Internal reference gene under stress of New Delhi tomato leaf curl virus and application thereof
By using the RBP2 gene as the internal reference gene, specific primers were designed for qPCR amplification, the problem of instability of internal reference gene expression under ToLCNDV infection was solved, the accuracy of gene quantitative detection was improved, and the screening and molecular mechanism research of disease-resistant varieties was supported.
Patent Information
- Application Number
- CN202510584169.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-05-07
AI Technical Summary
In the prior art, ToLCNDV infection of the New Delhi tomato leaf virus causes unstable expression of plant intra-reference genes, affecting the accuracy of gene expression analysis, and lack of suitable stable intra-reference genes, which limits the in-depth development of ToLCNDV infection molecular mechanism and resistance breeding research.
The RBP2 gene was used as the internal reference gene, and specific primers were designed for qPCR amplification. The expression of candidate genes related to the anti-New Delhi Tomato Leaf Virus was determined by 2-△△CT method, and disease-resistant varieties were screened.
It improves the accuracy and reliability of gene quantitative detection, provides technical support for the screening and molecular mechanism research of anti-ToLCNDV genes, and helps the cultivation of disease-resistant varieties.
Smart Images

Figure BDA0005391208750000061 
Figure BDA0005391208750000071 
Figure BDA0005391208750000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and more specifically, relates to an internal reference gene, a specific primer and an application thereof for quantitative gene detection of plants infected by New Delhi Tomato Leaf Curl Virus. Background Art
[0002] Tomato Leaf Curl New Delhi Virus (ToLCNDV) is a two-component, positive-strand DNA virus belonging to the genus Begomovirus in the family Geminiviridae. Transmitted by whiteflies (Bemisia tabaci), it severely harms cash crops such as tomatoes and melons, causing significant declines in yield and quality. Symptoms caused by ToLCNDV infection include leaf curling, deformity, stunted growth, and reduced fruit size, making it a globally significant viral disease.
[0003] In the study of the ToLCNDV infection mechanism, plant reference genes (such as Actin, EF1α, GAPDH, etc.) are often used to standardize and correct gene expression levels. However, studies have shown that ToLCNDV infection may cause fluctuations in the expression of plant reference genes, affecting the accuracy of gene expression analysis. For example: Liu et al. (2018) found that ToLCNDV infection may interfere with the transcriptional regulatory network of plants, leading to unstable expression of certain commonly used reference genes (such as Actin and EF1α), thereby affecting the reliability of qPCR experiment results. Zhang et al. (2020) found through RNA-Seq data analysis that ToLCNDV infection has a significant effect on the host gene expression pattern, but has not yet screened out reference genes that are stably expressed under ToLCNDV infection conditions.
[0004] Therefore, the expression stability of existing reference genes under ToLCNDV infection conditions has not been systematically verified, which may affect the accurate analysis of gene expression levels. The lack of stable reference genes suitable for ToLCNDV infection conditions has limited the in-depth study of the molecular mechanisms of ToLCNDV infection and resistance breeding. Summary of the Invention
[0005] Based on this, the object of the present invention is to provide an internal reference gene that is stably expressed under the infection conditions of New Delhi Tomato Leaf Curl Virus ToLCNDV.
[0006] The technical solutions for achieving the above-mentioned invention objectives include the following.
[0007] In a first aspect of the present invention, an internal reference gene under New Delhi Tomato Leaf Curl Virus stress is provided, wherein the internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO: 1.
[0008] The second aspect of the present invention provides the use of the above-mentioned internal reference gene in the quantitative detection of genes in plants under New Delhi Tomato Leaf Curl Virus stress or in the screening of New Delhi Tomato Leaf Curl Virus-resistant genes.
[0009] In a third aspect of the present invention, specific primers for the internal reference gene under New Delhi Tomato Leaf Curl Virus stress are provided, comprising a forward primer having a sequence as shown in SEQ ID NO: 2 and a reverse primer having a sequence as shown in SEQ ID NO: 3.
[0010] A fourth aspect of the present invention provides use of the above-mentioned specific primers in preparing a kit for quantitative gene detection in plants under New Delhi Tomato Leaf Curl Virus stress.
[0011] In a fifth aspect, the present invention provides a gene quantitative detection kit for plants under New Delhi Tomato Leaf Curl Virus stress, comprising specific primers for the internal reference gene under New Delhi Tomato Leaf Curl Virus stress.
[0012] In a sixth aspect, the present invention provides a method for quantitatively detecting genes in plants under New Delhi Tomato Leaf Curl Virus stress, comprising the following steps: using the cDNA of the plant to be tested as a template, and using amplification primers of the gene to be tested and the specific primers of the above-mentioned internal reference gene as primers to perform qPCR amplification.
