Primer composition and kit for identifying universal type and vaccine strain of brucella

By designing specific primers and probes combined with multiple fluorescence PCR technology, rapid identification of Brucella universal, pig breed S2 vaccine strains and bovine A19 vaccine strains was achieved, solving the problem of insufficient detection time and specificity in the prior art, and improving detection efficiency and accuracy.

CN120442824APending Publication Date: 2025-08-08湖南省动物疫病预防控制中心 +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510612188.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately distribute the natural strong strain of Rucella, pig breed S2 vaccine strain and bovine A19 vaccine strain. The conventional pathogenic diagnosis takes time and poses safety risks. The specificity and sensitivity of molecular biological methods need to be improved.

Method used

Design specific primers and probes, combined with multiple fluorescence PCR technology, and achieve rapid identification of Brucella universal, pig breed S2 vaccine strains and bovine A19 vaccine strains through primer pairs and probes labeling fluorophores.

Benefits of technology

It realizes fast, simple and low-cost detection, improves detection efficiency, solves the limitations of single-fold reactions, and enhances the specificity and sensitivity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442824A_ABST
    Figure CN120442824A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of animal epidemic disease pathogen detection, and particularly relates to a primer composition and a kit for identifying a Brucella universal type and a vaccine strain, the primer composition comprises primer pairs and probes for identifying the Brucella universal type, a pig breed S2 vaccine strain and a cattle breed A19 vaccine strain; the primer pair for identifying the universal type of Brucella is shown as SEQ ID NO.1-2, and the probe is shown as SEQ ID NO.3; a primer pair for identifying the pig breed S2 vaccine strain is SEQ ID NO.4-5, and a probe is SEQ ID NO.6; the primer pair for identifying the bovine species A19 vaccine strain is SEQ ID NO.7-8, and the probe is SEQ ID NO.9; the specificity and the sensitivity are good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of animal disease pathogen detection, and particularly relates to a primer composition and a kit for identifying universal types and vaccine strains of Brucella. Background Art

[0002] Brucellosis is a major zoonosis caused by Brucella bacteria. It is listed as a notifiable disease by the World Organization for Animal Health (WOAH) and is a major animal disease that is prioritized for prevention and control in my country. Brucella can infect humans, a variety of domestic and wild animals, and cause similar clinical symptoms and pathological lesions, such as fever, miscarriage, infertility, chronic arthritis, and neurological damage. Internationally, Brucella is divided into 12 species based on biochemical identification and host preference. The most common species of Brucella infecting humans are those of sheep (B. melitensis), cattle (B. abortus), pigs (B. suis), and dogs (B. canis). If human infection with Brucella is not diagnosed and treated promptly, it can easily lead to various complications, such as spondylitis, endocarditis, and encephalitis.

[0003] In my country, the widely used Brucella vaccine strains are the porcine S2 and bovine A19 strains. Current vaccines and related detection methods make it difficult to distinguish between the porcine S2 and bovine A19 strains of Brucella and naturally virulent strains. This makes it impossible to determine whether a positive Brucella test in livestock is a natural infection or the result of vaccine immunization. Therefore, establishing a reliable method to distinguish between the porcine S2 and bovine A19 strains and naturally virulent strains is urgently needed.

[0004] While conventional etiological diagnosis is the gold standard for diagnosing brucellosis, it relies on isolating suspected bacterial colonies from host tissues, breast milk, or vaginal secretions, followed by bacteriological characterization. This process is accurate and reliable. However, this method has certain drawbacks. The process from clinical specimen collection to final identification is time-consuming and must be performed by highly skilled personnel in an authorized biosafety level 3 laboratory, posing potential risks. Currently established serological diagnostic methods include the red tiger plate agglutination test (RBPT), tube agglutination test (SAT), and enzyme-linked immunosorbent assay (ELISA). The RBPT offers high sensitivity, ease of use, low cost, and the absence of high-standard laboratory conditions and technical requirements, but is susceptible to subjective judgment. The ELISA, while highly sensitive and suitable for screening large numbers of samples, is also expensive and requires a complex experimental procedure. The SAT offers high accuracy and low cost, but the experimental procedure is cumbersome and results are susceptible to subjective judgment. None of these methods can quickly and accurately distinguish between naturally virulent Brucella strains, the porcine S2 vaccine strain, and the bovine A19 vaccine strain.

