KASP molecular marker related to quality character of brassica napus and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to brassica napus quality traits and application of the KASP molecular marker, and belongs to the technical field of molecular genetics. According to the KASP molecular marker related to the brassica napus quality traits, the primers of the KASP molecular marker and the application of the KASP molecular marker and the primers in brassica napus genetic typing or quality traits identification, results show that the KASP molecular marker can accurately identify genotypes, is high in sensitivity and specificity and effectively reduces the error rate. The invention also discloses a brassica napus genotyping / quality identification method, and the result shows that the material with the genotyping result of AA has the characteristics of low erucic acid content, low thioglycoside content, high oleic acid content, high linoleic acid content, low arachidonic acid content and low protein content; gG-type materials exhibit high erucic acid, high thioglycoside, low oleic acid, low linoleic acid, high arachidonic acid and high protein content. Individuals with excellent quality characters can be rapidly screened in early generations, and the long process of character identification after plant maturation in traditional breeding is avoided.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and in particular relates to a KASP molecular marker related to quality traits of Brassica napus and an application thereof. Background Art

[0002] Brassica napus L. is one of the important oil crops in my country, and its quality traits directly determine the nutritional value and industrial application value of rapeseed. In recent years, with the increase in people's demand for high-quality edible oils, simple "double-low" (low glucosinolate content, low erucic acid content) Brassica napus has been unable to meet people's demand for rapeseed oil, and achieving comprehensive Brassica napus quality synergistic improvement with high oleic acid, middle linoleic acid, middle linolenic acid, low erucic acid and low glucosinolates has become a new goal in the field of breeding. However, the main quality traits of Brassica napus, such as fatty acid composition, glucosinolate content and protein content, are typical quantitative traits, controlled by micro-effect polygenes, and these traits are significantly correlated. Traditional breeding methods are less efficient in improving these traits and are difficult to meet the needs of modern breeding. The present invention aims to explore the main effect sites that control the main quality traits of Brassica napus and provide a theoretical basis for Brassica napus quality trait breeding.

[0003] Marker-assisted selection (MAS) technology is a core technical means in the field of modern crop genetic improvement. Molecular markers can accurately reflect the difference information at the genomic level of individual organisms. Their greatest advantage is that they are not affected by environmental factors and can be easily detected and analyzed in the early stages of crop growth and development (even in the seed stage). There are many types of molecular markers, but early molecular marker methods have disadvantages such as high cost and low throughput. Competitive allele-specific PCR (KASP) has the characteristics of higher accuracy, higher efficiency, lower cost and high throughput, providing a more efficient, accurate and stable selection basis for crop breeding.

[0004] Related studies have identified quantitative trait loci (QTLs) associated with oleic acid and linolenic acid content, located on chromosomes A03 and C03, respectively; QTLs associated with linoleic acid content are distributed on chromosomes A01, A02, and C03; QTLs associated with erucic acid content are located on chromosomes A02, A07, A09, and C01; and QTLs associated with glucosinolate content are distributed on chromosomes A03, A09, and C02. Therefore, the development of a molecular marker for the coordinated improvement of key quality traits in Brassica napus (B. napus) provides theoretical support for future coordinated improvement of quality traits and molecular marker-assisted breeding in B. napus, which has important theoretical and practical significance. Summary of the Invention

[0005] In response to the aforementioned problems in the prior art, the present invention aims to provide KASP molecular markers associated with quality traits of Brassica napus. Another technical problem addressed by the present invention is the use of KASP molecular markers associated with quality traits of Brassica napus for the coordinated improvement of key quality traits of Brassica napus.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0007] A KASP molecular marker related to the quality traits of Brassica napus, wherein the SNP site corresponding to the KASP molecular marker is located at 55439761bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.

[0008] Application of KASP molecular markers related to quality traits of Brassica napus in genotyping or quality trait identification of Brassica napus.

[0009] The PCR amplification primers for the KASP molecular marker related to the quality traits of Brassica napus are characterized by comprising a forward primer 1, a forward primer 2 and a reverse primer, and the specific sequences are as follows:

[0010] Forward primer 1:

[0011] 5'-GAAGGTGACCAAGTTCATGCTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATA-3',

[0012] Forward primer 2:

[0013] 5'-GAAGGTCGGAGTCAACGGATTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATG-3',

[0014] Reverse primer:

[0015] 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'.

