IGFBP-2 gene promoter region SNP (Single Nucleotide Polymorphism) molecular marker related to laying number of chicken and application thereof

Abstract

The invention discloses an IGFBP-2 (insulin-like growth factor binding protein 2) gene promoter region SNP (single nucleotide polymorphism) molecular marker related to laying number of chicken and application of the molecular marker, and belongs to the technical field of molecular genetics. According to the invention, a key promoter region of the IGFBP-2 gene is identified by researching the promoter region of the IGFBP-2 gene; two SNP loci significantly related to the laying number of chickens are screened from a key promoter region of the IGFBP-2 gene, and the two molecular markers related to the laying character are detected, so that the method is simple, convenient and rapid, breeding of high-yield laying hen varieties is facilitated, and beneficial help is provided for breeding work.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to an IGFBP-2 gene promoter region SNP molecular marker associated with the egg production of chickens and an application thereof. Background Art

[0002] Egg production is a key indicator of individual poultry production performance and economic profitability. Improving individual egg production can increase the revenue of poultry farming operations. Follicular growth and development significantly influence egg production in poultry. Research has shown that the growth and development of follicles, from formation to maturation to ovulation, is regulated by a molecular network of genes. Exploring the genetic polymorphisms associated with egg production in chickens can provide new insights into breeding high-yielding hens.

[0003] IGFBP-2 is a member of the IGF-binding protein family. Its typical function in the IGF system is to inhibit IGFs by binding to them and preventing them from binding to their receptors. During the growth and development of chickens, some studies have reported that dietary manipulation can regulate IGFBP-2 expression levels, thereby affecting the function of IGF1. Other studies have reported that IGFBP-2 polymorphisms are significantly associated with traits related to growth, body composition, and abdominal fat deposition. In the ovary, only descriptive studies have shown that IGF1 inhibits IGFBP-2 expression in chicken primordial follicles, and it has been speculated that IGFBP-2 may be involved in regulating the function of IGF1 in the chicken ovary (Ahmadi and Ohkubo, 2022), but this has not been further explored. The potential function of IGFBP-2 in chicken follicle development and selection remains unknown.

[0004] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, leading to genetic differences between individuals. SNPs can cause amino acid changes, affecting gene function, or they can affect promoter activity, impacting gene expression. SNPs, a common form of genetic variation, are ubiquitous in biological genomes, accounting for approximately 90% of all known variation. The total number of SNPs in the human genome is approximately 3 million (Rocha et al., 2006); the variation rate in chickens is 6–7 times that of humans. Despite the large number and widespread distribution of SNPs, the proportion of SNPs significantly associated with biological traits is relatively small, making it challenging to identify molecular markers with practical applications from this vast pool of SNPs. Currently, there are no reports linking SNP markers in the promoter region of the chicken IGFBP-2 gene with egg production. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a SNP molecular marker in the promoter region of the IGFBP-2 gene related to the number of chicken eggs and its application.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides the use of the IGFBP-2 gene in at least one of the following (1)-(3):

[0008] (1) preparing a product for promoting the proliferation of chicken follicle granulosa cells;

[0009] (2) preparing a product for inhibiting apoptosis of chicken follicle granulosa cells;

[0010] (3) Prepare a product for regulating the level of progesterone secretion in chicken follicle granulosa cells.

[0011] In a second aspect of the present invention, a SNP molecular marker in the promoter region of the IGFBP-2 gene is provided, which is associated with the number of eggs produced in chickens. The nucleotide sequence of the SNP molecular marker in the promoter region of the IGFBP-2 gene is shown in SEQ ID No. 1, and comprises a SNP1 site and a SNP2 site.

[0012] The 355th base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP1 site, whose base is C or T; the 437th base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP2 site, whose base is C or T.

