Molecular marker, primer and detection system for identifying 'Tianxing 02' fruit type green radish hybrid and application
Through whole-genome resequencing and KASP primer combined with fluorescence detection technology, the purity of fruit-type green radish hybrids was quickly identified, solving the time-consuming and labor-intensive identification of the existing technology, and achieving efficient and low-cost seed purity identification and variety protection.
Patent Information
- Application Number
- CN202510462172.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art has problems such as labor-consuming, time-consuming, high cost and major influences due to environmental and human factors when identifying the purity of fruit-type green radish hybrids, making it difficult to quickly and accurately identify seed purity.
SNP sites between parents were screened through whole-genome resequencing variant detection, KASP primers were developed, and fluorescence detection technology was combined with Touchdown PCR amplification and fluorescence detection methods to quickly identify the parent, maternal and hybrids of fruit-type green radish.
The rapid, low-cost and accurate identification of the purity of fruit-type green radish hybrids is achieved, reducing losses caused by fake hybrids, improving identification efficiency and providing evidence for variety protection.
Smart Images

Figure CN120442833A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular breeding, and in particular to molecular markers, primers, a detection system and applications for identifying "Tianxing 02" fruit-type green radish hybrids. Background Art
[0002] Agriculture is the foundation of a nation, and seeds are the primary driver of agriculture. Cultivating and producing high-quality seeds is the core mission of the seed industry. Seed quality is the lifeblood of seed production and sales, the foundation of seed sales, and the key to controlling production risks. Generally, the four major indicators of seed quality are: purity, clarity, germination rate, and moisture content. Purity is the most crucial metric in determining seed quality. For this reason, seed purity testing is a crucial component of internal seed quality control and a key quality indicator for market regulation.
[0003] Common methods for cultivar purity identification include seed morphology, seedling morphology, protein (isoenzyme) electrophoresis, DNA molecular marker identification, and field plot identification. Seed morphology identification relies on morphological characteristics of corn seeds, including kernel shape, color, shape, size, embryo size, and endosperm powder content. This identification requires the availability of standard samples or atlases and relevant documentation for the particular variety, resulting in low accuracy. Seedling morphology identification relies on the color of the seedling sheath (green, red, purple, purple), leaf color, leaf shape, and growth potential. Sheath color is generally used as the primary morphological characteristic for purity identification. However, this method is time-consuming. Protein (isoenzyme) electrophoresis utilizes the fact that different seed varieties have different genetic bases and therefore produce different types and quantities of proteins (isoenzymes), resulting in different bands after electrophoretic separation. Comparison with a control (standard) variety allows the determination of the seed quantity of the other variety, ultimately achieving seed purity identification. This method requires time-consuming electrophoresis and is complex to perform. DNA molecular marker identification uses DNA fragments from different varieties as the detection target, using electrophoresis to examine the structure and composition of the genomic DNA. Varieties are distinguished by analyzing polymorphisms, or differences in DNA base sequences, in DNA. Currently, DNA molecular markers used for authenticity and purity verification include PCR-based SSR, AFLP, and RAPD techniques, and molecular hybridization-based RFLP. These methods rely on electrophoretic band resolution to distinguish genuine from counterfeit varieties and do not utilize large-scale operations. Field plot identification is currently the most reliable method for verifying variety authenticity and purity, particularly for hybrids. Its accurate and reliable results make it the most legally binding method for resolving seed quality disputes. This method allows for the observation and comparison of a wide range of traits. However, its disadvantages are labor-intensive, time-consuming, long identification cycles, and high costs. Furthermore, this method is significantly affected by environmental and human factors, and the accuracy of the identification is limited by the observer's experience.
[0004] With the advancement of genome sequencing technology, SNP markers for both parents have been developed. As the latest molecular marker detection method, SNP detection has been recommended by numerous international organizations, such as the International Seed Testing Association (ISTA), the International Union for the Protection of New Varieties of Plants (UPOV), and the International Seed Federation (ISF), for DNA-based variety identification. Key methods include SNP chip platforms, high-throughput in situ scanning platforms (LGC's KASP technology and Life Science's Taqman technology), and high-throughput targeted sequencing of loci and samples. However, these platforms are relatively expensive. Summary of the Invention
[0005] The present invention aims to provide molecular markers, primers, detection systems and applications for identifying the "Tianxing 02" fruit-type green radish hybrid. By developing parental polymorphic KASP primers based on parental resequencing data, combined with rapid F1 seed germination, DNA extraction and laboratory fluorescence quantitative detection, purity identification can be completed quickly and accurately.