[0013] The inventors of the present invention used qRT-PCR (real-time fluorescence quantitative PCR) to detect the expression stability of 22 candidate internal reference genes and the commonly used internal reference gene EF1α in Nicotiana benthamiana at 3 days and 5 days after infection with New Delhi Tomato Leaf Curl Virus (ToLCNDV). They found that when Nicotiana benthamiana was infected with New Delhi Tomato Leaf Curl Virus for different times, the RBP2 gene was not affected by exogenous and endogenous factors and still had extremely high expression stability. Therefore, the RBP2 gene can be used as an internal reference gene for quantitative detection of plant genes under New Delhi Tomato Leaf Curl Virus stress conditions, which can effectively eliminate the quantitative deviation caused by fluctuations in the expression of internal reference genes under the background of ToLCNDV infection, improve the accuracy and reliability of gene quantitative detection, provide technical support for the screening of ToLCNDV-resistant genes and the study of molecular mechanisms, and contribute to the cultivation of disease-resistant varieties.
[0014] Using the internal reference gene RBP2 gene, the fluorescence quantitative PCR technology was used to —△△CT This method can determine the expression levels of candidate genes related to resistance to New Delhi Tomato Leaf Curl Virus, and screen genes for resistance to New Delhi Tomato Leaf Curl Virus based on the changes in the expression levels of candidate genes under stress and normal conditions. DETAILED DESCRIPTION
[0015] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.
[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0017] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual (2013), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.
[0018] In some embodiments of the present invention, an internal reference gene under New Delhi Tomato Leaf Curl Virus stress is disclosed. The internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO: 1.
[0019] In other embodiments of the present invention, the use of the above-mentioned internal reference gene in the quantitative detection of genes in plants under New Delhi Tomato Leaf Curl Virus stress or the screening of New Delhi Tomato Leaf Curl Virus-resistant genes is disclosed.
[0020] In other embodiments of the present invention, specific primers for the internal reference gene under New Delhi Tomato Leaf Curl Virus stress are disclosed, including a forward primer having a sequence as shown in SEQ ID NO: 2 and a reverse primer having a sequence as shown in SEQ ID NO: 3.
[0021] In other embodiments of the present invention, the use of the above-mentioned specific primers in preparing a gene quantitative detection kit for plants under New Delhi Tomato Leaf Curl Virus stress is disclosed.
[0022] In some embodiments, the method for quantitative gene detection is qPCR or qRT-PCR.
[0023] In some embodiments, the plant is tomato, loofah, pumpkin, bitter melon, gourd or tobacco.
[0024] In other embodiments of the present invention, a gene quantitative detection kit for plants under New Delhi Tomato Leaf Curl Virus stress is disclosed, which includes specific primers for the internal reference gene under New Delhi Tomato Leaf Curl Virus stress.
[0025] In some embodiments, it further comprises amplification primers for the gene to be detected.
[0026] In some embodiments, the target gene to be detected is HSP82.
[0027] In some embodiments, the amplification primers for the target gene to be detected are shown as SEQ ID NO:4 and SEQ ID NO:5.
[0028] In other embodiments of the present invention, a method for quantitatively detecting genes in plants under New Delhi Tomato Leaf Curl Virus stress is disclosed, comprising the following steps: using the cDNA of the plant to be tested as a template, and using amplification primers of the gene to be tested and the specific primers of the above-mentioned internal reference gene as primers to perform qPCR amplification.
[0029] In some embodiments, the plant is tomato, loofah, pumpkin, bitter melon, gourd or tobacco.
[0030] The Tomato Leaf Curl New Delhi virus ToLCNDV used in the present invention was isolated from virus-infected leaves of loofah at the Zhongluotan base in Baiyun District, Guangzhou City, Guangdong Province, and was identified as Tomato Leaf Curl New Delhi virus ToLCNDV.
[0031] The present invention is described in detail below with reference to specific embodiments.
[0032] Example 1 Screening of stably expressed reference genes under New Delhi Tomato Leaf Curl Virus (ToLCNDV) infection conditions
[0033] The following steps are involved:
[0034] 1. Vaccination with ToLCNDV virus
[0035] Take the Nicotiana benthamiana plants cultured in the constant temperature and humidity culture room of the applicant's laboratory, and inoculate ToLCNDV virus by Agrobacterium infiltration (a method known in the art) at the 4-5 true leaf stage, wherein the inoculation concentration of DNA-A and DNA-B of ToLCNDV virus is OD 600 =0.3, and the corresponding empty vector (control) injection concentration was 0.6. After inoculation, the culture was continued under the same environmental conditions, and leaves were collected 3 days and 5 days after inoculation. Each experimental group had 3 biological replicates, for a total of 12 samples.
