Application of reagent for detecting RNF41 gene methylation level in preparation of liver cirrhosis diagnosis or auxiliary diagnosis product, detection kit and system

Abstract

The invention relates to the technical field of biomedicine, in particular to application of a reagent for detecting the methylation level of an RNF41 gene in preparation of products for liver cirrhosis diagnosis or auxiliary diagnosis, a detection kit and a system. In the application, the RNF41 gene refers to a specific CpG island in a RNF41 promoter region; the liver cirrhosis is hepatitis B related decompensated liver cirrhosis. According to the present invention, the high methylation state of the corresponding site region of the RNF41 gene promoter in the hepatitis B related compensatory liver cirrhosis patient is determined for the first time, such that the methylation degree of the corresponding site region of the RNF41 gene promoter is prompted to be closely related to the diagnosis of the hepatitis B related early liver cirrhosis patient; and occurrence and development of hepatitis B related compensatory liver cirrhosis can be prompted, so that clinical diagnosis is assisted.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an application of a reagent for detecting the methylation level of the RNF41 gene in preparing a liver cirrhosis diagnosis or auxiliary diagnosis product, a detection kit, and a system. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Liver cirrhosis (LC) is a common, chronic, progressive liver disease clinically caused by one or more etiologies. Pathologically, LC manifests as excessive deposition of collagen and other extracellular matrix proteins, scarring, and regenerative nodules replacing normal liver architecture. Despite improvements in hepatitis B vaccination coverage and the increased availability of effective antiviral drugs, chronic hepatitis B virus (CHB) infection remains the most important risk factor for the development of cirrhosis. CHB refers to chronic inflammatory liver disease caused by persistent infection with the hepatitis B virus (HBV), also known as chronic hepatitis B. Cirrhosis is the terminal state of various chronic liver diseases and can be divided into compensated and decompensated cirrhosis based on liver function and disease severity. Decompensated cirrhosis is characterized by portal hypertension and hepatic insufficiency, which can lead to serious complications, the most common of which are gastrointestinal bleeding, ascites, hepatic encephalopathy, and cancer. However, compensated cirrhosis typically lacks specific clinical symptoms or signs, and liver function test results are often suboptimal. Diagnosis often relies on imaging studies, with liver biopsy or laparoscopy as the diagnostic tool when necessary. Therefore, early diagnosis of LC urgently requires effective biomarkers, and timely and effective diagnosis to slow disease progression remains a medical challenge. Therefore, uncovering the mechanisms of hepatitis B-related cirrhosis, establishing effective comprehensive assessment and diagnostic criteria, and developing effective prevention and treatment strategies are of great significance.

[0004] Epigenetic regulation, a key regulatory paradigm, controls gene expression without altering DNA sequence or genetic information. It primarily includes DNA methylation, histone modification, and the expression of noncoding RNAs. DNA methylation has become a cornerstone of epigenetic regulation, playing a crucial role in the development of liver cirrhosis and becoming a research hotspot in the medical field. DNA methylation is the process by which DNA methyltransferases (DNMTs) catalyze the conversion of cytosine (C) adjacent to guanine (G) in DNA (CpG dinucleotides) to 5'-methylcytosine, using S-adenosylmethionine (SAM) as a methyl donor. Methylation in gene promoter regions can inhibit transcription, thereby affecting cell- and tissue-specific gene expression. Studies have shown that DNMT expression is upregulated in hosts infected with HBV (hepatitis B virus). Therefore, HBV may enhance DNMT activity, promoting methylation of viral DNA promoters, thereby inhibiting viral DNA transcription and, consequently, viral replication.