[0013] The details are as follows:

[0014] CACAATGGCGTTGCACCAAATGCCTGGCAAAGAACCGGGCTGAAACCCTCCCCTAGGGGAACGACCCCCATCGGCCACCTAAAAAATGCTTTACAATGAGGTTCAGGCTGCCCCTTGTGCTTACAAAGGGAGAAAGGCAGATGTCAGCCCGTGTACCGAGAGTGTGAGGGCATGGCGCTCACCACGGGGAGAAAACCAACGT TGGATGCTTGGAATATTTAACCGCCTGCAACAGATAATTAGCCAAACCCTCTTACGCCTCCAAATATAGCTTCATTAGTCATATGAAAATATCTCATTGGAACCAAATGTGAGTCATTAGTGAAGTCAACAGCAGATCATAAAAAAAGGTAC[C / T]GAGAGCCTTGAGAAATCGTGAGCG TGCGGTGAGAATAACTCAGCGCGTTGTGCACGGAACATCTGCTCACAGGGGCTGCCG[C / T]GTCC CCATTCCTGCCATGGGATGTGCAGCAGGAACAAACACAGAGCGTGCACTGGGCTTCTGCTGCTT CTTTTTTGTCAGCCTCTAAAAAGGAGAGGGACTCTGATGGGTGAAACCCTTGTAAGAATGGAGT TATTCTTTGGGGAAATGTGGGG AGCGGGGTGGGAAGGTGTGCTTAG .

[0015] Note: "[C / T]" in the sequence is a SNP site, which is represented by "n" in the sequence table.

[0016] The present invention detected two SNP sites in the promoter region of the chicken IGFBP-2 gene that are significantly associated with the number of chicken eggs, among which:

[0017] The physical position of the SNP1 site is 7_23308855; the physical position of the SNP2 site is 7_23308773.

[0018] The reference genome for the above physical location is GRCg6a; GenBank accession: GCA_000002315.5.

[0019] The genotypes of these two SNPs were associated with the total egg production at 43 weeks of age (E43) and could be used for the breeding of high-yielding laying hens.

[0020] The third aspect of the present invention provides the use of the above-mentioned SNP molecular marker in the promoter region of the IGFBP-2 gene in the breeding of high-yielding laying hens.

[0021] In the above application, the high-yielding laying hen has an egg-laying trait of producing a large number of eggs at 43 weeks of age.

[0022] In the above application, individuals with CT genotype at 7_23308855 (SNP1) and TT or CT genotype at 7_23308773 (SNP2) correspond to an egg-laying trait of more total eggs at 43 weeks of age.

[0023] A fourth aspect of the present invention provides the use of a primer pair for detecting SNP molecular markers in the promoter region of the IGFBP-2 gene in assisting the selection of laying hen breeds with a high total egg production;

[0024] The nucleotide sequences of the primer pairs are shown in SEQ ID No. 2 and SEQ ID No. 3; specifically, they are as follows:

[0025] F: CACAATGGCGTTGCACCAAATG; (SEQ ID No. 2)

[0026] R: AGCGGGGTGGGAAGGTGTGCTTAG. (SEQ ID No.3)

[0027] A fifth aspect of the present invention provides a method for identifying egg-laying traits of laying hens, comprising the following steps:

[0028] The genomic DNA of the laying hen to be tested is used as a template, and the primers shown in SEQ ID No. 2 and SEQ ID No. 3 are used to perform PCR amplification to obtain an amplified product; the amplified product is sequenced, and the egg-laying traits of the laying hen are identified based on the sequencing results.

[0029] Specifically, if the sequencing result of the amplified product corresponds to the sequence shown in SEQ ID No. 1, the 355th base from the 5' end is the CT genotype, and the 437th base is the TT or CT genotype, then it is identified as having the egg-laying trait of a large total number of eggs at 43 weeks of age.

[0030] The sixth aspect of the present invention provides the use of the above-mentioned SNP molecular marker in the promoter region of the IGFBP-2 gene in regulating the transcriptional activity of the promoter region of the IGFBP-2 gene.

[0031] Beneficial effects of the present invention:

[0032] (1) The present invention found that the IGFBP-2 gene has a regulatory function in chicken granulosa cells, can promote the proliferation of chicken granulosa cells, inhibit the apoptosis of chicken granulosa cells, and regulate the progesterone secretion level in chicken granulosa cells.