[0036] 2. Extract total RNA and reverse transcribe it into cDNA
[0037] Total RNA was extracted from each sample according to the instructions of the TransZol Up Plus RNA extraction kit. The quality and concentration of total RNA were measured using a NanoDrop 2000 spectrophotometer. The results showed that the 260 / 280 ratio of total RNA for all samples ranged from 1.8 to 2.1, indicating high purity and suitability for subsequent experiments. Based on RNA-Seq (transcriptome sequencing) analysis, genes that showed stable expression both after 3 and 5 days of injection were screened, resulting in a total of 22 genes identified as candidate new internal reference genes.
[0038] According to the instructions of the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit, total RNA (~2 μg) was reverse transcribed using a mixture of Oligo(dT)18 and Randomprimer as reverse transcription primers to obtain 20 μL of cDNA.
[0039] 3. qPCR amplification
[0040] Primers were designed based on the sequences of the 22 candidate new reference genes and the reference gene EF1α. These primers were synthesized by a commercial company, purified using PAGE, and diluted to a working solution for later use. The primer sequences are shown in Table 1. The reaction system was prepared on ice as shown in Table 2. qPCR reactions were performed on a CFX96 real-time fluorescence quantitative PCR instrument.
[0041] Table 1
[0042]
[0043]
[0044] Table 2
[0045] Reaction components Add Volume 2×SYBR Green Mix 10 μL cDNA (~2 μg / μL) 1 μL Forward primer F (10 μM) 0.4μL Reverse primer R (10 μM) 0.4μL <![CDATA[ddH2O]]> 8.2μL Total 20 μL
[0046] qPCR run procedure:
[0047] Each reaction was repeated three times to obtain the expression data Cq value of each gene.
[0048] 4. Experimental results
[0049] (1) Specificity analysis of qPCR amplification primers
[0050] The melting curves of the 23 genes all showed single, overlapping, and non-spurious peaks, indicating that all primers were suitable for qPCR amplification.
[0051] (2) Evaluation of internal reference gene expression stability
[0052] The expression Cq values detected for each candidate reference gene were entered into analysis software. Stability evaluation of the 23 genes was performed using four software programs: geNorm, NormFinder, ΔCt, and BestKeeper. RefFinder software was then used to comprehensively analyze the stability evaluation results from the four software programs. The results are shown in Table 3.
[0053] Table 3
[0054]
[0055] Note: The smaller the value, the more stable the gene expression.
[0056] The results in Table 3 show that NbRBP2 is the gene with the strongest comprehensive stability, far exceeding the most commonly used internal reference gene EF1α. Therefore, it is used as a new internal reference gene, and its nucleotide sequence is shown in SEQ ID NO: 1.
[0057] SEQ ID NO: 1
[0058] ATGGGAGATGCCTATTGGAATCAGCATCGTCAAGCGCCGCTTCCTCAATCT
[0059] GCCGGTTTGCTCAAACGACCTCGCTCTGAATATGTTTCCAGATCTTCCACCA
[0060] TCTGGGATATCATCAGCTCATGAAATGCATCATTACTTAGGACGGATGATG
[0061] ATCGTGGTGGACCTCGAGTAGTGGACACACAGTCAATTGGATCAGCATATG
[0062] ATCGTTATCTTCAGAGTTCGCAACTTTCTTCTCTTTCAGTCGGAGAAGCTAA
[0063] TAGTTACAAGGGAGTTGGAATTGGATTGGCTAGAGCAGGTGCTGGTGGTAT
[0064] ATCTTCCCTTCCTGTACGTGATCCGCTTCCATCAGCTCGTGGGCCAGAACTA
[0065] GCACCAAATGGAAGAGCAATGGTATTAAGTGGTCAAATGCCAGTCGAATCT
[0066] TTGCCAAGGCCTCGTGAAACACTGCCTCTCCCTCCTGATGCTTCTAACACC
[0067] CTCTATATAGAGGGACTTCCTGCAGACAGCTCCAGAAGAGAAGTAGCCCAT
[0068] ATTTTTCCGCCCTTTTGTGGGCTACAAAGAAGTCAGACTTGTTAGAAAGGAA
[0069] TCAAAACATCGTGGTGGAGATCCTCTTATCCTTTGTTTTGTGGATTTCATGG
[0070] ATCCAGCATGTGCAGCTACTGCTTTGAGTGCATTGCAAGGTTACAAAATGG
[0071] ATGAACATGACCCGATTCGGCCTACTTGCGGTTGCAGTTCTCGAAGTTTC
[0072] CAGGTCCGAGGTCTGGTGGCTCGGGGAGTCGTGGGAAGCGATGA
[0073] Example 2 Verification of the stability of the internal reference gene NbRBP2 for quantitative detection of target genes
[0074] This example used the most stably expressed reference gene NbRBP2 and the least stably expressed reference gene NbNQO1, as shown in Table 3, to verify the stability of the quantitative expression of HSP82, a gene associated with interaction with the pathogen Tomato Leaf Curl New Delhi Virus (ToLCNDV). The transcriptome results for HSP82 (Table 4) showed a log2FoldChange of 6.66566955589557 after three days of viral infection, indicating an upregulation of approximately 100-fold.
