a hairpin structure) is connected by blunt end or A / T or G / C sticky end double-stranded connection. Figure 11 ); the second connector is a Y-type connector ( Figure 10 )) is added to the original strand. Because the second linker is not phosphorylated, only the original strand can be ligated, forming a nick between the synthesized strand and the second linker. The second linker can be designed with a Y-shaped structure or by blocking the 3' end of a strand, allowing the R2 sequence (rather than the complementary sequence R2') to be added to the original strand in the correct orientation.
[0355] Step 5: Remove the single-stranded portion of the hairpin structure (and Y-shaped structure) through digestion with single-stranded nuclease, so that the template chain and the synthetic chain can be separated during denaturation.
[0356] The specific experimental steps of the above steps are as follows:
[0357] 1) Take about 10 ng of a 160 bp DNA fragment, add 1 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 2 mM dCTP, and 0.5 μl of TdT (TAKARA 2230A);
[0358] 2) Incubate at 37°C for 10 min, then at 90°C for 3 min, then transfer to an ice box.
[0359] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), and add water, a total of 16 μl;
[0360] SEQ ID NO.1:
[0361] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0362] SEQ ID NO.7:
[0363] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0364] 4) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0365]
[0366]
[0367] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Hua Rui Kang HRK-CC220-24) to the 16 μl reaction solution. Also add the P-STP76 adapter (final concentration 1 μM) shown in SEQ ID NO.8 and the P-SCP77 (final concentration 1 μM) shown in SEQ ID NO.9.
[0368] The adapter (final concentration 1 μM) and the P-STP7B9 adapter shown in SEQ ID NO. 10 (final concentration 1 μM) were added to a total volume of 28 μl and placed in a PCR instrument at 20°C for 25 minutes, then cooled to 4°C until the next step.
[0369] SEQ ID NO.8:
[0370] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT
[0371] SEQ ID NO.9:
[0372] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC
[0373] SEQ ID NO.10:
[0374] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA
[0375] 6) Add 7 μl of 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl of S1 nuclease (10 U / μl) to the 28 μl reaction solution. Incubate in a PCR machine at 23°C for 20 min, then cool to 4°C until the next step.
[0376] Step 6: The template strand and the synthesized strand are separated during PCR denaturation. The original strand now has a complete double-end adapter structure and can be amplified and library constructed using universal primer PCR.
[0377] 7) Add 42 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0378] 8) Add 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences as shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;
[0379] SEQ ID NO.4:
[0380] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0381] SEQ ID NO.5:
[0382] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0383] 9) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0384]
[0385]
[0386] 10) Add 24 μL of Ampure beads to purify the PCR product, and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure.
[0387] 11) Take 8 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 12As shown, the DNA length is concentrated between 100 bp and 750 bp.
[0388] Example 7 Ancient DNA Fragment Library Construction Method
[0389] 1) Take about 0.1 ng of ancient DNA fragments, add 1 μl 5X TdT Buffer (TAKARA 2230A), add 1 μl 2 mM dCTP, and add 0.5 μl TdT (TAKARA 2230A);
[0390] 2) Incubate at 37°C for 10 min, then at 90°C for 20 s, then transfer to an ice box.
[0391] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), and add water, a total of 16 μl;
[0392] SEQ ID NO.1:
[0393] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0394] SEQ ID NO.7:
[0395] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0396] 4) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0397]
[0398]
[0399] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Hua Rui Kang HRK-CC220-24) to the 16 μl reaction solution. Also add the P-STP76 adapter (set forth in SEQ ID NO. 8) (final concentration: 1 μM), the P-SCP77 adapter (set forth in SEQ ID NO. 9) (final concentration: 1 μM), and the P-STP7B9 adapter (set forth in SEQ ID NO. 10) (final concentration: 1 μM). The total volume was 28 μl. Incubate the reaction mixture in a PCR machine at 20°C for 25 minutes, then cool to 4°C until the next step.
[0400] SEQ ID NO.8:
[0401] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT
[0402] SEQ ID NO.9:
[0403] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC
[0404] SEQ ID NO.10:
[0405] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA
[0406] 6) Add 7 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10
[0407] U / μl). Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step.
[0408] At this point, the template chain and the synthesized chain are separated during PCR denaturation, and the original chain now has a complete double-end adapter structure, which is amplified and library constructed using universal primer PCR.