[0033] (2) The present invention studies the promoter region of the IGFBP-2 gene and identifies the key promoter region of the IGFBP-2 gene; then, two SNP sites significantly correlated with the number of eggs laid by chickens are screened in the key promoter region of the IGFBP-2 gene. By detecting these two molecular markers associated with egg-laying traits, the method is not only simple and quick, but also helps to breed high-yield laying chicken varieties, providing favorable assistance for breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 :IGFBP-2 gene expression levels after transfection of siRNA (A) and overexpression plasmid (B) * P<0.05, *** P<0.001, n=3).

[0035] Figure 2 :Effect of IGFBP-2 on the proliferation of Pre-GCs ( * P<0.05, ** P<0.01, *** P<0.001); in the figure, (A, B) EdU staining images and positive cell statistics after interference with IGFBP-2, n=3; (C) CCK-8 assay for cell viability after interference with IGFBP-2, n=5; (D, E) EdU staining images and positive cell statistics after overexpression of IGFBP-2, n=3; (F) CCK-8 assay for cell viability after overexpression of IGFBP-2, n=5; scale bar: 100 μm.

[0036] Figure 3 :Effect of IGFBP-2 on apoptosis of Pre-GCs ( ** P<0.01, n=3); in the figure, (A, B, C) changes in cell apoptosis after interference with IGFBP-2; (D, E, F) changes in cell apoptosis after overexpression of IGFBP-2.

[0037] Figure 4 :Effect of IGFBP-2 on progesterone synthesis in granulosa cells of ovarian follicles * P<0.05, ** P<0.01, ***P<0.001, n=3); in the figure, (A, B) expression levels of progesterone synthesis-related genes after interfering with IGFBP-2; (C, D) expression levels of progesterone synthesis-related genes after overexpressing IGFBP-2; (E, F) progesterone levels after interfering with or overexpressing IGFBP-2 in Post-GCs.

[0038] Figure 5 : Results of PCR amplification of the IGFBP-2 gene promoter region.

[0039] Figure 6 : Comparison analysis of the recombinant vector of IGFBP-2 gene promoter region and its NCBI sequence.

[0040] Figure 7 : Double enzyme digestion verification of IGFBP-2 gene promoter region deletion vector.

[0041] Figure 8 : Luciferase activities of promoter fragments of different lengths of IGFBP-2 gene (n=4), different lowercase letters indicate significant differences (P<0.05).

[0042] Figure 9 : Polymorphism of the key promoter region of IGFBP-2 gene in different chicken breeds.

[0043] Figure 10 : Effect of SNP site mutation on IGFBP-2 promoter activity (**P<0.05, ***P<0.001, n=4). DETAILED DESCRIPTION

[0044] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0045] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0046] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out in accordance with conventional test methods or the operating instructions recommended by the supplier.

[0047] Hailan brown laying hens come from the Linxi Village Farm in Fan Town, Tai'an City; Langya chickens come from Shandong Jihua Poultry Breeding Co., Ltd.; Zaozhuang Sunzhi chickens come from the Zaozhuang Sunzhi Chicken Breeding Base (Zhonghui Agriculture); Jining 100-day chickens come from the Jining Datang 100-day chicken breeding farm.

[0048] Example 1: Effect of IGFBP-2 gene on chicken follicle granulosa cell function

[0049] 1. Construction and efficacy testing of IGFBP-2 gene overexpression vector and siRNA:

[0050] (1) Overexpression vector construction:

[0051] The overexpression vector was constructed using the commercial pcDNA3.1(+) vector. The IGFBP-2 mRNA sequence expressed in chicken granulosa cells, obtained by RACE, was uploaded to NCBI (accession number PQ153874). The coding sequence was predicted using the ORF Finder tool on the website. The longest ORF was 702 bp. Primers were then designed at both ends of the sequence using SnapGene, with restriction sites and protective bases added. The upstream primer sequence was 5′-CCCAAGCTTGGGGCCACCATGGGGGCCGAGGCGTGCGGCG-3′, with a HindIII restriction site; the downstream primer sequence was 5′-GGAATTCCCTACTGGCTCCGCAGGGCGTGT-3′, with an EcoRI restriction site. The entire ORF was then amplified by PCR. The PCR product was then digested with the pcDNA3.1(+) vector plasmid and ligated with the digested PCR product. Sequencing analysis revealed the construction of a corrected IGFBP-2 gene overexpression vector.