[0005] Patients with cirrhosis exhibit varying degrees of liver fibrosis. Fibrosis and inflammatory injury play a crucial role in the development and progression of cirrhosis. Ring finger protein 41 (RNF41) is an important E3 ubiquitin-protein ligase that specifically degrades multiple proinflammatory cytokine receptors, adaptors, and kinases through ubiquitination. Studies have shown that RNF41 expression is significantly downregulated in both patients with cirrhosis and mouse models of liver fibrosis, suggesting a key role in liver fibrosis and regeneration. RNF41 promotes the phenotypic transition of macrophages from a proinflammatory to an anti-inflammatory state through the C / EBP-β / PPAR-γ signaling pathway. These anti-inflammatory macrophages subsequently release IGF-1, stimulating hepatocyte proliferation and hepatic stellate cell (HSC) inactivation. However, existing studies have only suggested low RNF41 mRNA expression in cirrhotic livers. Tissue environment is a major determinant of cellular gene expression, and changes in the tissue environment can influence the expression of corresponding genes. Whether RNF41 methylation is associated with cirrhosis remains unknown. Hypoxia, inflammatory factors, and changes in metabolites can significantly affect cellular methylation levels through various mechanisms (such as enzyme activity regulation and epigenetic modification). There is uncertainty about the relationship between gene expression levels in different tissue environments and their methylation status and methylation levels. The epigenetic characteristics of liver cells are shaped by the local liver microenvironment over a long period of time. Methylation patterns are relatively stable, but they exhibit plasticity under disease or environmental exposure. Furthermore, CpG islands refer to regions of the genome that are 300 to 3000 bp long and are rich in CpG dinucleotides. These regions are primarily located in gene promoters and exons. The effect of promoter CpG island methylation on transcriptional activity is related to factors such as the distribution of gene CpG islands, histone modifications, and cell type, and is site-specific. However, multiple CpG islands exist in promoter regions, and methylation at not all sites significantly affects gene transcriptional activity.

[0006] Currently, accurate diagnosis of cirrhosis requires a liver biopsy. However, due to its invasive nature, clinical diagnosis often relies on decompensated symptoms combined with imaging studies such as transient elastography (TE). However, early diagnosis of cirrhosis is difficult. TE accuracy may be affected by various factors, such as obesity, the presence of ascites, and proficiency of the operator.

[0007] Patent 2019110040934 discloses the use of CpG site methylation levels to detect markers for compensated cirrhosis, and mentions multiple methylation sites related to compensated cirrhosis. However, since this scheme detects methylation levels at multiple specific sites across the entire genome in determining compensated cirrhosis, the operation is complex and requires higher experimental conditions. In addition, based on the same disease, there is no predictable correlation between the methylation level of the entire genome and the methylation of specific genes. Summary of the Invention

[0008] The present invention provides the use of a reagent for detecting the methylation level of the RNF41 gene in the preparation of a liver cirrhosis diagnosis or auxiliary diagnosis product, a detection kit and a system. It is the first time to clarify that the corresponding site region of the RNF41 gene promoter is in a high methylation state in patients with hepatitis B-related compensated cirrhosis, indicating that the methylation level of the corresponding site region of the RNF41 gene promoter is closely related to the diagnosis of patients with hepatitis B-related early liver cirrhosis; by quantitatively detecting the methylation degree of the RNF41 gene promoter, it can indicate the occurrence and development of hepatitis B-related compensated liver cirrhosis, thereby assisting clinical diagnosis. It is a more effective biomarker for early, timely and accurate diagnosis, facilitates more effective treatment, and solves the problems existing in the prior art.

[0009] One of the technical solutions adopted by the present invention is:

[0010] Provided is the use of a reagent for detecting the methylation level of the RNF41 gene in the preparation of a liver cirrhosis diagnosis or auxiliary diagnosis product, wherein the RNF41 gene methylation level refers to the methylation level of a specific CpG island in the RNF41 promoter region; the liver cirrhosis is hepatitis B-related compensated liver cirrhosis.