[0409] 7) Add 42 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0410] 8) Add 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences as shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;
[0411] SEQ ID NO.4:
[0412] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0413] SEQ ID NO.5:
[0414] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0415] 9) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0416]
[0417]
[0418] 10) Purify the PCR product by adding 24 μL of Ampure beads and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure;
[0419] 11) Take 5 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 13 As shown in A, the DNA length is concentrated between 100 bp and 750 bp.
[0420] The qsep400 map of the library is as follows Figure 13 As shown in B.
[0421] Sequencing and analysis using the NovaSeq X Plus revealed that the library was a human DNA genomic library with numerous C->T mutations, consistent with ancient DNA characteristics.
[0422] Example 8 NIPT Standard Library Construction
[0423] 1) Take 3.3 μl of NIPT positive DNA (BGI) and 3.3 μl of NIPT negative DNA (BGI), add 1 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 2 mM dCTP, and 0.5 μl of TdT (TAKARA 2230A) respectively;
[0424] 2) Incubate at 37°C for 10 minutes, then at 96°C for 2 minutes, then transfer to an ice box.
[0425] 3) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), and add water, a total of 16 μl;
[0426] SEQ ID NO.1:
[0427] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0428] SEQ ID NO.7:
[0429] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0430] 4) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0431]
[0432]
[0433] 5) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Hua Rui Kang HRK-CC220-24) to the 16 μl reaction solution. Also add the P-STP76 adapter (final concentration 1 μM) shown in SEQ ID NO. 8, the P-SCP77 adapter (final concentration 1 μM) shown in SEQ ID NO. 9, and the P-STP7B9 adapter (final concentration 1 μM) shown in SEQ ID NO. 10. Place the 28 μl reaction mixture in a PCR machine at 20°C for 25 minutes, then cool to 4°C until the next step.
[0434] SEQ ID NO.8:
[0435] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT
[0436] SEQ ID NO.9:
[0437] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC
[0438] SEQ ID NO.10:
[0439] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA
[0440] 6) Add 7 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10
[0441] U / μl). Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step.
[0442] At this point, the template chain and the synthesized chain are separated during PCR denaturation, and the original chain now has a complete double-end adapter structure, which is amplified and library constructed using universal primer PCR.
[0443] 7) Add 42 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0444] 8) Add 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences as shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;
[0445] SEQ ID NO.4:
[0446] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0447] SEQ ID NO.5:
[0448] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0449] 9) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0450]
[0451]
[0452] 10) Purify the PCR product by adding 24 μL of Ampure beads and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure;
[0453] 11) Take 5 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 14 As shown in A, the DNA length is concentrated between 100 bp and 750 bp.
[0454] NIPT positive DNA library qsep400 map Figure 14 As shown in B; NIPT negative DNA library qsep400 map is as shown Figure 14 As shown in C.
[0455] Sequencing and analysis using the NovaSeq X Plus revealed that the NIPT-positive DNA library T21, T18, and T13 were all positive, while the NIPT-negative DNA library T21, T18, and T13 were all negative.
[0456] Example 9 Direct Construction of Methylation Sequencing Library from Plasma Original Samples
[0457] like Figure 15 As shown,
[0458] Step 1: Pre-treat the original sample: 1a. Add lysis buffer to the plasma sample; 1b. Remove protein and retain DNA;
[0459] Step 2: Purify DNA;
[0460] Step 3: Treat the DNA with sulfite. During the sulfite treatment, unmethylated cytosine (C) in the DNA is converted to uracil (U). During the subsequent DNA replication, uracil (U) is replaced by thymine (T). In contrast, methylated cytosine (including 5-methylcytosine, 5mC, and 5-hydroxymethylcytosine, 5hmC) does not undergo this conversion.
[0461] Step 4: The 3' end of the ssDNA (original chain) after sulfite treatment is cleaved by TdT (terminal deoxynucleotidyl transferase) and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates). The corresponding single nucleotide is added to the 3' end of the ssDNA, thereby forming the 3' extended end of the ssDNA (original chain);
[0462] Step 5: The 3' extended end sequence of the single-stranded DNA (original chain) is complementary to the 3' sequence of the first connector of the hairpin structure. Under the action of base complementary matching, the 3' extended end of the single-stranded DNA (original chain) specifically binds to the 3' sequence of the first connector of the hairpin structure. Under the action of a nucleic acid polymerase with chain displacement activity, the 3' extended end of the single-stranded DNA (original chain) continues to extend, and the first connector sequence R1 is copied to the end of the original chain. Since the 3' end of the first connector is blocked by a blocking group, the first connector will not produce random extension. The hairpin structure further ensures that random extension will not occur between connector templates to cause connector dimers;
[0463] Step 6: Through nucleic acid denaturation, the double-stranded structure of the original chain / adapter template generated in the previous step is separated. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic chain.
