Composition for enhancing distinguishing miRNA and pre-miRNA and one-step detection method
By designing RT-qPCR detection technology for competitive reactions, using the chemical modification of Linker sequence and blocker sequence, the problem of miRNA and pre-miRNA distinction detection is solved, and efficient and simple distinction effect is achieved, improving the sensitivity and specificity of the detection.
Patent Information
- Application Number
- CN202510623168.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to efficiently distinguish and detect microRNAs (miRNAs) and their precursors (pre-miRNAs), especially when the presence of high concentrations of pre-miRNAs is prone to false positive signals, and the operation is complicated or costly.
A composition is designed including forward and reverse primers, Linker sequence, blocker sequence and fluorescent probe. Through RT-qPCR detection technology of competitive reactions, chemical modification of Linker sequence and competitive binding of blocker sequence are used to inhibit non-specific binding of pre-miRNA, and differentiate detection of miRNA and pre-miRNA.
It realizes the high sensitivity and specificity of differentiation between miRNA and pre-miRNA in single-tube reactions, inhibits non-specific signals, improves the detection effect by 3.2 times, and simplifies the operation process.
Smart Images

Figure CN120442764A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to a composition capable of enhancing the differentiation of miRNA and pre-miRNA sequences in a single-tube reaction and a new one-step RT-qPCR detection method. Background Art
[0002] MicroRNA (miRNA) is a class of small RNA molecules with a length of 19-24 nucleotides that are widely expressed in animals, plants, and viruses. MiRNA plays a key regulatory role in a variety of biological processes, including cell differentiation, development, and homeostasis. Recent studies have shown that dysregulation of miRNA function is closely related to an increasing number of human diseases, especially playing an important role in the occurrence and development of cancer. Because miRNA can be detected from blood or other easily accessible body fluids, it has the potential to serve as a minimally invasive disease marker. This feature gives it broad application prospects in disease diagnosis and prognosis assessment.
[0003] The biosynthesis of miRNA is a complex process. First, miRNA is transcribed by RNA polymerase II or III in the form of primary transcripts (pri-miRNA). Subsequently, pri-miRNA is cleaved by the Drosha enzyme in the cell nucleus into a precursor miRNA (pre-miRNA) of approximately 70 nucleotides in length. The pre-miRNA has a characteristic stem-loop structure. After being transported to the cytoplasm by Exportin 5, the pre-miRNA is further cleaved by the Dicer enzyme, eventually forming a mature miRNA. In tissue or body fluid samples, mature miRNA and pre-miRNA often coexist, and the sequence of the miRNA is consistent with part of the sequence of the pre-miRNA, which poses a huge challenge to the detection of miRNA.
[0004] Currently, the methods used to distinguish and detect miRNAs mainly include the following:
[0005] 1. Northern blot: This is a traditional RNA detection method that can distinguish miRNAs from pre-miRNAs based on their molecular weight. However, this method is cumbersome, time-consuming, and has low sensitivity, making it unsuitable for detecting low-abundance miRNAs.
[0006] 2. Stem-loop RT-PCR: This is the most classic method for miRNA detection. It uses specific stem-loop primers to reverse transcribe miRNA, followed by real-time quantitative PCR. This method is highly sensitive, but requires a two-step process and can be difficult to completely eliminate interference from pre-miRNA.
[0007] 3. Dual molecular beacon method: This method uses two molecular beacons, one for detecting mature miRNA and the other for detecting pre-miRNA. Although it can distinguish between miRNA and pre-miRNA, it is complicated to operate and has high costs.
[0008] 4. SMOS-qPCR: This is an ultrasensitive miRNA detection system that can simultaneously detect multiple miRNAs in a single tube with a sensitivity of up to 0.1 zM. This method improves the ability to distinguish between miRNAs and pre-miRNAs by designing specialized primers and linker sequences. However, this method can still produce strong false-positive signals in the presence of high concentrations of pre-miRNA.
[0009] Given the importance of miRNAs as biomarkers and the challenges of their accurate detection, developing a novel method that can effectively distinguish miRNAs from pre-miRNAs while also being highly sensitive, specific, simple to operate, affordable, and amenable to multiplexed detection has significant scientific significance and application value. This method will not only advance the in-depth study of miRNAs but also potentially provide new tools and strategies for disease diagnosis, prognosis assessment, and personalized treatment. Summary of the Invention
[0010] To solve the above technical problems, the present invention provides a composition for enhancing the differentiation of miRNA and pre-miRNA and a one-step detection method, thereby achieving enhanced differentiation and detection of miRNA and pre-miRNA.