[0005] The development of molecular biology technology has provided a solution to this problem. Authorization announcement No. CN105018489B discloses a kit for identifying wild-type Brucella strains and vaccine strains A19 and S2. Authorization announcement No. CN117106940B discloses a primer set for identifying Brucella and its detection method and application. Its specificity and sensitivity need to be further improved. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a primer combination and a kit for identifying universal types and vaccine strains of Brucella, which have good specificity and sensitivity.

[0007] The embodiment of the present invention provides a primer composition for identifying universal Brucella and vaccine strains, including primer pairs and probes for identifying universal Brucella, pig species S2 vaccine strain, and bovine species A19 vaccine strain;

[0008] The primer pair for identifying universal Brucella is SEQ ID NO.1-2, and the probe is SEQ ID NO.3;

[0009] The primer pair for identifying the swine S2 vaccine strain is SEQ ID NO. 4-5, and the probe is SEQ ID NO. 6;

[0010] The primer pair for identifying the bovine A19 vaccine strain is SEQ ID NO. 7-8, and the probe is SEQ ID NO. 9.

[0011] Preferably, the 5' end of SEQ ID NO. 3 is labeled with a FAM reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

[0012] Preferably, the 5' end of SEQ ID NO. 6 is labeled with a HEX reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

[0013] Preferably, the 5' end of SEQ ID NO. 9 is labeled with a CY5 reporter fluorescent group, and the 3' end is labeled with a BHQ2 quencher fluorescent group.

[0014] Preferably, it further comprises an internal standard primer pair and an internal standard probe, and the internal standard primer pair and the internal standard probe are conventional sequences.

[0015] Preferably, the 5' end of the internal standard probe is labeled with a ROX reporter fluorescent group, and the 3' end is labeled with a BHQ2 quencher fluorescent group.

[0016] Preferably, it also includes a probe-based fluorescent quantitative PCR buffer and a hot-start Taq enzyme.

[0017] The embodiment of the present invention provides a kit for identifying universal types and vaccine strains of Brucella, comprising the primer combination.

[0018] The beneficial effect of the present invention is that the multiplex fluorescent PCR detection kit of the present invention can quickly identify and distinguish the porcine S2 vaccine strain, the bovine A19 vaccine strain and natural infection. It is simple to use and has a short detection time, which can greatly improve the detection efficiency. At the same time, it also saves detection costs and solves the limitations of single-reaction reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the results of primer and probe screening for the universal fluorescent PCR detection method for Brucella.

[0020] Figure 2 These are the specificity test results of the universal fluorescent PCR detection method for Brucella.

[0021] Figure 3 These are the results of primer and probe screening for the fluorescent PCR detection method of Brucella suis S2 vaccine strain.

[0022] Figure 4 These are the specificity test results of the fluorescent PCR detection method for Brucella suis S2 vaccine strain.

[0023] Figure 5 These are the results of primer and probe screening for the fluorescent PCR detection method of Brucella bovis A19 vaccine strain.

[0024] Figure 6 These are the specificity test results of the fluorescent PCR detection method for Brucella bovis A19 vaccine strain.

[0025] Figure 7 This is the result of triple detection of Brucella universal type, swine S2 vaccine strain and bovine A19 vaccine strain using fluorescent PCR detection in the FAM channel to detect Brucella swine S2 vaccine strain.

[0026] Figure 8 This is the result of triple detection of Brucella universal type, swine S2 vaccine strain and bovine A19 vaccine strain using fluorescent PCR detection in the FAM channel to detect Brucella bovine A19 vaccine strain. DETAILED DESCRIPTION

[0027] The present invention is further described below with reference to specific embodiments.