[0052] (2) siRNA synthesis:

[0053] siRNAs were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. siRNAs were designed based on existing sequences and sequences provided by NCBI. The sequences are shown in Table 1.

[0054] Table 1: siRNA sequences

[0055]

[0056] (3) Effect test:

[0057] siRNA, overexpression plasmid and blank control were transfected into chicken granulosa cells, and the expression level of IGFBP-2 mRNA was detected by fluorescence quantitative PCR.

[0058] The results are as follows Figure 1 As shown, all three siRNAs significantly decreased the expression level of IGFBP-2 ( Figure 1 A), the interference effect reached 70%-80%. After the overexpression plasmid was transferred into follicular granulosa cells, the expression level of IGFBP-2 was also significantly increased ( Figure 1 B) The results show that both overexpression plasmids and siRNA can be used in subsequent experiments.

[0059] 2. Effect of IGFBP-2 gene on the proliferation of chicken follicular granulosa cells:

[0060] The overexpression vector or siRNA was transferred into pre-GCs, and the changes in GC proliferation were detected by EdU staining and CCK-8.

[0061] The results are as follows Figure 2 As shown in Figure 2, after interfering with IGFBP-2 in Pre-GCs, the number of EdU-positive cells was significantly reduced ( Figure 2 A), the positive ratio decreased significantly ( Figure 2 B), cell proliferation was significantly inhibited. CCK-8 results showed that after interfering with IGFBP-2, the cell proliferation activity was significantly lower than that of the control group ( Figure 2 C). Overexpression of IGFBP-2 in Pre-GCs significantly promoted cell proliferation ( Figure 2 D, E, F).

[0062] 3. Effect of IGFBP-2 gene on apoptosis of chicken follicular granulosa cells:

[0063] After IGFBP-2 was interfered or overexpressed in granulosa cells, the changes of cell apoptosis were detected by flow cytometry. Figure 3 As shown in Figure 3, interference with IGFBP-2 in Pre-GCs significantly promoted cell apoptosis ( Figure 3 A, B, C); overexpression of IGFBP-2 significantly inhibited cell apoptosis ( Figure 3 D, E, F).

[0064] 4. Effect of IGFBP-2 gene on progesterone synthesis in chicken granulosa cells:

[0065] After the chicken follicle enters the hierarchical stage, granulosa cells begin to differentiate and produce progesterone. Therefore, we investigated the role of IGFBP-2 in regulating progesterone synthesis in granulosa cells. After overexpressing and knocking down IGFBP-2 in granulosa cells, we examined changes in the expression of genes involved in progesterone synthesis by qRT-PCR, and measured progesterone secretion in granulosa cells of post-hierarchical follicles (post-GCs) by ELISA.

[0066] The results are as follows Figure 4 As shown in Figure 2, in Pre-GCs, interference with IGFBP-2 significantly reduced the mRNA expression levels of StAR and HSD3B, and significantly increased the expression level of CYP11A1 (NM_001001756) ( Figure 4 A); Overexpression of IGFBP-2 significantly increased the mRNA expression level of HSD3B (NM_205118) ( Figure 4 C). In post-GCs, interference with IGFBP-2 significantly increased the mRNA expression level of HSD3B ( Figure 4 B), overexpression of IGFBP-2 significantly reduced the mRNA expression levels of StAR and HSD3B ( Figure 4 D). ELISA results showed that interfering with IGFBP-2 significantly increased the level of progesterone secretion ( Figure 4 E), while overexpression of IGFBP-2 significantly inhibited the secretion of progesterone ( Figure 4 F).