[0006] The present invention is achieved through the following technical solutions:
[0007] One of the purposes of the present invention is to provide a molecular marker for identifying "Tianxing 02" fruit-type green radish hybrid, comprising: molecular marker 1 and molecular marker 2;
[0008] The molecular marker 1 is a mutation from A to T occurring at the 767417 bp position on the radish genome scaf7;
[0009] The molecular marker 2 is a T-to-C mutation occurring at the 31482 bp position on the radish genome scaf12.
[0010] A second object of the present invention is to provide primers for amplifying the molecular markers for identifying the "Tianxing 02" fruit-type green radish hybrid, the primers comprising the following:
[0011]
[0012] Furthermore, the 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F are respectively connected to a FAM fluorescent linker;
[0013] The 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F were connected to a HEX fluorescent linker respectively;
[0014] The nucleotide sequence of the FAM fluorescent linker is: GAAGGTGACCAAGTTCATGCT;
[0015] The nucleotide sequence of the HEX fluorescent linker is GAAGGTCGGAGTCAACGGATT.
[0016] The third object of the present invention is to provide a molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid, wherein the molecular marker detection system comprises: the above-mentioned molecular marker and the above-mentioned primer.
[0017] A fourth object of the present invention is to provide the application of the above-mentioned molecular marker detection system in identifying the "Tianxing 02" fruit-type green radish variety.
[0018] A fifth object of the present invention is to provide a detection method for identifying the "Tianxing 02" fruit-type green radish hybrid. The detection method is based on the above-mentioned molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid, and the detection method comprises:
[0019] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product;
[0020] The amplified products were subjected to fluorescence detection, and samples in which both FAM fluorescence signals and HEX fluorescence signals were detected were judged as true hybrids; samples in which only FAM fluorescence signals or HEX fluorescence signals were detected were judged as false hybrids; and samples in which no fluorescence signals were detected were judged as other sexual hybrids.
[0021] Furthermore, the PCR amplification is Touchdown PCR;
[0022] The amplification program of the touchdown PCR was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
[0023] Furthermore, the pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids;
[0024] Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes;
[0025] Samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes;
[0026] And / or, samples in which both FAM fluorescence signals and HEX fluorescence signals are detected are determined to be true hybrids, and the corresponding detection sites are G:A and T:A genotypes.
[0027] A sixth object of the present invention is to provide a method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid. The method is based on the above-mentioned molecular marker detection system for identifying "Tianxing 02" fruit-type green radish hybrid, and the method comprises:
[0028] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product;
[0029] The amplified products were subjected to fluorescence detection, and samples with both FAM and HEX fluorescence signals detected were judged as true hybrids; samples with only FAM or HEX fluorescence signals detected were judged as false hybrids; samples with no fluorescence signals detected were judged as other sexual hybrids;
[0030] The ratio of true hybrids to false hybrids in the total tested samples is calculated to be the purity of the "Tianxing 02" fruit-type green radish hybrid.
[0031] Furthermore, the PCR amplification is Touchdown PCR;
[0032] The amplification program of the touchdown PCR was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles;
[0033] and / or,
[0034] The pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids;
[0035] Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes;
[0036] Samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes;
[0037] And / or, samples in which both FAM fluorescence signals and HEX fluorescence signals are detected are determined to be true hybrids, and the corresponding detection sites are G:A and T:A genotypes.
[0038] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0039] The present invention utilizes a whole-genome resequencing variation detection method to screen two SNP sites that differ between the two parents, successfully develops SNP markers, and develops two pairs of KASP primers. Utilizing fluorescence detection technology, the present invention is able to rapidly distinguish between the male parent, female parent, and hybrid of the "Tianxing 02" fruit-type green radish. These primers can be directly used to identify the commercial variety "Tianxing 02" fruit-type green radish, and further rely on these molecular markers to evaluate the authenticity of commercial hybrids, effectively protecting the rights and interests of this variety.