[0464] Step 7: The 5' and 3' ends of the original strands undergo a U-turn to form a double-stranded structure. The phosphorylated second linker R2 is then added to the original strands via blunt-end or A / T or G / C sticky-end double-strand ligation.
[0465] Step 8: Remove the single-stranded portion of the first and second adapter Y-shaped segments through digestion with single-stranded nuclease, allowing the template and synthetic strands to separate during denaturation.
[0466] Step 9: Both the original and synthesized chains now have complete double-end adapter structures and can be amplified and constructed using universal primer PCR.
[0467] Step 10: The U converted from the unmethylated C in the original PCR chain pairs with A, and the site exists as T in the PCR product; while the methylated C (including 5mC, 5hmC) is not changed and remains C in the PCR product.
[0468] The specific experimental steps of the above steps are as follows:
[0469] 1) Add 40 μl of proteinase K and 100 μl of sample lysis buffer (Apostle A17622-250) to 1 ml of human plasma;
[0470] 2) Incubate at 60°C for 20 minutes, add 15 μl of magnetic beads (Apostle A17622-250), and then add 1.25 ml of lysis and binding buffer (Apostle A17622-250).
[0471] 3) Mix on an oscillator at 2000 rpm for 10 minutes;
[0472] 4) Place on a magnetic stand and let it stand for 5 minutes, then discard the supernatant.
[0473] 5) Add 500 μl of washing solution (Apostle A17622-250) for washing, then magnetically adsorb and discard the supernatant;
[0474] 6) Wash with 500 μl of 85% ethanol, adsorb magnetically, and discard the supernatant;
[0475] 7) Wash again with 500 μl of 85% ethanol, magnetically adsorb, discard the supernatant, and air-dry for 5 minutes;
[0476] 8) Add 20 μl of water for elution;
[0477] 9) Add 130 μl Lightning Conversion Reagent (Zymo research D5030) and place in a PCR instrument at 98°C for 8 min, then at 54°C for 60 min, then cool to 4°C until the next step.
[0478] 10) Add 600 μl M-Binding Buffer (Zymo research D5030), mix well, and pass through Zymo-Spin column. TMIC Column(Zymo research D5030);
[0479] 11) Add 100 μl of M-Wash Buffer to the column, centrifuge at high speed for 30 seconds, and discard the wash buffer;
[0480] 12) Add 200 μl of L-Desulphonation Buffer (Zymo research D5030) to the Zymo-Spin TM IC Column; and at room temperature for 15 minutes;
[0481] 13) Add 200 μl of M-Wash Buffer to the column, centrifuge at high speed for 30 seconds, discard the wash buffer, and repeat the wash.
[0482] 14) Add 3.5 μl M-Elution Buffer for elution;
[0483] 15) Take 3.5μl M-Elution Buffer, add 1μl 5X TdT Buffer (TAKARA2230A), add 1μl 3
[0484] mM dCTP, add 0.5 μl TdT (TAKARA 2230A);
[0485] 16) 37°C for 10 min and then 96°C for 2 min, then transfer to ice box;
[0486] 17) Add 1.6 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2.5 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 3 mM), and add water, a total of 16 μl;
[0487] SEQ ID NO.1:
[0488] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0489] SEQ ID NO.7:
[0490] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0491] 18) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0492]
[0493] 19) Add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Hua Rui Kang HRK-CC220-24) to the 16 μl reaction solution. Also add the P-STP76 adapter (final concentration 1 μM) shown in SEQ ID NO.8 and the P-SCP77 (final concentration 1 μM) shown in SEQ ID NO.9.
[0494] adapter (final concentration 1 μM) and the P-STP7B9 adapter (denoted by SEQ ID NO. 10) (final concentration 1 μM). Place the PCR reaction in a 28 μl volume at 20°C for 25 minutes, then cool to 4°C until the next step.
