Rapid detection primer group for larvae and insect body fragments of bark beetles and application of rapid detection primer group
By designing LAMP primers specific for winged wings and using LAMP technology for rapid detection, the problem of winged wings and wings is solved, and the rapid detection effect with high sensitivity and specificity is achieved.
Patent Information
- Application Number
- CN202510569136.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to quickly and accurately identify larvae, especially larvae and insect body fragments, and is greatly affected by environmental factors and genetic mutations, and there are limitations in morphological identification and molecular barcode technology.
High sensitivity and specificity of LAMP primers for LAMP are designed, and LAMP technology is used for rapid detection, and the COI gene fragment of LAMP is specifically identified to achieve exponential amplification.
It realizes rapid and accurate detection in ports and field places, with high sensitivity and high specificity, and is suitable for detection under non-laboratory conditions.
Smart Images
Figure CN120442806A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a primer set for rapid detection of bark beetle larvae and insect body fragments and an application thereof. Background Art
[0002] The dark-winged footspur beetle (Xylosandrus crassiusculus (Motschulsky)) belongs to the family Xylosandidae, subfamily Xylosandrinae, order Coleoptera. Its morphological characteristics include: adults are approximately 2.7-3.5 mm long, with a black head and pronotum, brown elytra undersides, and five symmetrical black bands running longitudinally across the wings. Its body is less shiny and sparsely haired. It has a wide geographical distribution. It is a borer pest. Adults and larvae typically bore into tree trunks and branches, forming tunnels that damage plant tissues, affecting growth and development. In severe cases, they can cause tree death. It is a major pest of various plants, including mulberry trees. This fungivorous beetle's tunnels are located in the xylem, running vertically and horizontally through the wood. It coexists with fungi, feeding on the hyphae and spores of these fungi and other microorganisms.
[0003] Currently, the primary detection and identification method for the dark-winged footspur beetle is morphological identification, supplemented by molecular barcoding. However, morphological identification has the following drawbacks: 1. High requirements for the identifier: It requires extensive knowledge and experience in insect taxonomy, and familiarity with the morphological characteristics and variation of various insect species. Accurate identification of closely related species with similar morphology requires profound professional expertise and extensive practical experience, making it difficult for novices to accurately grasp the technique. 2. Reliance on complete specimens: Morphological identification typically requires complete insect specimens to observe the characteristics of each part. Incomplete specimens, such as those lacking key identifying features or damaged or deformed specimens, can compromise identification accuracy or even render identification impossible. 3. Difficulty distinguishing certain species: Many insect species are morphologically very similar, especially closely related species or infraspecific groups, making accurate distinction based solely on morphological characteristics difficult. 4. Inability to identify juveniles: Insect larvae (such as larvae and pupae) differ significantly from adults, and larvae of different instars also vary in morphology. Identifying juveniles based solely on morphological characteristics is often difficult, and may even be impossible to accurately identify to the species. 5. Significantly affected by the environment: The morphological characteristics of insects may change due to environmental factors. For example, differences in environmental conditions such as temperature, humidity, and light may cause individual insects to differ in size, color, and markings, thereby interfering with identification results. Molecular barcoding technology, however, has the following shortcomings: 1. Variation leading to amplification failure: Even for the same species, there may be certain variations in its gene sequence. When these variations occur at the primer binding site, the primer will not be able to effectively bind to the template DNA, causing amplification failure and affecting identification results. 2. Intraspecific variation: Some insect species have large genetic variations within them, and their molecular barcode sequences may overlap with other species of the same genus, making it difficult to accurately distinguish them. Summary of the Invention
[0004] To address the above technical challenges, the present invention provides LAMP primers specific for the dark-winged footspur beetle, which boast high sensitivity, specificity, and accuracy, and are simple to use and require minimal time. LAMP technology is also used to enable rapid detection of the dark-winged footspur beetle in non-laboratory locations such as ports and the wild. Based on this, the following technical solution is proposed.
[0005] First, the present invention provides LAMP primers specific for the dark-winged foot beetle, the nucleotide sequences of which are shown in SEQ ID No. 1 to SEQ ID No. 5.