[0040] By utilizing this molecular marker early on, the present invention allows for rapid identification of the purity of the variety, effectively reducing losses due to false hybrids, alleviating potential disputes, improving identification efficiency and accuracy, and providing evidence for variety protection. Therefore, the present invention has significant application value in the identification and variety protection of the "Tianxing 02" fruit-type green radish hybrid.
[0041] The detection method of the present invention can identify the purity of "Tianxing 02" fruit-type green radish hybrids and protect the variety through preliminary molecular marker screening. The seed purity identification can be completed within 2 hours, offering advantages such as speed, low cost, and ease of use. The detection method of the present invention is simple and easy to use, significantly improving efficiency for seed breeders. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the examples. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be considered as limiting the scope. A person of ordinary skill in the art can also derive other relevant drawings based on these drawings without inventive effort. In the drawings:
[0043] Figure 1 This is the phenotypic diagram of the male parent, female parent, and F1 material of the fruit-type green radish "Tianxing 02";
[0044] Figure 2 The molecular markers provided by the present invention are used to identify the genotyping diagram of the true and false hybrids of the "Tianxing 02" fruit-type green radish; wherein, Figure 2 (a) is the genotyping diagram of molecular marker 1, Figure 2 (b) is the genotyping diagram of molecular marker 2;
[0045] In the figure, A indicates: the PCR product is the fluorescence signal corresponding to primers Rs7-15019 and Rs12-31482, which is the male parent and male-type pseudohybrid;
[0046] B indicates: the PCR product is the fluorescent signal corresponding to primers Rs7-15019 and Rs12-31482, which is a pseudohybrid of the maternal and paternal types;
[0047] Point C indicates: the PCR product has two fluorescent signals of primers Rs7-15019 and Rs12-31482, which is the hybrid F1. DETAILED DESCRIPTION
[0048] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.
[0049] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.
[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0051] One of the purposes of the present invention is to provide a molecular marker for identifying "Tianxing 02" fruit-type green radish hybrid, comprising: molecular marker 1 and molecular marker 2;
[0052] The molecular marker 1 is a mutation from A to T occurring at the 767417 bp position on the radish genome scaf7;
[0053] The molecular marker 2 is a T-to-C mutation occurring at the 31482 bp position on the radish genome scaf12.
[0054] The reference genome of Raphanus sativus V1.0 can be downloaded from: http: / / www.nodai-genome-d.org / download.html.
[0055] The nucleotide sequence of scaf7 from the radish genome is shown in SEQ ID NO.1:
[0056] >Rs_scaf7:15019
[0057] TGGTTCAACTTCATGTTTTAAACCTGAGATGTACCTATAATCACCAGGCAAAATCGGAATGACCTTCCGAACAGGCCATGTGATTGAATCTTCCACGGCATCCCTTATTGTTTCCTGTTACATATCAACTACCGGTAAGTGTCATATGCCCCAGTGCATAAAGGAGCCTCTAAAAGATTACAGCATTTGCATCACTAGC[G / A]TC ACATGGAGCGCTTCTTAAGAAACCAAGATGGAAAAGGAATAGAAAACTAGGAATTAGACTTAACTACAAAAATCATTCGAACAAGGTTCATGTGTTAAAAAGGTTCCTGGCACTAATTGAAAATGTGTTCACTTAGTAACAAATGAATGCTAATATACTACTGTGATAATAGGTGGACAACACCAGGAAAAAAAAACA。
[0058] The nucleotide sequence of radish genome scaf12 is shown in SEQ ID NO.2:
[0059] >Rs_scaf12:31482
[0060] TGTCTCTAAAGCTTATAACTTTGGTGTGGTTTGCAAGGTTGCATCACCACCAAGGAGCTCGGAACCGTGATGAGGTCACTAGGGCAAAACCCAACCGAAGCTGAGCTCCAAGACATGATCAACGAGGTCGATGCAGACGGTAACGGTACCATCGATTTCCCGGAGTTCCTGAACCTGATGGCCAGGAAAATGAAGGACAC[T / C]GACTCTGAGGAAGAGCTCAAGGAAGCCTTTAGGGTTTTCGACA AAGACCAGAACGGTTTCATCTCTGCGGCTGAGCTTCGACATGTGATGACGAACCTCGGTGAGAAACTTACCGACGAGGAGGTTGATGAGATGATCCGTGAAGCTGATGTTGATGGTGATGGTCAGATCAACTATGATGAGTTCGTTAAAGTCATGAT。
[0061] A second object of the present invention is to provide primers for amplifying the molecular markers for identifying the "Tianxing 02" fruit-type green radish hybrid, wherein the primers include the following:
[0062]
[0063]
[0064] Furthermore, the 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F are respectively connected to a FAM fluorescent linker;
[0065] The 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F were connected to a HEX fluorescent linker respectively;
[0066] The nucleotide sequence of the FAM fluorescent linker is shown in SEQ ID NO.9. The nucleotide sequence of the FAM fluorescent linker is: GAAGGTGACCAAGTTCATGCT;
[0067] The nucleotide sequence of the HEX fluorescent linker is shown in SEQ ID NO. 10, and the nucleotide sequence of the HEX fluorescent linker is GAAGGTCGGAGTCAACGGATT.