[0011] The technical solutions provided by the present invention are as follows:
[0012] A composition for enhancing the differentiation of miRNA and pre-miRNA, comprising forward and reverse primers, a linker sequence, a blocker sequence, a fluorescent probe and a reaction mixture;
[0013] The reverse primer also serves as a reverse transcription primer for miRNA;
[0014] The 3' end of the linker sequence is modified by a chemical group and blocked from extension. The modification group of the linker sequence includes one or more of a phosphate group, C3, C6, and C9.
[0015] Furthermore, the 3' end of the blocker sequence is modified with a chemical group and blocked from extension, and the modification group of the blocker sequence includes one or more of MGB, phosphate group, C3, C6, and C9.
[0016] Furthermore, the blocker sequence includes fragment A and fragment B, wherein fragment A starts from the 5' end of the blocker sequence and is completely complementary to the 3' end of the pre-miRNA cDNA relative to the extended portion of the miRNA cDNA; the 5' end of fragment B is connected to the 3' end of fragment A, has a length of approximately 2-10 nt, and forms a complementary pair with the common sequence of the pre-miRNA cDNA and the miRNA cDNA.
[0017] Furthermore, the blocker sequence bases include one or more of deoxyribonucleic acid (DNA), locked nucleic acid (LNA) or peptide nucleic acid (PNA).
[0018] Furthermore, the 3'-end modified chemical group of the blocker sequence is MGB.
[0019] Furthermore, the length of the blocker sequence is 11 nt to 17 nt.
[0020] Furthermore, the reaction mixture comprises reverse transcriptase, DNA hot-start polymerase, MgCl2, a mixture of four dNTPs, KCl and deionized water.
[0021] Furthermore, the concentration of the blocker sequence is 0.1-0.8 μM, the concentration of the linker is 5-20 nM, the concentration of the forward and reverse primers is 0.2-0.8 μM, and the concentration of the fluorescent probe is 0.1-0.2 μM.
[0022] The present invention also provides a one-step detection method for enhancing the differentiation of miRNA and pre-miRNA, the detection method comprising: using the above-mentioned composition for enhancing the differentiation of miRNA and pre-miRNA, placing forward and reverse primers, linker sequences, blocker sequences, fluorescent probes, reaction mixtures and reaction templates into the same reaction tube, wherein the reaction template is miRNA or pre-miRNA, and evaluating the effect of differentiating miRNA and pre-miRNA by subtracting the Ct values obtained after simultaneous amplification of miRNA and pre-miRNA to obtain a ΔCt value, wherein the larger the ΔCt value, the more significant the differentiation effect.
[0023] Furthermore, the detection procedure is:
[0024] 50℃ for 30 minutes, 1 cycle; 95℃ for 10-15 minutes, 1 cycle; 37℃ for 1 minute, 46-54℃ for 1 minute, 1 cycle; 95℃ for 10-15 seconds, 56℃ for 30 seconds, 70-72℃ for 10 seconds, 50 cycles; 10℃ for 1 minute, 1 cycle.
[0025] Beneficial effects
[0026] The present invention designs a one-step RT-qPCR detection technology for miRNA in which blocker and linker sequences compete for reaction. The hybridization of nucleic acid sequences can be accurately calculated and controlled by the thermodynamic parameter: standard Gibbs free energy, and multiple groups of nucleic acid sequences can be guided through competitive reactions to produce the best discrimination effect of similar sequences. Due to the presence of the linker sequence, the reverse transcribed cDNA template can be further extended, breaking the limitation that the cDNA template obtained in the original two-step method is too short to be directly amplified. At the same time, through the competitive binding of the blocker and the pre-miRNA cDNA, the non-specific binding of the pre-miRNA and the linker sequence is inhibited, and the maximum inhibition multiple can be enhanced by 3.2 times without affecting the detection effect of miRNA, thereby achieving enhanced differentiation detection of miRNA and pre-miRNA. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Schematic diagram of the principles of the present invention. (a) After the reverse transcription primer generates miRNA cDNA, it binds tightly to the linker sequence but cannot stably bind to the blocker sequence, generating a stable miRNA signal. (b) In the absence of the blocker sequence, the linker sequence produces a small amount of nonspecific binding to the 3' end of the high-concentration pre-miRNA cDNA, generating a nonspecific signal. (c) After the blocker sequence is introduced, the blocker sequence and linker sequence compete with the pre-miRNA cDNA, resulting in a more stable binding of the blocker sequence to the pre-miRNA cDNA, thereby suppressing the generation of nonspecific templates.