[0006] XCr-F3-3: (SEQ ID No. 1) TGATATAGCATTCCCACGATT XCr-B3-3: (SEQ ID No. 2) AAATTAATTGCGCCGAGAA XCr-FIP-3: (SEQ ID No.3)CCGTTCCTGCTCCTTTATCAATAAATATAAGATTTTGACTTCTTCCACC XCr-BIP-3: (SEQ ID No.4)CGCCTCTAGCAGCTAATATTGCATGATGAAACTCCTGATATGTGTA XCr-LB-3: (SEQ ID No. 5) CATGAAGGTGCCTCAGTAGACT The above primers are designed with the COI gene fragment of the dark-winged foot beetle (shown in SEQ ID No. 6) as the target gene, and the LAMP detection primers obtained through screening have good specificity and good detection effect of actual samples, with a sensitivity of 1 copies / μL.
[0007] Furthermore, the present invention provides the use of the aforementioned LAMP primers specific for the dark-winged beetle in preparing a kit.
[0008] Furthermore, the present invention provides a kit for detecting the dark-winged footspur beetle, which contains the dark-winged footspur beetle-specific LAMP primers.
[0009] Preferably, the final concentration ratio of the nucleotide sequences shown in SEQ ID No. 1 to SEQ ID No. 5 is 1:1: (7.5-8.5): (7.5-8.5): (3.5-4.5).
[0010] Preferably, the kit comprises the following components: the dark-winged foot beetle-specific LAMP primer according to claim 1, DNA polymerase, nucleic acid fluorescent dye, dNTPs and Mg + .
[0011] Preferably, the kit further comprises a positive plasmid control.
[0012] Furthermore, the present invention provides the use of the kit in detecting the dark-winged foot beetle.
[0013] The detection principle of the kit of the present invention is: Primer design: Five specific primers are used to specifically recognize multiple different regions on the target gene, ensuring amplification specificity.
[0014] Strand displacement reaction: At the start of the reaction, the template DNA is denatured and melted by heating. The F3 primer first binds to the F3c region of the template DNA. Under the action of a DNA polymerase with strand displacement activity, DNA synthesis begins at the 3' end of the F3 primer and extends to the binding region of the FIP primer, synthesizing a new DNA strand and simultaneously displacing the original complementary strand. On the displaced single-stranded DNA, the F1c region of the FIP primer binds to the F1 region of the template, and the B1c region of the BIP primer binds to the B1 region of the template. DNA synthesis then proceeds from these two binding sites under the action of DNA polymerase, forming a dumbbell-shaped single-stranded DNA structure.
[0015] Cyclic amplification: The dumbbell-shaped single-stranded DNA serves as a template for subsequent reactions. The F3 primer binds again to the F3c region on the template, triggering a new round of strand displacement synthesis and producing more dumbbell-shaped DNA. Simultaneously, the loop primer LB binds to the corresponding loop region on the dumbbell-shaped single-stranded DNA, initiating rapid DNA synthesis and further accelerating the amplification reaction. This cycle repeats, achieving exponential amplification of the target gene.
[0016] In the specific implementation process, DNA polymerase, nucleic acid fluorescent dye, dNTPs and Mg + It can be included in commercially available fluorescent isothermal amplification master mix (such as the fluorescent isothermal amplification master mix of Ningbo AiGene Technology Co., Ltd.).
[0017] Furthermore, the present invention provides a method for detecting the dark-winged footspur beetle, comprising: using the DNA of the sample to be tested as a template, and performing LAMP amplification using the dark-winged footspur beetle-specific LAMP primers shown in SEQ ID No. 1 to SEQ ID No. 5.
[0018] Preferably, the reaction temperature of LAMP amplification is 62° C. to 65° C.; and / or, LAMP amplification is performed for 25 to 35 cycles.
[0019] Preferably, signal collection is performed every 1 min during the LAMP amplification process.
[0020] Preferably, if there is no Ct value, the test result is determined to be negative, and if there is a Ct value, the test result is determined to be positive, and the smaller the Ct value and the larger the peak value, the better the test effect or the higher the DNA concentration.
[0021] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses the COI gene fragment of the dark-winged footspur beetle as the target gene for LAMP detection to design LAMP detection primers. The LAMP primers have strong specificity and high sensitivity. Based on this, the present invention provides a method for detecting the dark-winged footspur beetle. Using LAMP technology, the method enables rapid and accurate detection of the dark-winged footspur beetle in non-laboratory locations such as ports and the wild. The detection method of the present invention has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is the test result of primer screening.