[0495] SEQ ID NO.8:
[0496] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT
[0497] SEQ ID NO.9:
[0498] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC
[0499] SEQ ID NO.10:
[0500] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA
[0501] 20) Add 7 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10
[0502] U / μl). Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step.
[0503] 21) Add 42 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0504] 22) Add 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;
[0505] SEQ ID NO.4:
[0506] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0507] SEQ ID NO.5:
[0508] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0509] 23) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0510]
[0511] 24) Add 24 μL of Ampure beads to purify the PCR product and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure;
[0512] 25) Take 5 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 16 As shown in A, the DNA length is concentrated between 100 bp and 750 bp;
[0513] The qsep400 map of the library is as follows Figure 16 As shown in B, sequencing and analysis were performed using the NovaSeq X Plus. BSMAP sequence analysis showed that the data were consistent with BS-seq data.
[0514] Example 10 FFPE DNA library construction method 2
[0515] like Figure 17As shown: Step 1: Expose the gDNA or FFPE DNA sample to a complex consisting of Tn5 Transposase and AdapterR2-ME to randomly shear the DNA fragments and add the Adapter R2-ME sequence to the 5' ends of the cleaved DNA fragments. The 5' end of Adapter R2-ME contains an R2-ME hairpin structure that binds to the 5' end of DNA fragments, regardless of whether the DNA fragments are single-stranded or double-stranded.
[0516] Step 2: Denature the double-stranded DNA into single-stranded DNA by heating or alkaline treatment. Add an R2-ME hairpin structure to the 5' end of the Tn5 transposase-treated DNA molecule.
[0517] Step 3: Under the action of TdT and dCTP (or dATP, or dTTP, or dGTP, or dUTP, or a mixture of the above deoxymononucleotide triphosphates), the corresponding single nucleotide is added to the 3' end of the 5' end R2-ME hairpin structure single-stranded DNA (original chain), forming the 3' extended end of the single-stranded DNA (original chain);
[0518] Step 4: The 3' extended end sequence of the 5' end R2-ME hairpin structure single-stranded DNA (original chain) is complementary to the 3' sequence of the hairpin structure's first adapter. Under the action of base complementary matching, the 3' extended end of the single-stranded DNA (original chain) specifically binds to the 3' sequence of the hairpin structure's first adapter. Under the action of a strand-displacing nucleic acid polymerase, the 3' extended end of the 5' end R2-ME hairpin structure single-stranded DNA (original chain) continues to extend, copying the first adapter sequence R1 to the end of the original chain. Because the 3' end of the first adapter is blocked by a blocking group, the first adapter will not produce random extension. The hairpin structure further ensures that random extension will not occur between the adapter templates to cause adapter dimers.
[0519] Step 5: Through nucleic acid denaturation, the double-stranded structure of the original chain / adapter template generated in the previous step is separated. The hairpin sequence on the original chain undergoes a U-turn to form a hairpin structure. The 3' end of the hairpin can be further extended by polymerase to synthesize a complementary synthetic chain.
[0520] Step 6: A double-stranded molecule with R1 and R2-ME hairpin structures at both ends is obtained by extension;
[0521] Step 7: Remove the single-stranded portion of the hairpin structure through digestion with single-stranded nuclease, allowing the DNA to separate during denaturation;
[0522] Step 8: The DNA has a complete double-end adapter structure and can be amplified and library constructed using universal primers PCR.
[0523] The specific experimental steps are as follows:
[0524] 1) Take 20 μl of QuarPro Tn5 Transposase (1 U / μL) (Dynegene NE1001A) and add ME-UTP7 (SEQ ID NO. 11) (final concentration 10 μM);
[0525] SEQ ID NO.11:
[0526] 5'-[phos]CTGTCTCTTATACACATCTAGATCGGAAGAGCACACGTCTTTTTTAGACGTGTGCTCTTCCGATCTAGATGTGTATAAGAGACAG
[0527] 2) Incubate at 30°C for 60 minutes to label the ME-UTP7 transposome;
[0528] 3) Add 2 μl 5× Tagment Buffer (Dynegene), 1 μl ME-UTP7 transposome, 100 ng FFPE DNA, and make up to 10 μl with water;
[0529] 4) Incubate at 55°C for 20 minutes;
[0530] 5) Add 1 μL Termination Buffer (Dynegene) and pipette gently 10 times to mix the reaction system thoroughly;
[0531] 6) Add 12 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0532] 7) Add 5 μl of water to the Ampure beads for elution;
[0533] 8) Take 5 μl of the eluate and add 1.5 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 2.5 mM dCTP, and 0.6 μl of TdT (TAKARA 2230A).