[0028] Figure 2 Comparison of the effects of different 3'-end modifications and base modifications in the blocker sequence. (a) Comparison of the enhancement effects of a blocker-free sequence, a phosphate group (POOH), and a MGB-modified blocker sequence, and (c, d) schematic diagrams of the enhancement mechanism. (b) Comparison of the effects of LNA base modifications at different positions in the blocker sequence.
[0029] Figure 3 Comparison of the enhancement effects of blockers of different lengths and concentrations on miR-16: comparison of the effects of 11-17nt blockers in distinguishing between miRNA and pre-miRNA (a, b), comparison of the effects of 13nt blockers in distinguishing between miRNA and pre-miRNA at different concentrations (c, d), and comparison of the effects of 15nt blockers in distinguishing between miRNA and pre-miRNA at different concentrations (e, f).
[0030] Figure 4 Comparison of the effects of different concentrations of blockers on miR-93 (a, b) and miR-21 (c, d).
[0031] Figure 5 Comparison of the differentiation effect at different reaction temperatures, (a) Ct value comparison, (b) △△Ct value comparison. DETAILED DESCRIPTION
[0032] The present invention will be further explained below with reference to the accompanying drawings and specific embodiments.
[0033] Example 1
[0034] 6×10 7 The miR-16 and pre-miR-16 copies / reactions were used as templates. A blocker-free control was prepared by adding 1.2µL of 10µM forward and reverse primers, 3µL of 100nM linker sequence, 0.3µL of 10µM fluorescent probe (Taqman probe), 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology, containing reverse transcriptase and DNA hot-start polymerase), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology, containing MgCl2, dNTPs mix, KCl, and deionized water), 4µL of template, and DEPC water to 30µL. For the blocker-free control, a 15nt blocker was added to the blocker-free control at a final concentration of 0.2µM, and the volume of DEPC water was reduced accordingly, maintaining a total volume of 30µL. The 15nt blocker corresponds to a fragment B length of 6nt. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0035] SEQ ID NO.1 miR-16 sequence: UAGCAGCACGUAAAUAUUGGCG;
[0036] SEQ ID NO.2 pre-miR-16 sequence:
[0037] guuccacuUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaaca-
[0038] CCAAUAUUACUGUGCUGCUUUAgugugac;
[0039] SEQ ID NO.3 miR-16 reverse primer CCTACAGACTACGCCAATAT;
[0040] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0041] SEQ ID NO.5 miR-16 Linker sequence
[0042] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT-POOH;
[0043] SEQ ID NO.6 miR-16 Taqman probe FAM-CAGAGCCAACTAGC-MGB;
[0044] SEQ ID NO.7 miR-16 phosphate group blocking 15nt blocker GTTCCACTCTAGCAG-POOH;
[0045] SEQ ID NO.8 miR-16 MGB group blocking 15nt blocker GTTCCACTCTAGCAG-MGB.
[0046] Test results such as Figure 2 As shown in a, when no blocker sequence is added, 6×10 7 The pre-miR-16 of the copies / reaction still has a strong amplification signal. However, after adding the 15 nt blocker sequence blocked by the phosphate group, the effect is not significant (△△Ct). This is because the temperature of the extension step is 50℃, so the 15nt blocker is not stable when binding to the pre-miR-16 cDNA at this time ( Figure 2 c). MGB is a modification group that helps short oligonucleotides bind. Therefore, after we modified the 15nt blocker sequence with MGB, the ability to distinguish between miR-16 and pre-miR16 was significantly enhanced (the larger the △△Ct value, the stronger the differentiation ability) ( Figure 2 a, 2d).