[0068] The third object of the present invention is to provide a molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid, wherein the molecular marker detection system comprises: the above-mentioned molecular marker and the above-mentioned primer.
[0069] A fourth object of the present invention is to provide the application of the above-mentioned molecular marker detection system in identifying the "Tianxing 02" fruit-type green radish variety.
[0070] A fifth object of the present invention is to provide a detection method for identifying the "Tianxing 02" fruit-type green radish hybrid. The detection method is based on the above-mentioned molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid, and the detection method comprises:
[0071] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product;
[0072] The amplified products were subjected to fluorescence detection, and samples in which both FAM fluorescence signals and HEX fluorescence signals were detected were judged as true hybrids; samples in which only FAM fluorescence signals or HEX fluorescence signals were detected were judged as false hybrids; and samples in which no fluorescence signals were detected were judged as other sexual hybrids.
[0073] Furthermore, the PCR amplification is Touchdown PCR;
[0074] The amplification program of the touchdown PCR was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
[0075] Furthermore, the pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids;
[0076] Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes;
[0077] The samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes.
[0078] A fifth object of the present invention is to provide a method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid. The method is based on the above-mentioned molecular marker detection system for identifying "Tianxing 02" fruit-type green radish hybrid, and the method comprises:
[0079] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product;
[0080] The amplified products were subjected to fluorescence detection, and samples with both FAM and HEX fluorescence signals detected were judged as true hybrids; samples with only FAM or HEX fluorescence signals detected were judged as false hybrids; samples with no fluorescence signals detected were judged as other sexual hybrids;
[0081] The ratio of true hybrids to false hybrids in the total tested samples is calculated to be the purity of the "Tianxing 02" fruit-type green radish hybrid.
[0082] Furthermore, the PCR amplification is Touchdown PCR;
[0083] The amplification program of the touchdown PCR was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles;
[0084] and / or,
[0085] The pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids;
[0086] Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes;
[0087] Samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes;
[0088] And / or, samples in which both FAM fluorescence signals and HEX fluorescence signals are detected are determined to be true hybrids, and the corresponding detection sites are G:A and T:A genotypes.
[0089] To further illustrate the present invention, the following describes the molecular markers, primers, detection system, and applications for identifying the "Tianxing 02" fruit-type green radish hybrid provided by the present invention, in conjunction with examples. However, it should be understood that these examples are based on the technical solutions of the present invention and provide detailed implementation methods and specific operating procedures. These examples are intended only to further illustrate the features and advantages of the present invention and are not intended to limit the scope of the present invention. The scope of protection of the present invention is not limited to the following examples.
[0090] Example 1 Acquisition of molecular markers for the "Tianxing 02" fruit-type green radish hybrid
[0091] 1. Whole-genome resequencing variant detection
[0092] Variant detection involves sequencing and differentially analyzing the genomes of individuals or populations of a species using high-throughput sequencing technology, generating a large number of single nucleotide polymorphisms (SNPs), insertion / deletion (InDel) sites, structural variation (SV) sites, and copy number variation (CNV) sites. With the significant reduction in sequencing costs and improvements in sequencing efficiency, whole-genome resequencing variant detection has become one of the fastest and most effective methods for studying human disease and molecular breeding of plants and animals. After the sequencing data is downloaded from the machine, bioinformatics analysis is performed according to the following process.
[0093] (1) Perform quality control on the raw data to obtain clean data for analysis; the raw data is the raw date to obtain high-quality clean reads for subsequent analysis. The sequencing data filtering steps are as follows: (1) remove reads containing adapters; (2) remove reads with N greater than 3;
[0094] (3) Remove low-quality reads (the number of bases with a quality value Q < 5 accounts for more than 20% of the entire read).