[0534] 9) 37°C for 10 min and then 96°C for 2 min, then transfer to ice box;
[0535] 10) Add 2 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2.5 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 2 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 2 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 2.5 mM), and add water to a total of 21 μl;
[0536] SEQ ID NO.1:
[0537] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0538] SEQ ID NO.7:
[0539] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0540] 11) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0541]
[0542] 12) Add 5.5 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 1 μl S1 nuclease (10
[0543] U / μl). Place in a PCR instrument at 23°C for 25 min, then cool to 4°C until the next step.
[0544] 13) Add 27.5 μL of Ampure beads to bind the DNA and wash twice with 85% ethanol. Carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes.
[0545] 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) were added to the Ampure beads in sequence.
[0546] SEQ ID NO.4:
[0547] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0548] SEQ ID NO.5:
[0549] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0550] 14) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0551]
[0552] 15) Add 24 μL of Ampure beads to purify the PCR product, and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure.
[0553] 16) Take 5 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 18 As shown in A, the DNA length is concentrated between 100 bp and 750 bp.
[0554] Sequencing and analysis were performed using the NovaSeq X Plus. Sequence analysis revealed that all read 2s began with MEsequenceAGATGTGTATAAGAGACAG, which fully matched our experimental design.
[0555] Example 11 Directly constructing a library of blood collection card samples
[0556] 1) Use a 1.0 mm diameter punch to punch a hole in the blood collection card containing the blood sample;
[0557] 2) Soak the blood collection card with 14.5 μl Atlantis Digestion Buffer (ZYMO Cat: D5220);
[0558] 3) Incubate at 37°C for 60 minutes;
[0559] 4) Add 0.05 U of Atlantis dsDNase (ZYMO Cat: D5220);
[0560] 5) Incubate at 42°C for 30 minutes;
[0561] 6) Add 10 μl of magnetic beads (Apostle A17622-250) and 32 μl of lysis and binding solution (Apostle A17622-250);
[0562] 7) Incubate at room temperature for 30 minutes, shaking every 5 minutes to mix thoroughly.
[0563] 8) Place the tube on a magnetic stand and let it stand for 5 minutes, then discard the supernatant.
[0564] 9) Add 100 μl of washing solution (Apostle A17622-250) for washing, then magnetically adsorb and discard the supernatant;
[0565] 10) Wash with 100 μl of 85% ethanol, adsorb magnetically, and discard the supernatant;
[0566] 11) Wash again with 100 μl of 85% ethanol, magnetically adsorb, discard the supernatant, and air-dry for 5 minutes;
[0567] 12) Elute with 5 μl of water;
[0568] 13) Take 5 μl of the eluate, add 1.5 μl of 5X TdT Buffer (TAKARA 2230A), 1 μl of 3 mM dCTP, and 0.3 μl of TdT (TAKARA 2230A);
[0569] 14) 37°C for 10 min, then 96°C for 2 min, then transfer to ice box;
[0570] 15) Add 2 μl of SD Polymerase Reaction Buffer incomplete (BIORON), 2.5 μl of dNTP Mix (2.5 mM) and 0.5 μl of SD Polymerase 10 U / μL (BIORON), mix NAP5-N15 NH2 (final concentration 3 μM) (sequence shown in SEQ ID NO. 1) and SNAP5-G12 NH2 (final concentration 3.5 μM) (sequence shown in SEQ ID NO. 7), add MgCl2 (final concentration 4 mM), and add water to a total of 16 μl;
[0571] SEQ ID NO.1:
[0572] AGATCGGAAGAGCGTCGTAAAAAAACGACGCTCTTCCGATCTANNNNNNNNNNNNNN-(NH2-C6)
[0573] SEQ ID NO.7:
[0574] AGATCGGAAGAGCGTCGTAAAAAACGACGCTCTTCCGATCTAGGGGGGGGGGGG-(NH2-C6)
[0575] 16) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0576]
[0577] 17) To the 16 μl reaction solution, add 8 μl of Ligation Buffer and 1.5 μl of DNA ligase V3 (Hua Rui Kang HRK-CC220-24). Also add the P-STP76 adapter (SEQ ID NO. 8) (final concentration 0.5 μM), the P-SCP77 adapter (SEQ ID NO. 9) (final concentration 0.5 μM), and the P-STP7B9 adapter (SEQ ID NO. 10) (final concentration 0.5 μM).