[0075] Table 4
[0076]
[0077] qPCR reactions were performed using RBP2 and NQO1 as internal reference genes, respectively, and cDNA from six leaf samples from the two experimental groups (virus-infected 3-day group and empty vector-infected 3-day group) in Example 1 as templates. The reaction system was the same as in Table 2 (the reaction system also included the forward primer F: TGGAGGAACTGCGTAAGAGA (SEQ ID NO: 4) and the reverse primer R: TCAGACCCAACTTCAACATCC (SEQ ID NO: 5) for the HSP82 gene). The reaction procedure was the same as step 3 of Example 1.
[0078] Using RBP2 and NQO1 as internal reference genes, the transcription level of HSP82, a gene related to interaction with pathogens, was detected. The results are shown in Tables 5 and 6, respectively.
[0079] Table 5 RBP2 was used as an internal reference gene to detect HSP82 gene
[0080]
[0081] Note: The data in the back row of the table are the mean ± SE of three independent biological replicates (n=3). E represents empty vector EV; T represents virus ToLCNDV.
[0082] Table 6 NQO1 was used as an internal reference gene to detect HSP82 gene
[0083]
[0084]
[0085] Note: The data in the back row of the table are the mean ± SE of three independent biological replicates (n=3). E represents empty vector EV; T represents virus ToLCNDV.
[0086] The results in Tables 5 and 6 show that when NbRBP2 was used as the internal reference gene, the NbHSP82 gene had an upregulation fold of 99.24 (the fold increase in gene expression caused by the virus relative to the empty vector control) after three days of viral infection, which generally matches the transcriptome data. However, when NbNQO1 was used as the internal reference gene, the NbHSP82 gene had an upregulation fold of 330.26 after three days of viral infection, indicating that the data for quantitative gene expression analysis using NbNQO1 as the internal reference gene is unstable.
[0087] Therefore, it is most appropriate to use NbRBP2 as an internal reference gene in the quantitative expression detection of genes under New Delhi Tomato Leaf Curl Virus infection conditions.
[0088] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0089] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. An internal reference gene under New Delhi Tomato Leaf Curl Virus stress, characterized in that The internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO:
1.
2. Use of the internal reference gene according to claim 1 in quantitative gene detection of plants under New Delhi Tomato Leaf Curl Virus stress or in screening for New Delhi Tomato Leaf Curl Virus-resistant genes.
3. The specific primers for the internal reference gene under New Delhi Tomato Leaf Curl Virus stress according to claim 1, characterized in that: It includes a forward primer with a sequence as shown in SEQ ID NO: 2 and a reverse primer with a sequence as shown in SEQ ID NO:
3.
4. Use of the specific primers according to claim 3 in preparing a gene quantitative detection kit for plants under New Delhi Tomato Leaf Curl Virus stress.
5. The use according to claim 4, characterized in that The method for quantitative gene detection is qPCR or qRT-PCR.
6. The use according to claim 4, characterized in that The plant is tomato, loofah, pumpkin, bitter melon, gourd or tobacco.
7. A kit for quantitative detection of genes in plants under New Delhi Tomato Leaf Curl Virus stress, characterized in that: The method comprises the specific primers of the internal reference gene under the stress of New Delhi Tomato Leaf Curl Virus according to claim 3.
8. The gene quantitative detection kit for plants under New Delhi Tomato Leaf Curl Virus stress according to claim 7, characterized in that It also includes amplification primers for the target gene to be detected; preferably, the target gene to be detected is HSP82, and the amplification primers for the target gene to be detected are shown in SEQ ID NO: 4 and SEQ ID NO:
5.
9. A method for quantitatively detecting genes in plants under New Delhi Tomato Leaf Curl Virus stress, characterized in that: The following steps are involved: qPCR amplification is performed using the cDNA of the plant to be tested as a template, and using the amplification primers of the gene to be tested and the specific primers of the internal reference gene according to claim 3 as primers.
10. The method for quantitative detection of genes in plants under New Delhi Tomato Leaf Curl Virus stress according to claim 9, characterized in that: The plant is tomato, loofah, pumpkin, bitter melon, gourd or tobacco.
Citation Information
Patent Citations
Visual detection method of New Delhi tomato leaf curl virus
CN119332029A
KR20200126454A