[0028] Example 1: Establishment of a universal fluorescent quantitative PCR detection method for Brucella

[0029] 1. Materials and Methods

[0030] 1.1 Materials

[0031] Material suspected of Brucella universal infection.

[0032] 1.2 Instruments

[0033] Instruments and reagents: Fluorescence quantitative PCR instrument, Shanghai Hongshi Medical Technology Co., Ltd.; desktop high-speed centrifuge, Sangon Biotechnology (Shanghai) Co., Ltd.; automatic nucleic acid extraction and purification instrument, Hunan Guoce Biotechnology Co., Ltd.; magnetic bead-based viral nucleic acid extraction kit, Hunan Guoce Biotechnology Co., Ltd.

[0034] 1.3 Strain nucleic acid extraction

[0035] Specific extraction method:

[0036] Use the magnetic bead-based viral DNA / RNA efficient extraction kit (pre-packaged) produced by Hunan Guoce Biotechnology Co., Ltd. The operation is as follows: take out the pre-packaged deep-well plate, invert and mix to resuspend the magnetic beads, gently shake the well plate to concentrate the reagents at the bottom of the well plate, and carefully tear off the aluminum foil sealing film before use to avoid vibration of the well plate and prevent liquid splashing. Add 20 μL of proteinase K and 200 μL of sample to the second column of the nucleic acid extraction reagent (the sample must be inactivated at 60°C in a water bath for 30 minutes and then equilibrated to room temperature), place it on the base of the nucleic acid extraction instrument based on the magnetic bead adsorption principle, and insert the magnetic rod sleeve into the instrument's magnetic rod sleeve holder slot. Select the operating program provided by the manufacturer and run it. After the automated program ends, remove the nucleic acid in the eluate to obtain the sample nucleic acid.

[0037] 1.4 Selection of primers and probes

[0038] By comparing and analyzing the gene sequences of Brucella bovis 2308, Brucella melitensis 16M, Brucella suis 1330, and Brucella canis RM6 / 66 using DNAMAN software, we found that the Bcsp31 gene is highly conserved, and specific primer pairs and probes were designed for this purpose.

[0039] The Bcsp31 gene sequence is GCGGTGGCGGGCCGATTGCGTTGGGAGCGAGCTTTGCGGTTG CACAGGCCCCGACATTTTTCCGTATCGGCACTGGCGGCACAGCCGGAACCTATTATCCGATTGGTGGTCTGATCGCGAACGCGATTTCCGGCGCAGGCGAAAAGGGCGTGCCGGGTCTCGTCGCGACGGCCGTTTCGTCGAATGGCTCGGTTGCCAATATCAATGCGATCAAGTCGGGCGCTCTGGAG TCCGGCTTTACGCAGTCAGACGTTGCCTATTGGGCCTATAACGGCACCGGCCTTTATGATGGCAAGGGCAAGGTGGAAGATTTGCGCCTTCTGGCGACGCTTTACCCGGAAACGATCCATATCGTTGCGCGTAAGGATGCAAACATCAAATCGGTCGCAGACCTGAAAGGCAAGCGCGTTTCGCT(SEQ ID NO.10).

[0040] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows:

[0041] The sequence of the upstream primer Brucella-Bcsp31-F is: 5'-GGTTGCCAATATCAATGCGA-3' (SEQ ID NO. 1); the sequence of the downstream primer Brucella-Bcsp31-R is: 5'-GTCTGCGACCGATTTGATGTTT-3' (SEQ ID NO. 2);

[0042] The sequence of the downstream primer Brucella-Bcsp31-R2 is: 5′-TACGCGCAACGATATGGATCGT-3′ (SEQ ID NO. 11);

[0043] The sequence of the downstream primer Brucella-Bcsp31-R3 is: 5′-AGAAGGCGCAAATCTTCCACCT-3′ (SEQ ID NO. 12);

[0044] The sequence of the probe Brucella-Bcsp31-P is: 5'-AGTCCGGCTTTACGCAGTCAGACGTT-3' (SEQ ID NO. 3). The 5' end of the probe Brucella-Bcsp31-P is labeled with a FAM reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

[0045] 1.5 Optimal reaction conditions

[0046] The optimal amplification system is 50 μL: 2 μL of hot-start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, 13 μL of Oligo Mix, and the amount of extracted nucleic acid is 10 μL.