[0067] Example 2: Identification of SNP markers in the chicken IGFBP-2 gene promoter region

[0068] 1. Construction of full-length vector of IGFBP-2 gene promoter region:

[0069] Primers were designed within the first 3,000 bp of the IGFBP2-T8 transcript. Using the mixed genomic DNA of 35 Jining 100-day-old chickens as a template, a high-fidelity DNA polymerase was used to amplify the IGFBP-2 gene promoter region, resulting in a 2,919 bp fragment ( Figure 5 ).

[0070] The fragment was then inserted into the pGL3-Basic vector and sent to the company for sequencing. The sequencing results were compared with the IGFBP-2 promoter region sequence in the NCBI database (NC_052538.1). Figure 6 As shown in Figure 2, the sequence similarity reached 99.31%, proving that the full-length recombinant vector of the IGFBP-2 promoter region has been successfully constructed. The vector was named pGL3-IGFBP2-F1

[0071] 2. Construction of IGFBP-2 gene promoter region deletion vector:

[0072] Based on the full-length recombinant vector of the IGFBP-2 promoter region, upstream primers were designed for each 600-bp reduction, while the downstream primers remained unchanged, to construct promoter deletion vectors of different fragment lengths. The primers used to construct the IGFBP-2 gene promoter region deletion vectors are shown in Table 2.

[0073] Table 2: Primers for constructing promoter region deletion vector

[0074]

[0075]

[0076] The constructed promoter deletion vectors were named pGL3-IGFBP2-F2, -F3, -F4, and -F5. The results were verified by double enzyme digestion. Figure 7 As shown in the figure, the fragment length is consistent with the expected result. The recombinant plasmid was sent to the company for sequencing, and the fragment similarity after sequence comparison was greater than 99%.

[0077] 3. Dual luciferase activity analysis of IGFBP-2 gene promoter region deletion vector:

[0078] The recombinant plasmids of different lengths were transfected into Post-GCs, and the dual luciferase activity was detected 24 hours later. Figure 8 When the promoter region -1088 bp was deleted, the fluorescence activity decreased significantly, indicating that the -1679 bp to -1088 bp segment is the key segment of the IGFBP-2 gene promoter, with a total length of 591 bp.

[0079] 4. Identification of SNPs in the key region of the IGFBP-2 gene promoter:

[0080] Using whole-genome sequencing data, we screened for single-nucleotide polymorphisms (SNPs) within the key promoter region of the IGFBP-2 gene. We selected one high-yielding laying hen breed, the Hailan Brown, and three low-yielding local laying hen breeds: the Langya, Jining, and Zaozhuang Sunzhi. Genomic DNA from the blood of at least 20 chickens of each breed was used as a template for PCR amplification of the key promoter region containing the SNP. Each sample was amplified independently. After gel electrophoresis revealed the correct band, the gel block was excised and sent to our company for sequencing. Finally, the genotype of the SNP in each sample was analyzed using DNAMAN and Chromas software.

[0081] result Figure 9 As shown, two SNP sites were screened, both of which exist in different chicken breeds. The physical position of the SNP1 site is 7_23308855, and its nucleotide polymorphism is C / T; the physical position of the SNP2 site is 7_23308773, and its nucleotide polymorphism is C / T.

[0082] Example 3: Association analysis between SNP sites in the key promoter region of the IGFBP-2 gene and egg-laying traits of Langya chickens

[0083] A total of 1,183 Langya chickens with production records were selected. 1-2 mL of blood was collected from the wing vein in an anticoagulant blood collection tube. Association analysis was performed on the relationship between the two SNPs identified in Example 2 and egg production traits. The details are as follows:

[0084] Genotypes at loci 7_23308855 and 7_23308773 were determined in a Langya chicken population through genome sequencing and analyzed for association with egg production traits, including age at first lay (AFE), egg weight at first lay (EW), body weight at first lay (BW), total eggs at 43 weeks of age (E43), and maximum consecutive days of laying (LCS). The results are shown in Table 3.