[0016] Application of PCR amplification primers for KASP molecular markers related to quality traits of Brassica napus in genotyping of Brassica napus, including:

[0017] 1) Extracting genomic DNA from leaves of Brassica napus to be identified;

[0018] 2) Using the extracted genomic DNA as a template, PCR amplification was performed using KASP molecularly labeled PCR amplification primers;

[0019] 3) Determine the genotype of Brassica napus based on the fluorescence detection results;

[0020] The fluorescence detection result is: if the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA, and if the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG.

[0021] Application of PCR amplification primers of KASP molecular markers related to quality traits of Brassica napus in the collaborative improvement of quality traits of Brassica napus, including:

[0022] 1) Extracting genomic DNA from leaves of Brassica napus to be identified;

[0023] 2) Using the extracted genomic DNA as a template, PCR amplification was performed using KASP molecularly labeled PCR amplification primers;

[0024] 3) Determine the quality traits of Brassica napus based on the fluorescence detection results;

[0025] The fluorescence detection results are as follows: if the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content and low protein content; if the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content and high protein content.

[0026] Application of KASP molecular markers related to quality traits of Brassica napus in genetic improvement of Brassica napus.

[0027] Application of PCR amplification primers for KASP molecular markers related to quality traits of Brassica napus in genetic improvement of Brassica napus.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1) This paper uses principal component analysis (PCA) to integrate 10 key quality traits in Brassica napus seeds into five principal components through dimensionality reduction. Each principal component is a linear combination of the original variables and is independent of each other. This not only preserves most of the original data but also makes the data structure clearer, facilitating subsequent genome-wide association analysis and screening for associated single nucleotide polymorphisms.

[0030] 2) The present invention has screened a KASP molecular marker and primer set associated with the quality traits of Brassica napus, which can accurately identify genotypes with high sensitivity and specificity, effectively reduce the error rate, accurately distinguish different genotypes, provide a reliable molecular basis for genetic improvement, and ensure the stable inheritance of excellent traits. It can quickly screen individuals with excellent quality traits in early generations, avoiding the long process of traditional breeding that requires waiting for plant maturity to identify traits, significantly shortening the breeding cycle, and accelerating the process of genetic resource improvement. It can also be applied to multiple fields such as genetic map construction, germplasm resource identification, and seed purity identification, providing comprehensive technical support for comprehensive research and improvement of Brassica napus, promoting the innovative development of breeding technology, and providing new genetic resources and theoretical basis for molecular-assisted breeding.

[0031] 3) The genotyping method of the present invention has a simple operation process, does not require gel electrophoresis and complex equipment, and only uses conventional fluorescent quantitative PCR instruments. Through PCR amplification and fluorescence detection, genotyping can be completed in a single sample addition, which reduces the operational difficulty, improves work efficiency, and facilitates large-scale testing and breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the phenotypic distribution and correlation analysis diagram of the main quality traits of Brassica napus;

[0033] Figure 2 Figure 2 is the load analysis diagram of the main quality traits of Brassica napus (A) and the principal component analysis results diagram (B);

[0034] Figure 3 The PC1 Manhattan plot (A) and QQ plot (B) of the main quality traits of Brassica napus, with arrows indicating significant SNP sites;

[0035] Figure 4 The molecular marker typing diagrams of some materials at the C03_55439761 locus of Brassica napus (A and B) and the significance analysis of the main quality traits (C);

[0036] Figure 5 This is the first-generation sequencing verification result diagram. The first-generation sequencing is reverse sequencing. The sequencing result is T and a single peak, indicating that the genotype is AA; the sequencing result is C and a single peak, indicating that the genotype is GG. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solutions and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0038] Example 1

[0039] 1. Materials

[0040] The research team utilized a natural population of 275 core accessions of Brassica napus (Brassica napus)—174 winter rapeseed accessions, 48 mid-winter rapeseed accessions, and 53 spring rapeseed accessions—as materials. These 275 accessions were planted in experimental fields at Huaiyin Normal University, managed similarly to field production. To ensure purity, sampled plants were bagged during flowering. After maturity, two plants from each strain were randomly selected, and the rapeseed seeds were harvested and thoroughly air-dried for testing of key quality traits.