[0047] Optimal reaction procedure: Place the eight-tube strips into the real-time fluorescence quantitative PCR instrument and set the following procedure for the reaction: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and 45 cycles. Collect the FAM channel fluorescence signal data after each cycle.

[0048] 1.6 Results

[0049] If the Ct value of the FAM channel is ≤35 and the amplification curve is a typical S-type, it is determined to be positive for the Brucella universal type;

[0050] If the Ct value of the FAM channel is 35<≤45 or does not show a typical S-shape, the test should be repeated;

[0051] If, during retesting, the Ct value of the FAM channel is 35 < ≤ 45, then the result should be determined as positive for the universal type of Brucella;

[0052] If there is no Ct value, it should be judged as negative.

[0053] 1.7 Screening of primers and probes for universal fluorescent PCR detection of Brucella

[0054] The above upstream primers, downstream primers, and probes are used in combination in the following schemes:

[0055] Scheme 1: Upstream primer Brucella-Bcsp31-F, downstream primer Brucella-Bcsp31-R, probe Brucella-Bcsp31-P;

[0056] Scheme 2: Upstream primer Brucella-Bcsp31-F, downstream primer Brucella-Bcsp31-R2, probe Brucella-Bcsp31-P;

[0057] Scheme 3: Upstream primer Brucella-Bcsp31-F, downstream primer Brucella-Bcsp31-R3, probe Brucella-Bcsp31-P.

[0058] The extracted nucleic acid was added to the reaction system and tested according to the above optimal reaction conditions. The results are as follows Figure 1 .

[0059] Based on the results, the most preferred option is scheme 1: upstream primer Brucella-Bcsp31-F, downstream primer Brucella-Bcsp31-R, and probe Brucella-Bcsp31-P.

[0060] 1.8 Specificity test of universal fluorescent PCR detection method for Brucella

[0061] The nucleic acid of Brucella, Escherichia coli, Streptococcus suis, Haemophilus parasuis, Mycoplasma hyopneumoniae and Actinobacillus pleuropneumoniae were tested simultaneously under the above optimal conditions. The results were as follows: Figure 2 The results showed that only Brucella nucleic acid could produce a specific fluorescence curve, while the others were negative, proving that the designed primer-probe pair had strong analytical specificity.

[0062] Example 2: Establishment of a Fluorescence Quantitative PCR Method for Identifying and Detecting Brucella suis S2 Vaccine Strain

[0063] 2. Materials and Methods

[0064] 2.1 Materials

[0065] Brucellosis live vaccine (S2 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.

[0066] 2.2 Instrument (same as Example 1)

[0067] 2.3 Strain nucleic acid extraction (same as Example 1)

[0068] 2.4 Selection of primers and probes

[0069] By searching for gene-related information of the Brucella swine S2 strain and comparing it with the whole genome sequence of its parental wild strain, it was found that the S2 vaccine strain was deleted between 24.6-24.7W of chromosome I. Based on this information, specific primers and probes were designed.

[0070] The Brucella suis S2 vaccine strain has a deleted gene, the sequence of which is: ATCCGGTAAAATTCGTTGGGGCTGCG GTCGAGATGCTTGGCGATCTCGGCCTGTGTCAGCCCGCCATCCACACTCGCCAGCAATTCCAATATGTCCAGCCCCTTGTCCAGCGCGGGCGCGCGATAGCGATCGTCAGTTTCCAAGGTCGGCTACGAACAGCGTAAAGGGTGAAAGGAATAACCACCCGCAAATCGCCTTGACCATGTTTGAATAATATGTTTGCATATAAATGGAAGCCCCACAATCGGGGAACGTGG (SEQ ID NO. 13).