[0095] (2) Align the clean data with the reference genome. After obtaining clean reads, use BWA software to align the clean reads with the reference genome. The initial alignment results are in sam format. Then use SAMtools software to convert the results to bam format and sort them. If the results of a sample include multiple libraries, use SAMtools to merge the bam results of multiple libraries, use Picard to annotate the repeated sequences, and perform basic data statistics.
[0096] (3) Perform SNP variation detection; GATK software (v3.8 second-generation resequencing variation detection software https: / / software.broadinstitute.org / gatk / ) was used to detect SNPs;
[0097] (4) SNP screening: sites with QUAL values (base quality values) less than 30, MQ quality values less than 30, and DP values less than 2 were filtered out, and SNP sites that were homozygous and different between parents were selected as candidate sites.
[0098] 2. Molecular Marker Development
[0099] Based on the differences in the sequencing sequences between the parents, candidate SNP loci were selected. KASP primers (shown in Table 1) were designed using the online primer design software SNP Primer (www.snpway.com). These primers consist of a pair of SNP allele-specific primers (Primer A and Primer B) containing different fluorescent linkers, and a reverse common primer (Primer C). Primer A contains a FAM fluorescent linker (GAAGGTGACCAAGTTCATGCT), while Primer B contains a HEX fluorescent linker (GAAGGTCGGAGTCAACGGATT). Primer pairs with appropriate specificity and annealing temperature were selected and synthesized by Beijing Qingke Co., Ltd.
[0100] Table 1 Molecular marker primers and sequences
[0101]
[0102]
[0103] Example 2 Detection method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid
[0104] A method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid, the method specifically comprising the following steps:
[0105] (1) Using the genomic DNA of the sample to be tested as a template, a touchdown PCR amplification was performed using molecularly labeled amplification primers to obtain the amplified product. The touchdown PCR amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
[0106] (2) Detection and analysis of amplified products
[0107] If the FAM fluorescence signal corresponding to primers Rs7-15019 and Rs12-31482 is detected in the sample PCR product, the corresponding detection sites are A:A, T:T genotypes, and it is determined to be a paternal type pseudohybrid;
[0108] If the HEX fluorescence signal corresponding to primers Rs7-15019 and Rs12-31482 is detected in the sample PCR product, the corresponding detection sites are G:G, A:A genotypes, and it is determined to be a maternal type pseudohybrid;
[0109] If both FAM and HEX fluorescence signals are detected at the same time, the detection site is G:A, T:A genotype, and it is determined to be a true hybrid.
[0110] If no fluorescent signal is detected, it is another genotype combination and is determined to be another type of hybrid.
[0111] (3) The purity of radish hybrid seeds can be calculated by counting the ratio of true hybrids to the total number of tested samples.
[0112] Specific application examples
[0113] According to the methods of Examples 1 and 2, 188 test samples were tested using two SNP markers. The proportion of true hybrids in the test samples was calculated based on the SNP marker test results. The primers were mutually corrected, and when both primer pairs were heterozygous in the F1 test, it was determined to be a true hybrid. The number of hybrid plants was determined as the number of individual plants with the same genotype as the male or female parent at the dual-marker loci. The genotypes of the seeds and the number of true and false hybrids were counted, and the results are shown in Table 3. The purity of the seeds was also calculated based on the statistical results in Table 3, and the results are shown in Table 4.
[0114] Table 3 Genotypes detected by Rs7-15019 and Rs12-31482 markers and determination of true and false hybrids
[0115]
[0116]
[0117]
[0118]
[0119]
[0120] Table 4 Purity identification results
[0121]
[0122] Phenotype diagram of the male and female parents of the "Tianxing 02" fruit-type green radish true and false hybrid and the hybrid F1 material, such as Figure 1 shown.
[0123] According to the results in Table 3, the genotyping results of the true and false hybrids of the "Tianxing 02" fruit-type green radish were statistically analyzed. Figure 2 shown.
[0124] The primers were verified to be stable in field tests and were consistent with the results of field tests, and could be used to identify the purity of radish hybrid varieties.
