Reference genes under tomato leaf curl new delhi virus stress and their applications

By using the RBP2 gene as an internal reference gene and designing specific primers for gene quantification, the problem of unstable internal reference gene under ToLCNDV infection was solved, thus improving the accuracy of gene expression analysis and supporting the breeding of disease-resistant varieties.

CN120442838BActive Publication Date: 2025-11-04INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510584169.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-11-04
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

In the existing technology, Tolichrysum leaf curl virus (ToLCNDV) infection leads to unstable expression of plant internal reference genes, affecting the accuracy of gene expression analysis. The lack of suitable stable internal reference genes limits the in-depth development of research on the molecular mechanism of ToLCNDV infection and resistance breeding.

Method used

Using the RBP2 gene as an internal reference gene, specific primers were designed for the quantitative detection of the gene under the stress of New Delhi tomato leaf curl virus. The quantitative deviation caused by the fluctuation of the expression of the internal reference gene was eliminated by qRT-PCR technology, thereby improving the detection accuracy.

Benefits of technology

The RBP2 gene is stably expressed under ToLCNDV infection conditions. As an internal reference gene, it can effectively eliminate quantitative bias, improve the accuracy and reliability of gene quantitative detection, and help in the breeding of disease-resistant varieties and the study of molecular mechanisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005391208750000061
    Figure BDA0005391208750000061
  • Figure BDA0005391208750000071
    Figure BDA0005391208750000071
  • Figure BDA0005391208750000081
    Figure BDA0005391208750000081
Patent Text Reader

Abstract

The application discloses an internal reference gene under New Delhi tomato leaf curl virus (ToLCNDV) stress and application thereof, wherein the internal reference gene is an RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown as SEQ ID NO:1. It is found that the RBP2 gene can be used as an internal reference gene for quantitatively detecting plant genes under ToLCNDV stress conditions, can effectively eliminate the quantitative deviation caused by expression fluctuation of the internal reference gene under ToLCNDV infection background, and can improve the accuracy and reliability of gene quantitative detection, thereby providing technical support for screening of ToLCNDV-resistant genes and molecular mechanism research, and being helpful to cultivation of disease-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology. More specifically, this invention relates to an internal reference gene, specific primers, and their applications for quantitative detection of genes in plants infected with New Delhi tomato leaf curl virus. Background Technology

[0002] Tomato Leaf Curl New Delhi Virus (ToLCNDV) is a two-component positive-sense DNA virus belonging to the genus Begomovirus in the family Geminiviridae. It is transmitted by the whitefly (Bemisiatabaci) and severely damages economic crops such as tomatoes and melons, causing a significant decline in yield and quality. Symptoms caused by ToLCNDV infection include leaf curling, malformation, stunted growth, and smaller fruits, and it has become one of the most important viral diseases globally.

[0003] In studies on the infection mechanism of ToLCNDV, plant reference genes (such as Actin, EF1α, and GAPDH) are often used for the standardization and correction of gene expression levels. However, previous studies have shown that ToLCNDV infection may lead to fluctuations in the expression levels of plant reference genes, affecting the accuracy of gene expression analysis. For example, Liu et al. (2018) found that ToLCNDV infection may interfere with the plant's transcriptional regulatory network, leading to unstable expression of some commonly used reference genes (such as Actin and EF1α), thereby affecting the reliability of qPCR results. Zhang et al. (2020) found through RNA-Seq data analysis that ToLCNDV infection has a significant impact on host gene expression patterns, but no reference genes stably expressed under ToLCNDV infection conditions have been screened.

[0004] Therefore, the expression stability of existing internal reference genes under ToLCNDV infection conditions has not been systematically verified, which may affect the accurate analysis of gene expression levels. The lack of stable internal reference genes suitable for ToLCNDV infection conditions limits in-depth research on the molecular mechanisms of ToLCNDV infection and resistance breeding. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide an internal reference gene that is stably expressed under Tolix Leaf Curl Virus (ToLCNDV) infection conditions in New Delhi.

[0006] The technical solutions for achieving the above-mentioned objectives include the following.

[0007] In a first aspect, the present invention provides an internal reference gene for the stress of New Delhi tomato leaf curl virus, wherein the internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO:1.

[0008] In a second aspect, the present invention provides the application of the above-mentioned internal reference gene in the quantitative detection of genes or the screening of genes resistant to New Delhi tomato leaf curl virus in plants under stress with New Delhi tomato leaf curl virus.

[0009] A third aspect of the present invention provides specific primers for the internal reference gene under the stress of the New Delhi tomato leaf curl virus, including a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer with a sequence as shown in SEQ ID NO:3.