[0578] A total volume of 28 μl was placed in a PCR instrument at 20°C for 25 min, then cooled to 4°C until the next step;
[0579] SEQ ID NO.8:
[0580] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTT
[0581] SEQ ID NO.9:
[0582] pAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTC
[0583] SEQ ID NO.10:
[0584] pTAGATCGGAAGAGCACACGTCTTTTTAGACGTGGTGCTCTTCCGATCTA
[0585] 18) Add 7 μl 5X Reaction Buffer (Thermo Scientific EN0321) and 2 μl S1 nuclease (10
[0586] U / μl). Place in a PCR instrument at 23°C for 20 min, then cool to 4°C until the next step.
[0587] 19) Add 42 μL of Ampure beads to bind DNA and wash twice with 85% ethanol; carefully remove the 85% ethanol wash solution and air-dry at room temperature for 5 minutes;
[0588] 20) Add 9 μl of water, 1 μl of primer mix (LP5-UDI0021 and LP7-UDI0021, 10 μM each, with sequences as shown in SEQ ID NOs. 4 and 5, respectively), and 10 μl of KAPA HiFi HotStart Ready Mix (Roche) to the Ampure beads in sequence;
[0589] SEQ ID NO.4:
[0590] AATGATACGGCGACCACCGAGATCTACACAAGACGTCACACTCTTTCCCTACACGACGCTCTTCCGATC
[0591] SEQ ID NO.5:
[0592] CAAGCAGAAGACGGCATACGAGATGGTACCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT
[0593] 21) Place the tube on a PCR instrument and follow the reaction procedure as follows:
[0594]
[0595] 22) Add 24 μL of Ampure beads to purify the PCR product and elute with 50 μL of water to obtain an NGS library with a complete double-end adapter structure;
[0596] 23) Take 5 μl of NGS library and run electrophoresis on 1% agarose gel at 100 V for 20 minutes. Figure 18 As shown in B, the DNA length is concentrated between 100bp and 750bp. Figure 19 As shown in A. Sequencing and sequence analysis were performed using NovaSeq XPlus. The library length distribution is shown in Figure 19 As shown in B.
[0597] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. A method for nucleic acid U-shaped self-rotation amplification, characterized in that: The method comprises adding a specific linker to the 3' end of a single-stranded nucleic acid, wherein the specific linker comprises a hairpin structure and an adapter sequence, and the adapter sequence is used for complementary binding to the 3' end of the single-stranded nucleic acid; After the single-stranded nucleic acid is combined with a specific adapter, it is extended from the 3' end of the single-stranded nucleic acid using the specific adapter as a template. The extended single-stranded nucleic acid has a hairpin structure to form a self-rotation, and then the original single-stranded nucleic acid is used as a template for extension and amplification to form an amplified product.
2. The method according to claim 1, wherein The hairpin structure comprises a stem region and a loop region, the two chains of the stem region are complementary, preferably, the two chains of the stem region are a linker template and a linker sequence, the linker template is complementary to the linker sequence, and the linker sequence is connected to the end of the linker template; and / or, the single-stranded nucleic acid is selected from DNA or RNA; and / or, the 3' end of the single-stranded nucleic acid includes a natural 3' end of the single-stranded nucleic acid or a 3' end that has been extended and modified; and / or, the adapter sequence consists of 6 to 25 degenerate bases N; And / or, a blocking group is provided at the 3' end of the adapter sequence, and the blocking group is a 3' terminal hydroxyl active blocking group; preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.
3. The method according to claim 2, wherein the adapter template is selected from a sequencing primer binding site, a protein binding sequence, or a promoter sequence; preferably, the sequence of the sequencing primer binding site is selected from a partial sequence or full-length sequence of sequencing primer binding sites R1, R2, or their respective complementary sequences R1', R2'; and / or, the sequence length of the stem region in the hairpin structure is 5 to 40 bp; And / or, the sequence of the loop region in the hairpin structure is TTTTT, AAAAAA, ACTCTTTCCCTA or AATAA.