[0041] 2. Phenotypic identification of main quality traits of Brassica napus

[0042] Using the built-in model of the near-infrared grain analyzer (FOSS INFRATECTM 1241ANALYZER), the 10 main quality traits of the seeds of this population in 2022, 2023 and 2024, including palmitic acid (C160), stearic acid (C180), oleic acid (C181), linoleic acid (C182), linolenic acid (C183), arachidic acid (C201), erucic acid (C221), thioglucosides (SGC), protein content (SOC) and fat content (SPC) were measured. Each sample was tested twice, and the average value was taken as the specific content of the quality traits of the sample.

[0043] The results are shown in Table 1. The average values of the ten main quality traits of this natural population were 3.69%, 2.03%, 41.31%, 17.42%, 9.10%, 7.38%, 19.70%, 101.17 μmol / g, 101.17 μmol / g, 101.17 μmol / g, 22.51% and 44.02%, respectively. The coefficients of variation were 0.17, 0.20, 0.55, 0.18, 0.12, 0.90, 1.09, 0.44, 0.10 and 0.07, respectively. The phenotypic variation was rich, which was suitable for genome-wide association analysis to locate loci and genes controlling quality traits.

[0044] Table 1 Variation analysis of 10 main quality traits of rapeseed seeds

[0045] Traits average value Standard deviation Kurtosis Skewness Minimum Maximum Confidence level (95.0%) Coefficient of variation C160 3.69 0.62 -0.87 -0.35 1.69 5.08 0.07 0.17 C180 2.03 0.40 9.05 0.44 0.00 4.25 0.05 0.20 C181 41.31 22.62 -1.65 -0.33 5.56 72.91 2.58 0.55 C182 17.42 3.15 -0.97 -0.19 8.08 24.68 0.36 0.18 C183 9.10 1.08 2.28 -0.04 3.65 12.34 0.12 0.12 C201 7.38 6.63 -1.56 0.37 -1.08 19.08 0.76 0.90 C221 19.70 21.51 -1.67 0.38 -2.15 56.56 2.46 1.09 SOC 44.02 2.96 9.97 -1.59 22.07 51.46 0.34 0.07 SGC 101.17 44.36 -1.18 -0.46 15.49 184.00 5.07 0.44 SPC 22.51 2.26 1.94 -0.10 11.26 30.03 0.26 0.10

[0046] 3. Group analysis and positioning

[0047] Whole-genome resequencing of 275 Brassica napus accessions was performed using the Illumina sequencing platform. Reads from the resequencing data were aligned to the Darmor v4.1 reference genome, and 2,290,799 high-quality SNPs with a minimum allele frequency (MAF) greater than 5% and a missingness rate less than 50% were identified.

[0048] 4. Principal component analysis of main quality traits of Brassica napus

[0049] Seeds of the population were collected from 2022 to 2024, and 10 quality-related traits were evaluated and subjected to principal component analysis.

[0050] The results are as follows Figure 1 and Figure 2 As shown, different traits have different degrees of correlation ( Figure 1 ). The first principal component (PC1) explained 57.3% of the phenotypic variation, and its main contributing traits covered seven traits: palmitic acid, stearic acid, oleic acid, linoleic acid, arachidonic acid, erucic acid, and glucosinolates. The high loadings of these traits in PC1 indicated that they had a significant effect on the phenotypic variation of Brassica napus, and there was a strong correlation between them. Among them, oleic acid was positively correlated with palmitic acid, stearic acid, and linoleic acid, and negatively correlated with erucic acid, arachidonic acid, and glucosinolates. This shows that the increase in oleic acid content is accompanied by an increase in the content of palmitic acid, stearic acid, and linoleic acid, while inhibiting the accumulation of erucic acid, arachidonic acid, and glucosinolates. The second principal component (PC2) explained 17.9% of the phenotypic variation, and its main contributing traits were linolenic acid, protein content, and fat content. Among them, fat content was negatively correlated with linolenic acid and protein content ( Figure 2 ).

[0051] 5. Genome-wide association analysis based on principal component analysis

[0052] We selected the first five principal components with the highest contributions and conducted a genome-wide association analysis using the MLM model built into GAPIT. In principal component analysis, the first principal component, as the comprehensive indicator with the largest contribution to variance, best reflects the variation in the original data. Highly loaded traits in PC1 were palmitic acid, stearic acid, oleic acid, linoleic acid, arachidic acid, erucic acid, and glucosinolates, all of which significantly influence the phenotypic variation in Brassica napus.