[0085] Table 3: Association analysis between SNP sites in the key promoter region of IGFBP-2 gene and egg production traits of Langya chicken

[0086]

[0087] Note: AFE: Age at first laying, BW: Body weight at first laying, EW: Egg weight at first laying, E43: Total number of eggs laid at 43 weeks of age, LCS: Longest consecutive days of laying. When P < 0.05, the association between each genotype and egg production traits was significantly different, otherwise it was not significant.

[0088] The results showed that both loci 7_23308855 and 7_23308773 were significantly associated with the total number of eggs produced at 43 weeks of age, among which the CT genotype of locus 7_23308855 corresponded to more egg production; the TT and CT genotypes of locus 7_23308773 corresponded to more egg production.

[0089] Example 4: Effect of SNP sites in the key promoter region of the IGFBP-2 gene on the transcriptional activity of the promoter region

[0090] 1. Test method:

[0091] By the result of embodiment 3 association analysis, 7_23308855 and 7_23308773 two sites are selected to carry out site-directed mutagenesis.With promoter full-length vector F1 as template, the front 25bp of selection site and rear 25bp and mutation site composition mutation primer (table 4), then carry out pcr amplification, pcr amplification product is complete mutation vector, can be directly used for conversion after glue recovery.By the site-directed mutagenesis vector transfection Post-GCs of 7_23308855 and 7_23308773 two sites of structure, detect dual luciferase activity after 24h.

[0092] Table 4: Site-directed mutagenesis primers

[0093]

[0094]

[0095] 2. Test results:

[0096] The results are as follows Figure 10As shown, the promoter activity decreased significantly after the 7_23308773 site and the 7_23308855 site were mutated from C to T.

[0097] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Use of the IGFBP-2 gene in at least one of the following (1)-(3): (1) preparing a product for promoting the proliferation of chicken follicle granulosa cells; (2) preparing a product for inhibiting apoptosis of chicken follicle granulosa cells; (3) Prepare a product for regulating the level of progesterone secretion in chicken follicle granulosa cells.

2. A SNP molecular marker in the promoter region of the IGFBP-2 gene associated with egg production in chickens, characterized in that: The nucleotide sequence of the SNP molecular marker in the promoter region of the IGFBP-2 gene is shown in SEQ ID No. 1, which includes SNP1 site and SNP2 site; The 355th base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP1 site, whose base is C or T; the 437th base from the 5' end of the sequence shown in SEQ ID No. 1 is the SNP2 site, whose base is C or T.

3. Use of the SNP molecular marker in the promoter region of the IGFBP-2 gene according to claim 2 in breeding high-yielding laying hens.

4. The use according to claim 3, characterized in that The high-yield laying hen has an egg-laying trait of producing a large number of eggs at the age of 43 weeks.

5. The use according to claim 4, characterized in that Individuals with SNP1 site of the SNP molecular marker in the promoter region of the IGFBP-2 gene being the CT genotype and SNP2 site being the TT or CT genotype correspond to the egg-laying trait of having a large total number of eggs at 43 weeks of age.

6. Use of a primer pair for detecting the SNP molecular marker in the promoter region of the IGFBP-2 gene according to claim 2 in assisting in the selection of laying hens with a high total egg production.

7. The use according to claim 6, characterized in that The nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No.

3.

8. A method for identifying egg-laying traits of laying hens, characterized in that: The following steps are involved: The genomic DNA of the laying hen to be tested is used as a template, and PCR amplification is performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain an amplified product; the amplified product is sequenced, and the egg-laying traits of the laying hen are identified based on the sequencing results.

9. The method according to claim 8, characterized in that If the sequencing result of the amplified product corresponds to the sequence shown in SEQ ID No. 1, the 355th base from the 5' end is the CT genotype, and the 437th base is the TT or CT genotype, then it is identified as having the egg-laying trait of a large total number of eggs at 43 weeks of age.

10. Use of the IGFBP-2 gene promoter region SNP molecular marker according to claim 2 in regulating the transcriptional activity of the IGFBP-2 gene promoter region.

Images