[0071] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows:

[0072] The sequence of the upstream primer Brucella-S2-F is: 5′-GCGATAGCGATCGTCAGTT-3′ (SEQ ID NO. 4);

[0073] The sequence of the upstream primer Brucella-S2-F2 is: 5′-AGCAATTCCAATATGTCCAGC-3′ (SEQ ID NO. 14);

[0074] The sequence of the downstream primer Brucella-S2-R is: 5′-GTGGTTATTCCTTTCACCCTTTAC-3′ (SEQ ID NO. 5);

[0075] The sequence of the probe Brucella-S2-P is: 5'-ACGCTGTTCGTAGCCGACCTTG-3' (SEQ ID NO. 6). The 5' end of the probe Brucella-S2-P is labeled with a HEX reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

[0076] 2.5 Optimal reaction conditions

[0077] The optimal amplification system is 50 μL: 2 μL of hot-start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, 13 μL of Oligo Mix, and the amount of extracted nucleic acid is 10 μL.

[0078] Optimal reaction procedure: Place the eight-tube strips into the real-time fluorescence quantitative PCR instrument and set the following procedure for the reaction: pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, and 45 cycles. Collect the fluorescence signal data of the HEX channel after each cycle.

[0079] 2.6 Results

[0080] If the HEX channel Ct value is ≤35 and the amplification curve is a typical S-type, it is determined to be positive for the pig breed S2 vaccine strain;

[0081] If 35<HEX channel Ct value≤45 or does not show a typical S-shape, retest is required;

[0082] If, during retesting, the Ct value of the HEX channel is 35<≤45, then the result should be determined to be positive for the pig breed S2 vaccine strain;

[0083] If there is no Ct value, it should be judged as negative.

[0084] 2.7 Screening of primers and probes for fluorescent PCR detection of Brucella suis S2 vaccine strain

[0085] The above upstream primers, downstream primers, and probes are used in combination in the following schemes:

[0086] Solution 1: Upstream primer Brucella-S2-F, downstream primer Brucella-S2-R, probe Brucella-S2-P;

[0087] Scheme 2: Upstream primer Brucella-S2-F, downstream primer Brucella-S2-R2, probe Brucella-S2-P.

[0088] The extracted nucleic acid was added to the reaction system and tested according to the above optimal reaction conditions. The results are as follows Figure 3 .

[0089] Based on the results, the most preferred option is scheme 1: upstream primer Brucella-S2-F, downstream primer Brucella-S2-R, and probe Brucella-S2-P.

[0090] 2.8 Specificity testing of the fluorescent PCR detection method for Brucella suis S2 vaccine strain

[0091] The nucleic acids of Brucella suis S2 vaccine strain, Brucella naturally infected strain, Brucella bovis A19 vaccine strain, Escherichia coli, Streptococcus suis, Haemophilus parasuis, Mycoplasma hyopneumoniae, and Actinobacillus pleuropneumoniae were tested simultaneously under the above optimal conditions. The results are as follows: Figure 4 The results showed that only the Brucella suis S2 vaccine strain nucleic acid could produce a specific fluorescence curve, while the others were negative, proving that the designed primer-probe pair had strong analytical specificity.

[0092] Example 3: Establishment of a Fluorescence Quantitative PCR Method for Identifying and Detecting Brucella bovis A19 Vaccine Strain

[0093] 3. Materials and Methods

[0094] 3.1 Materials

[0095] Brucellosis live vaccine (A19 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.