[0047] Example 2
[0048] 6×10 7The miR-16 and pre-miR-16 copies / reactions were used as templates. A blocker-free control was prepared by adding 1.2µL of 10µM forward and reverse primers, 3µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and filling to 30µL with DEPC water. For the blocker-free control, a 15nt blocker was added to the blocker-free control at a final concentration of 0.2µM, and the volume of DEPC water was reduced accordingly, maintaining a total volume of 30µL. The 15nt blocker corresponds to a fragment B length of 6nt. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0049] SEQ ID NO.1 miR-16 sequence: UAGCAGCACGUAAAUAUUGGCG;
[0050] SEQ ID NO.2 pre-miR-16 sequence:
[0051] guuccacuUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaaca-
[0052] CCAAUAUUACUGUGCUGCUUUAgugugac;
[0053] SEQ ID NO.3 miR-16 reverse primer CCTACAGACTACGCCAATAT;
[0054] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0055] SEQ ID NO.5 miR-16 Linker sequence
[0056] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT-POOH;
[0057] SEQ ID NO.6 miR-16 Taqman probe FAM-CAGAGCCAACTAGC-MGB;
[0058] SEQ ID NO.9 miR-16 5' end LNA modified 15nt blocker GTT CCACTCTAGCAG-POOH;
[0059] SEQ ID NO.10 miR-16 intermediate modified 15nt blocker GTTCCA CTC TAGCAG-POOH;
[0060] SEQ ID NO.11 miR-16 3' end LNA modified 15nt blocker GTTCCACTCTAG CAG -POOH.
[0061] The results are as follows Figure 2 As shown in a, modifying three bases at any position in the blocker sequence to LNA can also significantly enhance the ability of the one-step detection system to distinguish miR-16 from pre-miR-16.
[0062] Example 3
[0063] 6×10 7 The miR-16 and pre-miR-16 copies / reactions were used as templates. A blocker-free control was prepared by adding 1.2µL of 10µM forward and reverse primers, 3µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and filling to 30µL with DEPC water. For the blocker-free control, add 11nt, 13nt, 15nt, and 17nt blockers to a final concentration of 0.2µM, respectively, and reduce the volume of DEPC water accordingly, maintaining a total volume of 30µL. The corresponding fragment B lengths for the 11nt, 13nt, 15nt, and 17nt blockers are 2nt, 4nt, 6nt, and 8nt, respectively. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0064] SEQ ID NO.1 miR-16 sequence: UAGCAGCACGUAAAUAUUGGCG;
[0065] SEQ ID NO.2 pre-miR-16 sequence:
[0066] guuccacuUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaaca-
[0067] CCAAUAUUACUGUGCUGCUUUAgugugac;
[0068] SEQ ID NO.3 miR-16 reverse primer CCTACAGACTACGCCAATAT;
[0069] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0070] SEQ ID NO.5 miR-16 Linker sequence
[0071] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT-POOH;
[0072] SEQ ID NO.6 miR-16 Taqman probe FAM-CAGAGCCAACTAGC-MGB;
[0073] SEQ ID NO.8 miR-16 MGB group blocking 15nt blocker GTTCCACTCTAGCAG-MGB;
[0074] SEQ ID NO.12 miR-16 MGB group blocking 11nt blocker GTTCCACTCTA-MGB;
[0075] SEQ ID NO.13 miR-16 MGB group blocking 13nt blocker GTTCCACTCTAGC-MGB;
[0076] SEQ ID NO.14 miR-16 MGB group blocking 17nt blocker GTTCCACTCTAGCAGCA-MGB.
[0077] Test results such as Figure 3As shown in Figures a and 3b, MGB-modified blockers of different lengths can enhance the discrimination between miR-16 and pre-miR-16, but blockers of different lengths also have a slight inhibitory effect on miR-16 (the larger the delay △Ct value, the more severe the inhibition).
[0078] Example 4
[0079] Based on the results of Example 3, we selected 13nt and 15nt MGB modified blockers to verify the blocker effects at different concentrations.
[0080] 6×10 7 The miR-16 and pre-miR-16 copies / reactions were used as templates. A blocker-free control was prepared by adding 1.2µL of 10µM forward and reverse primers, 3µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and DEPC water to 30µL. For the blocker-free control, add 13nt and 15nt blockers to final concentrations of 0.1, 0.2, 0.4, 0.6, and 0.8µM, respectively, and reduce the volume of DEPC water accordingly, maintaining a total volume of 30µL. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0081] SEQ ID NO.1 miR-16 sequence: UAGCAGCACGUAAAUAUUGGCG;
[0082] SEQ ID NO.2 pre-miR-16 sequence:
[0083] guuccacuUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaaca-
[0084] CCAAUAUUACUGUGCUGCUUUAgugugac;
[0085] SEQ ID NO.3 miR-16 reverse primer CCTACAGACTACGCCAATAT;
[0086] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0087] SEQ ID NO.5 miR-16 Linker sequence
[0088] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT-POOH;
[0089] SEQ ID NO.6 miR-16 Taqman probe FAM-CAGAGCCAACTAGC-MGB;
[0090] SEQ ID NO.8 miR-16 MGB group blocking 15nt blocker GTTCCACTCTAGCAG-MGB;
[0091] SEQ ID NO.13 miR-16 MGB group blocking 13nt blocker GTTCCACTCTAGC-MGB.