[0010] In a fourth aspect, the present invention provides the application of the above-mentioned specific primers in the preparation of a gene quantification kit for plants under New Delhi tomato leaf curl virus stress.

[0011] In a fifth aspect, the present invention provides a gene quantification detection kit for plants under New Delhi tomato leaf curl virus stress, comprising specific primers for the aforementioned internal reference gene under New Delhi tomato leaf curl virus stress.

[0012] In a sixth aspect, the present invention provides a method for quantitative detection of genes in plants under stress from New Delhi tomato leaf curl virus, comprising the following steps: using cDNA of the plant to be tested as a template, and using amplification primers of the gene to be tested and specific primers of the internal reference gene as primers, qPCR amplification is performed.

[0013] The inventors of this invention used qRT-PCR (real-time quantitative PCR) to detect the expression stability of 22 candidate internal reference genes and the commonly used internal reference gene EF1α in Nicotiana Bunsenata at 3 and 5 days after infection with ToLCNDV (Tomato Leaf Curl Virus). They found that when Nicotiana Bunsenata was infected with ToLCNDV at different times, the RBP2 gene remained highly stable regardless of exogenous or endogenous factors. Therefore, the RBP2 gene can be used as an internal reference gene for quantitative detection of plant genes under ToLCNDV stress conditions. This can effectively eliminate quantitative deviations caused by fluctuations in the expression of internal reference genes under ToLCNDV infection background, improve the accuracy and reliability of gene quantitative detection, provide technical support for the screening of ToLCNDV-resistant genes and the study of molecular mechanisms, and contribute to the breeding of disease-resistant varieties.

[0014] Using the internal reference gene RBP2, quantitative real-time PCR was performed using 2 —△△CT This method can determine the expression levels of candidate genes related to resistance to New Delhi tomato leaf curl virus, and further screen for genes resistant to New Delhi tomato leaf curl virus based on changes in the expression levels of candidate genes under stress and normal conditions. Detailed Implementation

[0015] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0016] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0017] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0018] In some embodiments of the present invention, an internal reference gene for New Delhi tomato leaf curl virus stress is disclosed, wherein the internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO:1.

[0019] In other embodiments of the present invention, the application of the above-mentioned internal reference gene in the quantitative detection of genes or the screening of genes resistant to New Delhi tomato leaf curl virus in plants under stress with New Delhi tomato leaf curl virus is disclosed.

[0020] In other embodiments of the present invention, specific primers for the internal reference gene under the stress of the New Delhi tomato leaf curl virus are disclosed, including a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer with a sequence as shown in SEQ ID NO:3.

[0021] In other embodiments of the present invention, the application of the above-mentioned specific primers in the preparation of a gene quantification kit for plants under New Delhi tomato leaf curl virus stress is disclosed.

[0022] In some embodiments, the gene quantification method is qPCR or qRT-PCR.

[0023] In some embodiments, the plant is a tomato, loofah, pumpkin, bitter melon, gourd, or tobacco.

[0024] In other embodiments of the present invention, a gene quantification kit for plants under New Delhi tomato leaf curl virus stress is disclosed, which includes specific primers for the internal reference gene under New Delhi tomato leaf curl virus stress.

[0025] In some embodiments, it also includes amplification primers for the gene to be tested.

[0026] In some embodiments, the target gene to be tested is HSP82.

[0027] In some embodiments, the amplification primers for the target gene to be tested are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0028] In other embodiments of the present invention, a method for quantitative detection of genes in plants under stress from New Delhi tomato leaf curl virus is disclosed, comprising the following steps: using cDNA of the plant to be tested as a template, and using amplification primers of the gene to be tested and specific primers of the above-mentioned internal reference gene as primers, qPCR amplification is performed.

[0029] In some embodiments, the plant is a tomato, loofah, pumpkin, bitter melon, gourd, or tobacco.

[0030] The New Delhi Tomato Leaf Curl Virus (ToLCNDV) used in this invention was isolated from virus-infected leaves of loofah at the Zhongluotan Base in Baiyun District, Guangzhou City, Guangdong Province, and was identified as New Delhi Tomato Leaf Curl Virus (ToLCNDV).

[0031] The present invention will be described in detail below with reference to specific embodiments.