[0096] 3.2 Instrument (same as Example 1)

[0097] 3.3 Strain nucleic acid extraction (same as Example 1)

[0098] 3.4 Selection of primers and probes

[0099] By searching for gene-related information of Brucella bovis A19 strain and comparing its whole genome sequence with that of its parent wild strain, it was found that the A19 vaccine strain had ABC gene deletion. Based on this information, specific primers and probes were designed.

[0100] The deleted gene of Brucella bovis A19 vaccine strain is: TCGAGGGTCGCGCATTCTTTGCGCTGA TCGCGATCATCGCCGTCTTCTCGTTCCTTTCGCCCTATTACTTTACGGTCGATAATTTCCTCATGTCGTCGCATGTGGCCATTTTCGGCCTTCTGGCGATTGGTATGCTGCTCGTCATCCTCAATGGCGGCATCGACCTTTCGGTCGGCTCCACGCTGGGGCTGGCCGGTCTGGGCCGTGGTGCTCAT CACCTGCGCGCTCGGCGCCTTCGTCGGCGCGGTCAATGGTGTGTTGATCGCTTATCTGCGCGTTCCGGCCTTCGTGGCGACGCTTGGCGTTCTTTATTGCGCGCGTGGCGTAGCGCTTTTGATGACCAACGGTCTCACCTACAACAATCTCGGCGGTCGCCCCGAACTTGGCAATACGGGCTTTG(SEQID NO.15).

[0101] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows:

[0102] The sequence of the upstream primer Brucella-A19-F is: 5′-AATGGCGGCATCGACCTTT-3′ (SEQ ID NO. 7);

[0103] The sequence of the downstream primer Brucella-A19-R is: 5′-ATTGACCGCGCCGACGAA-3′ (SEQ ID NO. 8);

[0104] The sequence of the downstream primer Brucella-A19-R2 is: 5′-ACACCATTGACCGCGCCGA-3′ (SEQ ID NO. 16);

[0105] The sequence of the downstream primer Brucella-A19-R3 is: 5′-GCAGGTGATGAGCACCA-3′ (SEQ ID NO. 17);

[0106] The sequence of the probe Brucella-A19-P is: 5'-GCTGGCCGGTCTGGGC-3' (SEQ ID NO. 9). The 5' end of the probe Brucella-A19-P is labeled with a Cy5 reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

[0107] 3.5 Optimal reaction conditions

[0108] The optimal amplification system is 50 μL: 2 μL of hot-start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, 13 μL of Oligo Mix, and the amount of extracted nucleic acid is 10 μL.

[0109] Optimal reaction procedure: Place the eight-tube strips into a real-time fluorescence quantitative PCR instrument and set the following procedure for the reaction: 95°C pre-denaturation for 2 min, 95°C denaturation for 15 s, 60°C annealing for 30 s, 45 cycles, and collect Cy5 channel fluorescence signal data after each cycle.

[0110] 3.6 Results

[0111] If the Ct value of the Cy5 channel is ≤35 and the amplification curve is a typical S-shaped one, it is determined to be positive for the bovine A19 vaccine strain;

[0112] If 35<Cy5 channel Ct value≤45 or does not show a typical S-shape, retest is required;

[0113] If, during retesting, the Ct value of the Cy5 channel is 35<≤45, then the result should be determined to be positive for the bovine A19 vaccine strain;

[0114] If there is no Ct value, it should be judged as negative.

[0115] 3.7 Screening of primers and probes for fluorescent PCR detection of Brucella bovis A19 vaccine strain

[0116] The upstream primer, downstream primer, and probe were used in combination. The following schemes were used: Scheme 1: upstream primer Brucella-A19-F, downstream primer Brucella-A19-R, probe Brucella-A19-P; Scheme 2: upstream primer Brucella-A19-F, downstream primer Brucella-A19-R2, probe Brucella-A19-P; Scheme 3: upstream primer Brucella-A19-F, downstream primer Brucella-A19-R3, probe Brucella-A19-P. The extracted nucleic acid was added to the reaction system and tested according to the above optimal reaction conditions. The results are as follows: Figure 5 .