[0053] The results are as follows Figure 3As shown, through comprehensive analysis of the Manhattan plot and QQ plot of PC1 in the genome-wide association analysis, a SNP site that is stable across multiple environments was located on chromosome C03, with a p-value far below the threshold (P < 9.54E-07). This molecular marker is located at bp 55439761 on chromosome C03 of the Brassica napus genome, and the single nucleotide polymorphism is A / G. The specific nucleotide sequence is:

[0054] CTGTTCTTACTTATATGAAAATAATAAATGTATGTTGAAAATCAAACGTA TTATTATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGAT[A / G]TGTACTTTTAACAGATAATAACAAGTGCACAGAGAACTTTTCAAATAAGACT GTGAGCGCAACTTGTCACATTTCTTTTTGCATTGGATAAAATAACAAT, wherein [A / G] is a single nucleotide polymorphism site, when A is a single nucleotide polymorphism site, the specific nucleotide sequence is shown in SEQ ID NO.1, and when G is a single nucleotide polymorphism site, the specific nucleotide sequence is shown in SEQ ID NO.2.

[0055] 6. KASP molecular marker development and validation

[0056] Targeting the located SNP site, KASP molecular marker primer sequences were designed using SnapGene software. These include two specific primers (forward primer 1 and forward primer 2) and one universal primer (reverse primer). The 5' end of the nucleotide sequence of forward primer 1 contains the fluorescent group FAM (underlined portion), and the 5' end of the nucleotide sequence of forward primer 2 contains the fluorescent group HEX (underlined portion). The specific primer sequences and fluorescent groups are as follows:

[0057] Forward primer 1:

[0058] 5'- GAAGGTGACCAAGTTCATGCT ATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATA-3',

[0059] Forward primer 2:

[0060] 5'- GAAGGTCGGAGTCAACGGATT ATTATAATACTCTTTTCTTATTATTAAATTGAACTTATTAGAGATG-3',

[0061] Reverse primer:

[0062] 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'.

[0063] A total of 275 Brassica napus accessions were identified. Genomic DNA was obtained using the CTAB (cetyltrimethylammonium bromide) method for crude DNA extraction. This DNA was used as a template and a three-primer mixture, SNP Primer Mix (forward primer 1, forward primer 2, reverse primer, and ddH2O, in a volume ratio of 6:6:15:23), was used for PCR amplification and fluorescence detection using a fluorescence quantitative PCR instrument. The amplification system consisted of 5 μL of HiGeno 2× Probe Mix, 0.14 μL of 100 μmol / L SNP Primer Mix, 1 μL of 20–30 ng of genomic DNA, and 4 μL of ultrapure water. The amplification program is as follows: 10 minutes of initial denaturation at 95°C; 20 seconds of denaturation at 95°C, 40 seconds of annealing and extension at 61-55°C, with the annealing temperature decreasing by 0.6°C each cycle, for a total of 10 cycles; 30 cycles of 20 seconds of denaturation at 95°C, 40 seconds of annealing and extension at 55°C, and a final extension at 25°C for 1 minute. If the expression level is low as determined by fluorescence typing, the program can be continued with 6 cycles of 20 seconds of denaturation at 95°C, 40 seconds of annealing and extension at 55°C, and a final extension at 30°C for 30 seconds. After completion of the reaction, the fluorescence typing results are automatically generated as an image. If the fluorescent signal corresponding to the forward primer F1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content (C22:1<4%), low glucosinolate content (SGC<90 μmol / g), high oleic acid content (C18:1>55%), high linoleic acid content (C18:2>17%), low arachidonic acid content (C20:1<4%) and low protein content (SPC<22.5%); if the fluorescent signal corresponding to the forward primer F2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content (C22:1>30%), high glucosinolate content (SGC>110 μmol / g), low oleic acid content (C18:1<20%), low linoleic acid content (C18:2<15%), high arachidonic acid content (C20:1>12%) and high protein content (SPC>22.5%).

[0064] The results are as follows Figure 4 As shown, the KASP marker can accurately distinguish individuals with different genotypes, among which 176 materials have the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content and low protein content (AA), and 99 materials have the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content and high protein content (GG). The differences in each trait between individuals with different genotypes are extremely significant (p < 0.001).