[0032] Example 1: Screening of internal reference genes stably expressed under Tolcher Leaf Curl Virus (ToLCNDV) infection conditions in New Delhi

[0033] Includes the following steps:

[0034] 1. Inoculation with ToLCNDV virus

[0035] ToLCNDV virus was inoculated into Nicotiana Bunsenata plants cultured in the applicant's laboratory at the 4-5 true leaf stage using Agrobacterium tumefaciens infiltration (a method known in the art). The inoculation concentration of ToLCNDV virus DNA-A and DNA-B was OD. 600 =0.3, with a corresponding empty vector (control) injection concentration of 0.6. After inoculation, the cells were cultured under the same environmental conditions, and leaves were collected 3 days and 5 days after inoculation. Each experimental group had 3 biological replicates, for a total of 12 samples.

[0036] 2. Extract total RNA and reverse transcribe it into cDNA.

[0037] Total RNA was extracted from each sample according to the instructions of the TransZol Up Plus RNA Extraction Kit. The mass and concentration of total RNA were measured using a NanoDrop 2000 spectrophotometer. The results showed that the 260 / 280 values ​​of total RNA in all samples ranged from 1.8 to 2.1, indicating high purity suitable for subsequent experiments. Based on RNA-Seq (transcriptome sequencing) analysis, genes showing stable expression in both 3-day and 5-day backgrounds were screened, resulting in 22 candidate novel internal control genes.

[0038] Following the instructions of the TransScript One-Step gDNARemoval and cDNA Synthesis SuperMix Kit, Oligo(dT)18 and Randomprimer were used as reverse transcription primers to reverse transcribe total RNA (~2 μg) to obtain 20 μL of cDNA.

[0039] 3. qPCR amplification

[0040] Primers were designed based on the 22 candidate novel internal reference genes and the EF1α sequence of the internal reference gene. They were synthesized commercially, purified using PAGE, and diluted to prepare working solutions. Primer sequences are shown in Table 1. Reaction systems prepared on ice are shown in Table 2. qPCR reactions were performed using a CFX96 real-time quantitative PCR instrument.

[0041] Table 1

[0042]

[0043]

[0044] Table 2

[0045] Reaction components Add volume 2×SYBRGreenMix 10μL cDNA (~2 μg / μL) 1μL Forward primer F (10 μM) 0.4μL Reverse primer R (10 μM) 0.4μL <![CDATA[ddH2O]]> 8.2μL Total 20μL

[0046] qPCR running procedure:

[0047] Each reaction was performed in triplicate. The expression data (Cq values) of each gene were obtained.

[0048] 4. Experimental Results

[0049] (1) Specificity analysis of qPCR amplification primers

[0050] The melting curves of all 23 genes showed single, overlapping peaks without any extraneous peaks, indicating that all primers can be used for qPCR amplification.

[0051] (2) Evaluation of the stability of internal reference gene expression

[0052] The expression Cq values ​​of each candidate internal reference gene were input into the analysis software. The stability of 23 genes was evaluated using four software programs: geNorm, NormFinder, ΔCt, and BestKeeper. The stability evaluation results from the four software programs were then analyzed using RefFinder software. The results are shown in Table 3.

[0053] Table 3

[0054]

[0055] Note: The smaller the value, the more stable the gene expression.

[0056] The results in Table 3 show that NbRBP2 is the gene with the strongest overall stability, far exceeding the most commonly used internal reference gene EF1α. Therefore, it is used as a new internal reference gene, and its nucleotide sequence is shown in SEQ ID NO:1.