[0117] Based on the results, the most preferred solution is scheme 1: upstream primer Brucella-A19-F, downstream primer Brucella-A19-R, and probe Brucella-A19-P.

[0118] 3.8 Specificity testing of the fluorescent PCR detection method for Brucella bovis A19 vaccine strain

[0119] The nucleic acids of Brucella bovis A19 vaccine strain, Brucella naturally infected strain, Brucella suis S2 vaccine strain, Escherichia coli, Streptococcus suis, Haemophilus parasuis, Mycoplasma hyopneumoniae, and Actinobacillus pleuropneumoniae were tested simultaneously under the above optimal conditions. The results are as follows: Figure 6 The results showed that only the Brucella bovis A19 vaccine strain nucleic acid could produce a specific fluorescence curve, while the others were negative, proving that the designed primer-probe pair had strong analytical specificity.

[0120] Example 4: Establishment of a triple detection method for Brucella universal, swine S2 vaccine strain, and bovine A19 vaccine strain

[0121] 4. Materials and Methods

[0122] 4.1 Materials

[0123] Brucellosis live vaccine (S2 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.

[0124] Brucellosis live vaccine (A19 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.

[0125] 4.2 Instruments (same as in Example 1)

[0126] 4.3 Strain nucleic acid extraction (same as Example 1)

[0127] 4.4 Selection of primers and probes

[0128] The optimal primer and probe pairs for detecting various types of Brucella fluorescence PCR screened in Example 1, Example 2, and Example 3 were used.

[0129] 4.5 Optimal reaction conditions

[0130] The optimal amplification system is 50 μL: 2 μL of hot-start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, 13 μL of Oligo Mix, and the amount of extracted nucleic acid is 10 μL.

[0131] Optimal reaction procedure: Place the eight-tube strips into a real-time fluorescence quantitative PCR instrument and set the following procedure for the reaction: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and 45 cycles. After each cycle, collect fluorescence signal data for the FAM, HEX, ROX, and Cy5 channels.

[0132] 4.6 Results

[0133] 4.6.1 If the Ct value of the ROX channel is ≤35 and the amplification curve is a typical S-shaped curve, the test result is considered valid. If the Ct value of the ROX channel is 35 < ≤45, the sample test should be repeated. If no Ct value is displayed in the ROX channel, the test result is considered invalid.

[0134] 4.6.2 If the test result is deemed valid, if the Ct value of the FAM channel is ≤35 and the amplification curve is a typical S-shaped curve, the test is considered positive for Brucella universal type; if the Ct value of the FAM channel is 35 < ≤45, the test is considered suspicious; if no Ct value is displayed on the FAM channel, the test is considered negative for Brucella universal type.

[0135] 4.6.3 If the test is positive for Brucella, and the HEX channel Ct value is ≤35 and the amplification curve is a typical S-shaped curve, the test is positive for Brucella suis S2 vaccine strain; if the HEX channel Ct value is 35 < ≤45, the test is suspicious; if no Ct value is displayed on the HEX channel, the test is negative for Brucella suis S2 vaccine strain but positive for Brucella.

[0136] 4.6.4 If the test is positive for Brucella, and the Cy5 channel Ct value is ≤35 and the amplification curve is a typical S-shaped curve, the test is considered positive for Brucella bovis A19 vaccine strain; if the Cy5 channel Ct value is 35 < ≤45, the test is considered suspicious; if no Ct value is displayed on the Cy5 channel, the test is considered negative for Brucella bovis A19 vaccine strain but positive for Brucella.

[0137] 4.6.5 If the initial test result is suspicious, a repeat test should be performed. If no Ct value is displayed, the pathogen nucleic acid corresponding to the channel is judged to be negative; otherwise, it is judged to be positive.