[0092] The results are as follows Figure 3 As shown in Figure cf, blockers of varying concentrations can strongly discriminate between miR-16 and pre-miR-16, with the 13nt blocker achieving the best discrimination at 0.2µM. The 15nt blocker's discrimination efficiency increases with increasing concentration, but its inhibition of miR-16 also increases, with the optimal effect observed at 0.4µM.
[0093] Example 5
[0094] 6×10 7Using miR-93 and pre-miR-93 from the miR-93 replicas / reaction assay as templates, a blocker-free control was prepared: 1.2µL of 10µM forward and reverse primers, 1.5µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and DEPC water were added to 30µL. For the blocker-free control, a 17nt blocker was added to the final concentrations of 0.1, 0.2, and 0.4µM, respectively. Fragment B was 7nt in length. The volume of DEPC water was reduced accordingly, maintaining the total volume at 30µL. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0095] SED ID NO.14: miR-93 sequence CAAAGUGCUGUUCGUGCAGGUAG;
[0096] SEQ ID NO.15: pre-miR-93 sequence ccgggggctCGGGAAGTGCTAGCTCAGCAGTaggttgggtaatcaca-
[0097] CTACCTGCACGAACAGCACTTTGgagcccccag;
[0098] SEQ ID NO.16: miR-93 reverse primer TTACAGTGGTCCTACCTGCACG;
[0099] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0100] SEQ ID NO.17 miR-93 Linker sequence
[0101] GTACTGCATCATCGGTCTACGAACTCTGACTCGCAAAGTGCTGTTC-POOH;
[0102] SEQ ID NO.18 miR-93 Taqman probe JOE-TCTGACTCGCAAAG-MGB;
[0103] SEQ ID NO.19 miR-93 MGB group blocking 17nt blocker ctgggggctcCAAAGTG-MGB.
[0104] Test results such as Figure 4 As shown in Figures a and 4b, the 17nt blocker at 0.1µM can produce a significant discriminatory effect on miR-93 and pre-miR-93.
[0105] Example 5
[0106] 6×10 7 Using miR-21 and pre-miR-21 from the PCR products (copies / reactions) as templates, a blocker-free control was prepared: 1.2µL of 10µM forward and reverse primers, 1.5µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and DEPC water were added to 30µL. For the blocker-free control, a 13nt blocker was added to the final concentrations of 0.2, 0.4, and 0.6µM, respectively. Fragment B was 6nt in length. The volume of DEPC water was reduced accordingly, maintaining the total volume at 30µL. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 50°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0107] SED ID NO.20: miR-21 sequence UAGCUUAUCAGACUGAUGUUGA;
[0108] SEQ ID NO.21: pre-miR-21 sequence ugcgggUAGCUUAUCAGACUGAUGUUGAcuguugaaucucaugg-
[0109] CAACACCAGUCGAUGGGCUGUcugaca;
[0110] SEQ ID NO.22: miR-21 reverse primer CTCAGCTCTCAACATCAGT;
[0111] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0112] SEQ ID NO.23 miR-21 Linker sequence
[0113] GTACTGCATCATCGGTCTACGAACATGTCCGCCTAGCTTATCAG-POOH;
[0114] SEQ ID NO. 24 miR-21 Taqman probe TAMRA-ATGTCCGCCTAGCT-MGB;
[0115] SEQ ID NO.25 miR-21 MGB group blocking 13nt blocker tgtcgggTAGCTT-MGB.
[0116] Test results such as Figure 4 As shown in Figures c and 4d, with the increase of blocker concentration, the enhancing effect on miR-21 and pre-miR-21 gradually increased.
[0117] Example 6
[0118] 6×10 7 The miR-16 and pre-miR-16 copies / reactions were used as templates. A blocker-free control was prepared by adding 1.2µL of 10µM forward and reverse primers, 3µL of 100nM linker sequence, 0.3µL of 10µM Taqman probe, 1.2µL Hotstart HiTaq & Script III (PhiPeng Biotechnology), 7.5µL of 4× RT PCR Buffer (PhiPeng Biotechnology), 4µL of template, and filling to 30µL with DEPC water. For the blocker-free control, add a 15nt blocker to a final concentration of 0.4µM and reduce the volume of DEPC water accordingly, maintaining a total volume of 30µL. The detection was performed according to the following reaction program: 50°C for 30 minutes, 1 cycle; 95°C for 15 minutes, 1 cycle; 37°C for 1 minute, 46°C / 50°C / 54°C for 1 minute, 1 cycle; 95°C for 15 seconds, 56°C for 30 seconds, 70°C for 10 seconds, 50 cycles; 10°C for 1 minute, 1 cycle.