[0023] Figure 2 This is the test result of optimizing the final primer concentration ratio.
[0024] Figure 3 It is the sensitivity test result.
[0025] Figure 4 It is a specific test result.
[0026] Figure 5 It is the test result of repeated verification of actual samples. DETAILED DESCRIPTION
[0027] To further clarify the objectives, technical solutions, and advantages of the present invention, the technical solutions of the present invention are described below in a clear and complete manner. Obviously, the embodiments described are only some of the embodiments of the present invention, and are not exhaustive. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without inventive effort are within the scope of protection of the present invention. In the examples provided herein, where specific techniques or conditions are not specified, the experiments were performed in accordance with those described in literature in the field or in accordance with the product specifications. Reagents or instruments used, where the manufacturer is not specified, are conventional products available through reputable distributors. The present invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book Molecular Cloning (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used reference books for those skilled in the art when conducting molecular biology experiments. Furthermore, depending on the purpose of the experiment, those skilled in the art can perform the corresponding experiments under the guidance of the operating manuals provided with various commercial kits or commission specialized companies to perform the experiments, such as gene sequencing, plasmid sequencing, and molecular weight determination.
[0028] The positive plasmid in the following example was constructed as follows: the COI gene fragment of the dark-winged beetle (shown in SEQ ID No. 6) was inserted into the multiple cloning site (MCS) of the pMV plasmid, and sterile water was added to prepare a solution for use.
[0029] The COI gene fragment of P. dusky-winged beetle (SEQ ID No.6): TGGAAATTGATTGGTACCACTAATATTAGGAGCCCCTGATATAGCATTCCCACGATTAAATAATATAAGATTTTGACTTCTTCCACCTAGATTAACTCTACTATTAATAAGAAGAATTATTGATAAAGGAGCAGGAACAGGA TGAACAGTTTATCCGCCTCTAGCAGCTAATATTGCACATGAAGGTGCCTCAGTAGACTTAGCAATCTTTAGATTACACATATCAGGAGTTTCATCAATTCTCGGCCAATTAATTTTATCTCAACAATTATTAATATGCATCCCTCAG Example 1 This embodiment provides a method for detecting the dark-winged foot beetle, and the steps are as follows: 1. Design five sets of LAMP primers specific for the dark-winged foot beetle as shown in Table 1: Table 1 LAMP primers specific for Pseudomonas aeruginosa
[0030] 2. Testing steps: (1) Template DNA extraction: A 0.1-0.5 mg sample of worms was placed in a 1.5 ml sterile centrifuge tube and ground using a disposable tissue grinder (LifeScience, Cat. No. MGR115-SQ). DNA was extracted according to the instructions of the US Everbright Genomic DNA Miniprep Kit (Suzhou Uni-Land Biotechnology Co., Ltd., Cat. No. UE-MN-MS-GDNA-50). The extracted DNA was analyzed for concentration using an ultra-micro spectrophotometer and stored at -20°C until needed.
[0031] (2) LAMP amplification: The fluorescent isothermal amplification premix (including DNA polymerase, nucleic acid fluorescent dye, dNTPs, Mg + A PCR amplification assay (e.g., Ningbo AiGene Technology Co., Ltd.) was mixed with each of the five primers in each group. 10 μL was mixed with 15 μL of template DNA and centrifuged briefly. The aliquots were then dispensed into PCR tubes, 5 μL per tube, and centrifuged briefly before analysis. A positive plasmid was used instead of template DNA as a positive control. An isothermal amplification detector (MA2000E, Ningbo AiGene Technology Co., Ltd.) was set to 63.5°C, with signal acquisition taking place every 1 minute. The reporter group was FAM.
[0032] (3) Result determination: The baseline period is set to start from the first cycle and end at the second cycle. If the machine detects no Ct value within 30 cycles, the test result is judged to be negative. If a Ct value appears, the test result is judged to be positive. The smaller the Ct value and the larger the peak value, the better the detection effect or the higher the DNA concentration.