[0065] 7. First-generation sequencing verification

[0066] Ten randomly selected Brassica napus accessions were used to verify the Brassica napus genotyping results using Sanger sequencing. Genomic DNA from the leaves of the Brassica napus to be identified was used as a template, and sequencing primers were designed using SnapGene software for PCR amplification. The primer sequences were:

[0067] Forward primer: 5'-ATAAATGTATGTTGAAAATCAAACG-3',

[0068] Reverse primer: 5′-TTTTATCCAATGCAAAAAGAAATGT-3′.

[0069] The amplification system consisted of 10 μL of 2× Taq Master Mix, 0.1 μL each of forward and reverse primers, 1 μL of genomic DNA, and 8.8 μL of ultrapure water. The amplification procedure was as follows: initial denaturation at 94°C for 3 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for 10 min, followed by storage at 16°C. The PCR amplification product was subjected to agarose gel electrophoresis. After verification of the PCR product on a 1% agarose gel, the PCR amplification product and reverse primer were sent to Anhui General Biotechnology Co., Ltd. for reverse sequencing.

[0070] The results are as follows Figure 5 As shown, the sequencing results were consistent with the KASP marker results, verifying the accuracy of the KASP marker results.

[0071] The above description is only illustrative of the present invention and not restrictive. Those skilled in the art will understand that many modifications, changes or equivalents may be made without departing from the spirit and scope defined by the appended claims, but all of them will fall within the scope of protection of the present invention.

Claims

1. KASP molecular markers related to quality traits of Brassica napus, characterized in that: The SNP site corresponding to the KASP molecular marker is located at 55439761bp on chromosome C03 of the Brassica napus genome, and its single nucleotide polymorphism site is A / G.

2. Use of the KASP molecular marker according to claim 1 in genotyping or quality trait identification of Brassica napus.

3. The PCR amplification primers for the KASP molecular marker according to claim 1, characterized in that: It includes forward primer 1, forward primer 2 and reverse primer, and the specific sequences are as follows: Forward Primer 1: 5’- GAAGGTGACCAAGTTCATGCTATTATAATACTCTTTTCTTATTATTAAATTGA ACTTATTAGAGATA-3', Forward primer 2: 5’- GAAGGTCGGAGTCAACGGATTATTATAATACTCTTTTCTTATTATTAAATTGA ACTTATTAGAGATG-3', Reverse primer: 5'-TTATTTGAAAAGTTCTCTGTGCACTTGTTATTATCTGTTAAAA-3'.

4. Use of the PCR amplification primers according to claim 3 in genotyping of Brassica napus.

5. A method for genotyping Brassica napus, characterized in that: include: 1) Extracting genomic DNA from leaves of Brassica napus to be identified; 2) Using the extracted genomic DNA as a template, PCR amplification was performed using KASP molecularly labeled PCR amplification primers; 3) Determine the genotype of Brassica napus based on the fluorescence detection results; The fluorescence detection result is: if the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA, and if the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG.

6. The method according to claim 5, characterized in that When the genotyping result is AA, it indicates that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content and low protein content; the genotyping result is GG, which indicates that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content and high protein content.

7. Use of the PCR amplification primers according to claim 3 in identifying quality traits of Brassica napus.

8. A method for identifying quality traits, characterized in that: include: 1) Extracting genomic DNA from leaves of Brassica napus to be identified; 2) Using the extracted genomic DNA as a template, PCR amplification was performed using KASP molecularly labeled PCR amplification primers; 3) Determine the quality traits of Brassica napus based on the fluorescence detection results; The fluorescence detection results are as follows: if the fluorescence signal corresponding to the forward primer F1 is detected, the genotyping result is AA, indicating that the material has the characteristics of low erucic acid content, low glucosinolate content, high oleic acid content, high linoleic acid content, low arachidonic acid content and low protein content; if the fluorescence signal corresponding to the forward primer F2 is detected, the genotyping result is GG, indicating that the material has the characteristics of high erucic acid content, high glucosinolate content, low oleic acid content, low linoleic acid content, high arachidonic acid content and high protein content.

9. Use of the KASP molecular marker according to claim 1 in genetic improvement of Brassica napus.

10. Use of the PCR amplification primers according to claim 3 in genetic improvement of Brassica napus.

Images