4. The method according to claim 1, wherein The specific adapter includes a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, an adapter sequence and a blocking group; or, the specific adapter sequence includes a sequencing primer binding site R2, a loop structure, a sequence R2' complementary to the sequencing primer binding site R2, an adapter sequence and a blocking group.
5. Use of the method according to any one of claims 1 to 4 in DNA amplification, library construction, qPCR detection, ddPCR detection, DNA methylation detection, second-generation sequencing, third-generation sequencing and / or fourth-generation sequencing.
6. A nucleic acid molecule linker, characterized in that The nucleic acid molecule linker includes a first linker, which includes a hairpin structure and a random sequence. The hairpin structure includes a stem region and a loop region. The two chains of the stem region are complementary. The two chains of the stem region are a linker template and a linker sequence, respectively. The linker template is complementary to the linker sequence. The random sequence is connected to the end of the linker template. The random sequence includes a sequence that is complementary to the 3' end portion of the nucleic acid molecule to be tested.
7. The nucleic acid molecule linker according to claim 6, characterized in that The 3' end of the nucleic acid molecule to be tested includes the natural 3' end or the extended and modified 3' end of the nucleic acid molecule to be tested; preferably, the extended and modified sequence consists of 2 to 30 degenerate bases N; And / or, the nucleic acid molecule to be detected is selected from DNA or RNA; And / or, the adapter template is selected from a sequencing primer binding site, a protein binding sequence or a promoter sequence; preferably, the sequence of the sequencing primer binding site is selected from a partial sequence or full-length sequence of the sequencing primer binding sites R1, R2 or their respective complementary sequences R1', R2'; And / or, the random sequence consists of 6 to 25 degenerate bases N; And / or, a blocking group is provided at the 3' end of the random sequence, and the blocking group is a nucleic acid molecule linker 3' terminal hydroxyl active blocking group; preferably, the blocking group is selected from NH2 modification, MGB modification, Spacer modification, ddNTP, phosphate group, cy3, cy5, VIC, FAM, BHQ1 or BHQ2.
8. The nucleic acid molecule linker according to claim 6, characterized in that The first adapter comprises a sequencing primer binding site R1, a loop structure, a sequence R1' complementary to the sequencing primer binding site R1, a random sequence, and a blocking group; or the first adapter comprises a sequencing primer binding site R2, a loop structure, a sequence R1' complementary to the sequencing primer binding site R2, a random sequence, and a blocking group; and / or, the sequence length of the first linker stem region is 5 to 40 bp; And / or, the sequence of the first linker loop region is TTTTT, AAAAAA, ACTCTTTCCCTA or AATAA.
9. The nucleic acid molecule linker according to claim 6, characterized in that The nucleic acid molecule linker further comprises a second linker, which is a linker containing a phosphorylation modification or a linker not containing a phosphorylation modification. 10 . The nucleic acid molecule linker according to claim 9 , wherein the second linker has a blunt end or a sticky end; preferably, the end of the second linker having a sticky end is T and / or C.
11. The nucleic acid molecule linker according to claim 9, characterized in that The second adapter is a hairpin structure, comprising a stem region and a loop region, the two chains of the stem region being complementary, the two chains of the stem region being sequencing primer binding sites, the sequencing primer binding sites being selected from sequencing primer binding sites R1, R2 or their respective complementary sequences R1' or R2', and the sequencing primer binding sites being different from the sequencing primer binding sites in the first adapter.
12. The nucleic acid molecule linker according to claim 9, characterized in that The second adapter is a Y-shaped adapter, which includes a head and a tail, and the head and the tail each include two chains. The head is two chains with non-complementary bases, and the two chains of the tail are complementary. The two chains of the tail are sequencing primer binding sites, and the sequencing primer binding sites are selected from sequencing primer binding sites R1, R2 or their respective complementary sequences R1' or R2'. The sequencing primer binding sites are different from the sequencing primer binding sites in the first adapter.
13. The nucleic acid molecule linker according to claim 11, characterized in that The length of the stem region of the second linker is generally 5 to 40 bp; and / or the loop region sequence of the second linker is TTTTT, AACTCCAGTCA, ACTCCAGTC, CTCCAGT or AAAAAA.
14. Use of the nucleic acid molecule linker according to any one of claims 6 to 13 in adding a linker to a nucleic acid molecule to be tested or in preparing a DNA library construction product.