[0125] In summary, in breeding, through molecular marker identification and screening, if the FAM fluorescence signal corresponding to the primers Rs7-15019 and Rs12-31482 is retained and detected, it can be determined as a paternal pseudohybrid; if the HEX fluorescence signal corresponding to the primers Rs7-15019 and Rs12-31482 is retained and detected, it can be determined as a maternal pseudohybrid; if both fluorescence signals are detected at the same time, the detection sites are G:A and T:A genotypes, and it is determined to be a true hybrid.
[0126] The detection method of the present invention can identify the purity of "Tianxing 02" fruit-type green radish hybrids and protect the variety through preliminary molecular marker screening. The seed purity identification can be completed within 2 hours, offering advantages such as speed, low cost, and ease of use. The detection method of the present invention is simple and easy to use, significantly improving efficiency for seed breeders.
[0127] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A molecular marker for identifying "Tianxing 02" fruit-type green radish hybrid, characterized in that: include: Molecular marker 1 and molecular marker 2; The molecular marker 1 is a mutation from A to T occurring at the 767417 bp position on the radish genome scaf7; The molecular marker 2 is a T-to-C mutation occurring at the 31482 bp position on the radish genome scaf12.
2. A primer for amplifying a molecular marker for identifying the "Tianxing 02" fruit-type green radish hybrid according to claim 1, characterized in that: The primers include the following:
3. The primer according to claim 2, characterized in that The 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F are respectively connected to a FAM fluorescent linker; The 5' end of the primer number Rs7-15019-F and the 5' end of the primer number Rs12-31482-F were connected to a HEX fluorescent linker respectively; The nucleotide sequence of the FAM fluorescent linker is: GAAGGTGACCAAGTTCATGCT; The nucleotide sequence of the HEX fluorescent linker is GAAGGTCGGAGTCAACGGATT.
4. A molecular marker detection system for identifying "Tianxing 02" fruit-type green radish hybrid, characterized in that: The molecular marker detection system comprises: the molecular marker according to claim 1 and the primer according to claim 2 or 3.
5. Use of the molecular marker detection system according to claim 4 in identifying the "Tianxing 02" fruit-type green radish variety.
6. A detection method for identifying "Tianxing 02" fruit-type green radish hybrid, characterized in that: The detection method is based on the molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid described in claim 4, and the detection method comprises: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product; The amplified products were subjected to fluorescence detection, and samples in which both FAM fluorescence signals and HEX fluorescence signals were detected were judged as true hybrids; samples in which only FAM fluorescence signals or HEX fluorescence signals were detected were judged as false hybrids; and samples in which no fluorescence signals were detected were judged as other sexual hybrids.
7. The detection method for identifying "Tianxing 02" fruit-type green radish hybrid according to claim 6, wherein The PCR amplification is Touchdown PCR; The amplification program of the touchdown PCR was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.
8. The detection method for identifying "Tianxing 02" fruit-type green radish hybrid according to claim 6, wherein The pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids; Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes; The samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes.
9. A method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid, characterized in that: The detection method is based on the molecular marker detection system for identifying the "Tianxing 02" fruit-type green radish hybrid described in claim 4, and the detection method comprises: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using two sets of primers corresponding to the molecular markers described in claim 2 to obtain an amplified product; The amplified products were subjected to fluorescence detection, and samples with both FAM and HEX fluorescence signals detected were judged as true hybrids; samples with only FAM or HEX fluorescence signals detected were judged as false hybrids; samples with no fluorescence signals detected were judged as other sexual hybrids; The ratio of true hybrids to false hybrids in the total tested samples is calculated to be the purity of "Tianxing 02" fruit-type green radish hybrid.
10. The method for identifying the purity of "Tianxing 02" fruit-type green radish hybrid according to claim 9, wherein: The PCR amplification is Touchdown PCR; The amplification program of the touchdown PCR is as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles; and / or, The pseudo hybrids include: male-type pseudo hybrids and female-type pseudo hybrids; Samples in which only FAM fluorescence signals were detected were judged as paternal pseudohybrids, and the corresponding detection sites were G:G and T:T genotypes; Samples in which only HEX fluorescence signals were detected were judged as maternal pseudohybrids, and the corresponding detection sites were G:A and T:C genotypes; And / or, samples in which both FAM fluorescence signals and HEX fluorescence signals are detected are determined to be true hybrids, and the corresponding detection sites are G:A and T:A genotypes.