[0033] 3. Primer screening results: Screening was performed according to the final primer concentration ratio of F3:B3:FIP:BIP:LB = 1:1:8:8:4. Each primer group was screened using the same nucleic acid sample, with 4 replicates. Under the premise that no peaks were observed in negative samples, the primer group with the earliest peak and good repeatability was determined, and this was selected as the optimal primer for subsequent experiments. The primer screening results are shown in Figure 2. Figure 1 As shown in the figure, primer set 3 had the lowest Ct value and the best detection effect, and this primer set was subsequently used for sensitivity and specificity tests.
[0034] 4. Optimization of primer final concentration ratio: Primer set 3 was used, and different final primer concentration ratios were set (as shown in Table 2). The final primer concentration ratios were screened using the same nucleic acid sample, and the ratio with the earliest peak and good repeatability was selected. The results were repeated 8 times.
[0035] Table 2 Primer final concentration ratio
[0036] The results of the primer final concentration ratio optimization test are as follows Figure 2 As shown in the figure, the primer final concentration ratio of group 3 had the best detection effect, and this primer final concentration ratio was used in subsequent sensitivity and specificity tests.
[0037] Example 2 Sensitivity Test The positive plasmid was diluted 10-fold in a gradient, from 10 6 copies / μL up to 10 0 copies / μL (corresponding to Groups 1 to 7, respectively), with four replicates, using the detection method of Example 1 to determine the lowest detectable concentration. Concentrations near the detection limit were repeatedly tested (16 replicates), and the lowest concentration at which a stable peak was observed was taken as the detection sensitivity.
[0038] Test results such as Figure 3 and as shown in Table 3.
[0039] Table 3 Sensitivity test results
[0040] The results showed that the sensitivity of the detection method in Example 1 was 1 copies / μL.
[0041] Example 3 Specificity Test Specificity testing was conducted using the detection method of Example 1 using the dark-winged foot beetle and its related species. The samples are shown in Table 4, with two replicates for each treatment. The biological materials listed in the table are available to the public from the applicant for use solely for replicating the experiments described herein and are not to be used for any other purpose.
[0042] Table 4 Specificity test samples
[0043] Test results such as Figure 4 As shown, the results showed that except for the dark-winged foot beetle, other closely related species were negative, indicating that the specificity of the detection method in Example 1 was good.
[0044] Example 4 Repeated verification of multiple samples of dark-winged foot beetles The detection method of Example 1 was used to detect 6 different samples of the dark-winged foot beetle, and a blank control group and a positive control group were set up. The blank control group used sterile water as an amplification template, and the positive control group used a positive plasmid as a template.
[0045] Test results such as Figure 5 As shown, 6 different dark-winged footspur beetles (actual samples) were all positive, the positive control group was positive, and the blank control group (negative sample) was negative.
[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. A LAMP primer specific for the dark-winged foot beetle, characterized in that: The nucleotide sequences are shown in SEQ ID No. 1 to SEQ ID No.
5.
2. Use of the LAMP primers specific for the dark-winged foot beetle according to claim 1 in preparing a kit.
3. A kit for detecting the dark-winged foot beetle, characterized in that: Contains the dark-winged foot beetle-specific LAMP primer according to claim 1.
4. The kit according to claim 3, wherein The final concentration ratio of the nucleotide sequences shown in SEQ ID No. 1 to SEQ ID No. 5 is 1:1: (7.5-8.5): (7.5-8.5): (3.5-4.5).
5. The kit according to claim 3, characterized in that The kit comprises the following components: the dark-winged foot beetle-specific LAMP primer according to claim 1, DNA polymerase, nucleic acid fluorescent dye, dNTPs and Mg + .
6. Use of the kit according to any one of claims 3 to 5 in detecting the dark-winged foot beetle.
7. A method for detecting the dark-winged foot beetle, characterized in that: include: LAMP amplification was performed using the DNA of the sample to be tested as a template using the LAMP primers specific for the dark-winged beetle shown in SEQ ID No. 1 to SEQ ID No.
5.
8. The detection method according to claim 7, characterized in that The reaction temperature of LAMP amplification is 62° C. to 65° C.; and / or, LAMP amplification is performed for 25 to 35 cycles.
9. The detection method according to claim 7, characterized in that During the LAMP amplification process, the signal was collected every 1 min.
10. The detection method according to any one of claims 7 to 9, characterized in that If there is no Ct value, the test result is judged to be negative. If there is a Ct value, the test result is judged to be positive. The smaller the Ct value and the larger the peak value, the better the test effect or the higher the DNA concentration.