[0057] SEQ ID NO:1

[0058] ATGGGAGATGCCTATTGGAATCAGCATCGTCAAGCGCCGCTTCCTCAATCT

[0059] GCCGGTTTGCTCAAACGACCTCGCTCTGAATATGTTTCCAGATCTTCCACCA

[0060] TCTGGGATATCATCAGCTCATGAAATGCATCATTACTTAGGACGGATGATG

[0061] ATCGTGGTGGACCTCGAGTAGTGGACACACAGTCAATTGGATCAGCATATG

[0062] ATCGTTATCTTCAGAGTTCGCAACTTTCTTCTCTTTCAGTCGGAGAAGCTAA

[0063] TAGTTACAAGGGAGTTGGAATTGGATTGGCTAGAGCAGGTGCTGGTGGTAT

[0064] ATCTTCCCTTCCTGTACGTGATCCGCTTCCATCAGCTCGTGGGCCAGAACTA

[0065] GCACCAAATGGAAGAGCAATGGTATTAAGTGGTCAAATGCCAGTCGAATCT

[0066] TTGCCAAGGCCTCGTGAAACACTGCCTCTCCCTCCTGATGCTTCTAACACC

[0067] CTCTATATAGAGGGACTTCCTGCAGACAGCTCCAGAAGAGAAGTAGCCCAT

[0068] ATTTTTCCGCCCTTTTGTGGGCTACAAAGAAGTCAGACTTGTTAGAAAGGAA

[0069] TCAAAACATCGTGGTGGAGATCCTCTTATCCTTTGTTTTGTGGATTTCATGG

[0070] ATCCAGCATGTGCAGCTACTGCTTTGAGTGCATTGCAAGGTTACAAAATGG

[0071] ATGAACATGACCCGATTCGGCCTACTTGCGGTTGCAGTTCTCGAAGTTTC

[0072] CAGGTCCGAGGTCTGGTGGCTCGGGGAGTCGTGGGAAGCGATGA

[0073] Example 2: Stability verification of the internal reference gene NbRBP2 for quantitative detection of the target gene

[0074] In this embodiment, the most stable internal reference gene NbRBP2 and the least stable internal reference gene NbNQO1 from Table 3 were used to verify the stability of quantitative expression of HSP82, a gene related to the interaction with the pathogen (Tolix New Delhi Tomato Leaf Curl Virus, ToLCNDV). The transcriptome results of the HSP82 gene (as shown in Table 4) show that at 3 days after viral infection, log2FoldChange = 6.66566955589557, indicating an upregulation fold of approximately 100-fold.

[0075] Table 4

[0076]

[0077] RBP2 and NQO1 were used as internal reference genes, respectively. qPCR reactions were performed using cDNA from six leaf samples of the two experimental groups (virus infection group for 3 days and empty vector group for 3 days) in Example 1 as templates. The reaction system was the same as in Table 2 (the reaction system also included the forward primer F of the HSP82 gene: TGGAGGAACTGCGTAAGAGA (SEQ ID NO:4), and the reverse primer R: TCAGACCCAACTTCAACATCC (SEQ ID NO:5)). The reaction procedure was the same as step 3 in Example 1.

[0078] Using RBP2 and NQO1 as internal reference genes, the transcription level of HSP82, a gene related to interaction with pathogens, was detected. The results are shown in Tables 5 and 6, respectively.

[0079] Table 5. RBP2 as an internal reference gene for HSP82 gene detection.

[0080]

[0081] Note: The data in the last row of the table are the mean ± SE (n=3) of three independent biological replicates. E represents empty vector EV; T represents virus ToLCNDV.

[0082] Table 6. NQO1 as an internal reference gene for HSP82 gene detection.

[0083]

[0084]

[0085] Note: The data in the last row of the table are the mean ± SE (n=3) of three independent biological replicates. E represents empty vector EV; T represents virus ToLCNDV.

[0086] Tables 5 and 6 show that when NbRBP2 was used as the internal reference gene, the upregulation fold of the NbHSP82 gene (the fold increase in gene expression caused by the virus relative to the control empty vector) was 99.24 days after viral infection, which is basically consistent with the transcriptome data. However, when NbNQO1 was used as the internal reference gene, the upregulation fold of the NbHSP82 gene was 330.26 days after viral infection, indicating that the data for quantitative gene expression detection using NbNQO1 as the internal reference gene was unstable.

[0087] Therefore, using NbRBP2 as an internal reference gene is the most suitable for quantitative gene expression detection under tomato leaf curl virus infection conditions in New Delhi.

[0088] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0089] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Application of internal reference gene in the quantitative detection of genes in Tobacco Bunsenii under Tomato Leaf Curl Virus stress in New Delhi, wherein the internal reference gene is the RBP2 gene, and the nucleotide sequence of the RBP2 gene is shown in SEQ ID NO:

1.

2. The application of the specific primers for the internal reference gene as described in claim 1 in the preparation of a gene quantitative detection kit for Tobacco Bunsen under Tomato Leaf Curl Virus stress in New Delhi, wherein the specific primers include a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer with a sequence as shown in SEQ ID NO:

3.

3. The application according to claim 2, characterized in that, The method for quantitative detection of the gene is qPCR or qRT-PCR.

4. A method for quantitative detection of genes in *Nicotiana bungeana* under *Tomato Leaf Curl Virus* stress in New Delhi, characterized in that... Includes the following steps: Using the cDNA of the target tobacco as a template, qPCR amplification was performed using the amplification primers of the target gene and the specific primers of the internal reference gene as described in claim 1. The specific primers include a forward primer with a sequence as shown in SEQ ID NO:2 and a reverse primer with a sequence as shown in SEQ ID NO:3.

Citation Information

Patent Citations

  • Visual detection method of New Delhi tomato leaf curl virus

    CN119332029A

  • KR20200126454A