[0119] SEQ ID NO.1 miR-16 sequence: UAGCAGCACGUAAAUAUUGGCG;
[0120] SEQ ID NO.2 pre-miR-16 sequence:
[0121] guuccacuUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaaca-
[0122] CCAAUAUUACUGUGCUGCUUUAgugugac;
[0123] SEQ ID NO.3 miR-16 reverse primer CCTACAGACTACGCCAATAT;
[0124] SEQ ID NO.4 Universal forward primer GTACTGCATCATCGGTCTAC;
[0125] SEQ ID NO.5 miR-16 Linker sequence
[0126] GTACTGCATCATCGGTCTACGTACCAGAGCCAACTAGCAGCACGT-POOH;
[0127] SEQ ID NO.6 miR-16 Taqman probe FAM-CAGAGCCAACTAGC-MGB;
[0128] SEQ ID NO.8 miR-16 MGB group blocking 15nt blocker GTTCCACTCTAGCAG-MGB.
[0129] The results are as follows Figure 5 As shown, the linker and blocker sequences competed at three different temperatures, 46°C, 50°C, and 54°C, and could effectively distinguish miR-16 from pre-miR-16, demonstrating the effectiveness of the present invention.
Claims
1. A composition for enhancing the differentiation of miRNA and pre-miRNA, characterized in that: Including forward and reverse primers, linker sequence, blocker sequence, fluorescent probe and reaction mixture; The reverse primer also serves as a reverse transcription primer for miRNA; The 3' end of the linker sequence is modified by a chemical group and blocked from extension. The modification group of the linker sequence includes one or more of a phosphate group, C3, C6, and C9.
2. The composition for enhancing the differentiation of miRNA and pre-miRNA according to claim 1, characterized in that The 3' end of the blocker sequence is modified with a chemical group to block extension, and the modification group of the blocker sequence includes one or more of MGB, phosphate group, C3, C6, and C9.
3. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The blocker sequence includes fragment A and fragment B, wherein fragment A starts from the 5' end of the blocker sequence and is completely complementary to the 3' end of the pre-miRNA cDNA relative to the extended portion of the miRNA cDNA; the 5' end of fragment B is connected to the 3' end of fragment A, has a length of about 2-10 nt, and forms a complementary pair with the common sequence of the pre-miRNA cDNA and the miRNA cDNA.
4. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The blocker sequence bases include one or more of deoxyribonucleic acid, locked nucleic acid and peptide nucleic acid.
5. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The 3'-end modified chemical group of the blocker sequence is MGB.
6. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The length of the blocker sequence is 11nt~17nt.
7. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The reaction mixture comprises reverse transcriptase, DNA hot-start polymerase, MgCl2, dNTPs mixed solution, KCl and deionized water.
8. The composition for enhancing the differentiation between miRNA and pre-miRNA according to claim 1, characterized in that The concentration of the blocker sequence is 0.1-0.8 μM, the concentration of the linker is 5-20 nM, the concentration of the forward and reverse primers is 0.2-0.8 μM, and the concentration of the fluorescent probe is 0.1-0.2 μM.
9. A one-step detection method for enhancing the distinction between miRNA and pre-miRNA, characterized in that: The detection method comprises: using the composition for enhancing the differentiation of miRNA and pre-miRNA according to any one of claims 1 to 7, placing forward and reverse primers, a linker sequence, a blocker sequence, a fluorescent probe, a reaction mixture and a reaction template into the same reaction tube, wherein the reaction template is miRNA or pre-miRNA, and performing a delta Ct value obtained by subtracting the Ct values obtained after simultaneous amplification of the miRNA and pre-miRNA to evaluate and differentiate the miRNA and pre-miRNA.
10. The one-step detection method for enhancing the distinction between miRNA and pre-miRNA according to claim 9, characterized in that: The testing procedure is: 50℃ for 30 minutes, 1 cycle; 95℃ for 10-15 minutes, 1 cycle; 37℃ for 1 minute, 46-54℃ for 1 minute, 1 cycle; 95℃ for 10-15 seconds, 56℃ for 30 seconds, 70-72℃ for 10 seconds, 50 cycles; 10℃ for 1 minute, 1 cycle.