15. A kit for constructing a DNA library, characterized in that: The kit comprises the nucleic acid molecule linker according to any one of claims 6 to 13, and further comprises any one or more of the following: nucleic acid polymerase, library construction reagent, nucleic acid purification reagent, and single-stranded nuclease.
16. A method for constructing an NGS library using nucleic acid U-shaped self-rotation amplification, characterized in that: The NGS library is constructed using the kit according to claim 15.
17. The method according to claim 16, characterized in that The method comprises the following steps: 1) mixing the nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and a first adapter and reacting the mixture to copy the adapter sequence to the 3' end of the original strand of the nucleic acid molecule to be tested; 2) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand; 3) mixing the product of step 2), the second linker, and DNA ligase and reacting them to add the second linker to the original strand and / or synthesized strand of the nucleic acid molecule to be tested; 4) Purifying the product in step 3) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
18. The method according to claim 17, characterized in that Also includes any one or more of the following features: A) In step 1), the nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, and dNTPs are mixed to extend and modify the 3' end of the nucleic acid molecule to be tested; B) In step 2), the first linker and the original strand of the nucleic acid molecule to be detected are first denatured to open the junction, and then a nucleic acid polymerase is used to extend and synthesize a complementary strand to form a double strand; C) in step 3), the second linker is a blunt-ended second linker or a sticky-ended second linker; D) In step 3), the nucleic acid molecule to be tested, to which the second adapter is added, is mixed with a single-stranded nuclease to remove the single-stranded portion of the first adapter and / or the second adapter; E) In step 4), after the PCR reaction is completed, the PCR product is mixed with magnetic beads for purification.
19. The method according to claim 16, wherein The method comprises the following steps: 1) mixing a double-stranded test nucleic acid molecule, a transposase, and a second adapter and reacting the mixture to add the second adapter sequence to the 5' end of the test nucleic acid molecule; the second adapter is a hairpin structure and has an ME sequence; 2) denaturing to convert the product in step 1) into a single strand, thereby obtaining a single-stranded nucleic acid molecule to be detected with a second linker; 3) mixing the single-stranded nucleic acid molecule to be tested, a nucleic acid polymerase with strand displacement activity, and the first adapter and reacting the mixture to copy the first adapter sequence to the 3' end of the nucleic acid molecule to be tested; 4) synthesizing a complementary strand of the original strand of the nucleic acid molecule to be tested so that the nucleic acid molecule to be tested forms a double strand; 5) Purifying the product in step 4) with magnetic beads, mixing it with PCR amplification reagents and performing PCR reaction to obtain an NGS library of the nucleic acid molecules to be tested and / or their complementary chains including a double-ended adapter structure.
20. The method according to claim 19, characterized in that Also includes any one or more of the following features: A) In step 3), before the mixing reaction, the single-stranded nucleic acid molecule to be tested, terminal deoxynucleotidyl transferase, and dNTPs are mixed to extend and modify the 3' end of the nucleic acid molecule to be tested; B) In step 4), the nucleic acid molecule to be tested with the first adapter is mixed with a single-stranded nuclease to remove the single-stranded portion of the first adapter and / or the second adapter.
21. Use of the method according to any one of claims 16 to 20 in any one or more of the following: 1) Used for constructing NGS libraries from FFPE DNA; 2) Used for ancient DNA construction NGS library; 3) No blood extraction is required, allowing for direct construction of whole-genome NGS libraries; 4) Blood card samples can be directly used to construct whole-genome NGS libraries without extraction; 5) No plasma extraction is required for direct construction of cfDNA NGS libraries; 6) Achieve plasma extraction-free and construct a plasma cfDNA bisulfite-treated NGS library for methylation sequencing; 7) Realize the extraction-free method of maternal plasma for the construction of cffDNA NGS libraries; 8) Enable direct construction of NGS libraries from FFPE slides.
Citation Information
Patent Citations
Method for constructing nucleic acid molecule
CN107208162A
Novel construction method for genome methylation library and application thereof
CN110195095A
Specific recognition sequence based T cell receptor high-throughput sequencing library construction and sequencing data analysis method
CN111363783A
Construction method of single-stranded nucleic acid molecule sequencing library
CN115197998A
Capturing and library building method based on single-chain connection and application
CN116200478A