[0138] Example 5 Repeatability and gradient test of Brucella fluorescence PCR triple detection method

[0139] Brucella fluorescence PCR triple detection of Brucella live vaccine S2 strain nucleic acid

[0140] The extracted Brucella live vaccine S2 strain nucleic acid was diluted three times in a gradient manner, with three replicates per gradient sample, and tested under the above optimal reaction conditions. The results are as follows: Figure 7 The internal reference of ROX channel was highly consistent with that in Table 1, and the coefficient of variation (CV) of each gradient of FAM channel and HEX channel was less than 1%, indicating good repeatability and gradient.

[0141] Table 1 Results of triple fluorescent PCR detection of Brucella universal type, swine S2 vaccine strain and bovine A19 vaccine strain against Brucella swine S2 vaccine strain

[0142]

[0143] Brucella fluorescent PCR triple detection of Brucella live vaccine A19 strain nucleic acid

[0144] The extracted Brucella live vaccine A19 strain nucleic acid was diluted three times in a gradient manner, and each gradient sample was repeated three times. The test was carried out according to the above optimal reaction conditions. The results are as follows Figure 8 The internal reference of ROX channel was highly consistent with Table 2, and the coefficient of variation (CV) of each gradient of FAM channel and Cy5 channel was less than 1%, indicating good repeatability and gradient.

[0145] Table 2 Results of triple fluorescent PCR detection of Brucella bovis A19 vaccine strain, Brucella universal type, swine S2 vaccine strain and bovine A19 vaccine strain

[0146]

[0147] Those skilled in the art should understand that the discussion of any of the above embodiments is merely illustrative and is not intended to imply that the scope of protection of the present application is limited to these examples. In line with the present application, the technical features in the above embodiments or different embodiments may be combined, the steps may be implemented in any order, and there are many other variations of different aspects of one or more embodiments of the present application as described above, which are not provided in detail for the sake of simplicity.

[0148] The one or more embodiments of this application are intended to encompass all such substitutions, modifications, and variations that fall within the broad scope of this application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of one or more embodiments of this application should be included in the scope of protection of this application.

Claims

1. A primer combination for distinguishing universal types and vaccine strains of Brucella, characterized in that, Includes primer pairs and probes for identifying Brucella universal type, swine S2 vaccine strain, and bovine A19 vaccine strain; The primer pair for identifying universal Brucella is SEQ ID NO.1-2, and the probe is SEQ ID NO.3; The primer pair for identifying the swine S2 vaccine strain is SEQ ID NO. 4-5, and the probe is SEQ ID NO. 6; The primer pair for identifying the bovine A19 vaccine strain is SEQ ID NO. 7-8, and the probe is SEQ ID NO.

9.

2. The primer composition according to claim 1, wherein The 5' end of SEQ ID NO. 3 is labeled with a FAM reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

3. The primer composition according to claim 1, wherein The 5' end of SEQ ID NO. 6 is labeled with a HEX reporter fluorescent group, and the 3' end is labeled with a BHQ1 quencher fluorescent group.

4. The primer composition according to claim 1, wherein The 5' end of SEQ ID NO. 9 is labeled with a CY5 reporter fluorescent group, and the 3' end is labeled with a BHQ2 quencher fluorescent group.

5. The primer composition according to claim 1, wherein An internal standard primer pair and an internal standard probe are also included.

6. The primer composition according to claim 5, wherein The 5' end of the internal standard probe is labeled with a ROX reporter fluorescent group, and the 3' end is labeled with a BHQ2 quencher fluorescent group.

7. The primer composition according to any one of claims 1 to 5, wherein: Also included is a probe-based fluorescent quantitative PCR buffer and a hot-start Taq enzyme.

8. A kit for distinguishing universal types and vaccine strains of Brucella, characterized in that: The invention also comprises a primer composition according to any one of claims 1 to 7.

Citation Information

Patent Citations

  • Kit for differentiating Brucella wild strains from vaccine strains A19 and S2

    CN105018489B

  • A primer set for identifying Brucella and its detection method and application

    CN117106940B