[0011] After extensive and in-depth research, the present invention analyzed the methylation status of the DNA gene promoters of peripheral blood mononuclear cells of multiple patients with hepatitis B-related compensated liver cirrhosis (HBV-CLC), chronic hepatitis B (CHB) and normal people (HC), and performed correlation analysis with the patient's non-invasive diagnostic marker LSM. It was found that the promoter methylation level of the RNF41 gene is closely related to the progression of hepatitis B-related liver cirrhosis. The RNF41 gene promoter is in a high methylation state in patients with early liver cirrhosis. The analysis of the methylation status of the RNF41 promoter in the peripheral blood mononuclear cell DNA of patients with hepatitis B-related liver cirrhosis and chronic hepatitis B is helpful to assist clinicians in identifying patients with chronic hepatitis B who may progress to hepatitis B-related liver cirrhosis, so as to play an earlier diagnosis and guide treatment. Therefore, the above application can be used to monitor or predict the progression of chronic hepatitis B patients to hepatitis B-related liver cirrhosis.

[0012] Furthermore, RNF41 gene methylation refers to CpG island methylation in the range of 521-933bp in the RNF41 promoter region; the reagent is a reagent for detecting the methylation level of CpG island in the range of 521-933bp in the RNF41 promoter region; when the RNF41 gene is highly methylated, the subject suffers from hepatitis B-related compensated cirrhosis.

[0013] Furthermore, the aforementioned high methylation refers to an RNF41 methylation rate ≥ 16.138%.

[0014] Furthermore, the samples used for detection are peripheral blood mononuclear cells.

[0015] Furthermore, the reagents include primers, probes, antibodies or nucleic acid chips.

[0016] Furthermore, the reagents include an RNF41 primer pair and an RNF41-Taqman fluorescent probe for detecting the methylation level of the RNF41 gene by quantitative methylation-specific PCR.

[0017] Furthermore, the RNF41 primer pair includes: RNF41-upstream primer, as shown in SEQ ID NO.1; RNF41-downstream primer as shown in SEQ ID NO.2; and the RNF41-Taqman fluorescent probe as shown in SEQ ID NO.3.

[0018] SEQ ID NO. 1: 5'GGTTGGTTTCGGATTTATGATTTTA 3'.

[0019] SEQ ID NO. 2: 5'AACAAAACTCCTTTACCGAAATAA 3'.

[0020] SEQ ID NO. 3: 5'ACCAAATACAACGACTCACGCCTAATCCT 3'.

[0021] Furthermore, the RNF41-Taqman fluorescent probe is provided with a fluorescent group and a quenching group at the 5' end and the 3' end, respectively. The fluorescent group may be FAM, and the quenching group may be MGB.

[0022] Furthermore, the product is a detection kit.

[0023] The present invention also provides the use of a marker for detecting hepatitis B-related compensated cirrhosis using the methylation level of the RNF41 gene in the preparation of a kit for detecting hepatitis B-related compensated cirrhosis. The marker is a CpG island of a 521-933bp fragment in the promoter region of the RNF41 gene. By detecting the methylation level of the RNF41 CpG island, it is determined whether the patient has hepatitis B-related compensated cirrhosis.

[0024] The second technical solution adopted by the present invention is:

[0025] Provided is a detection kit comprising the methylation-specific RNF41 primer pair and RNF41-Taqman fluorescent probe of the gene RNF41 promoter as described above.

[0026] Furthermore, the detection kit also includes an internal reference gene-specific primer pair and an internal reference gene Taqman fluorescent probe; the internal reference gene-specific primer pair includes an ACTB-upstream primer, as shown in SEQ ID NO.4; an ACTB-downstream primer, as shown in SEQ ID NO.5; and an ACTB-Taqman fluorescent probe as shown in SEQ ID NO.6.

[0027] SEQ ID NO. 4: 5'TGGTGATGGAGGAGGTTTAGTAAGT 3'.

[0028] SEQ ID NO. 5: 5'AACCAATAAAAACCTACTCCTCCCTTAAA 3'.

[0029] SEQ ID NO. 6: 5'ACCACCACCCAACACACAATAACAAACACA 3'.

[0030] Furthermore, the ACTB-Taqman fluorescent probe is provided with a fluorescent group and a quenching group at the 5' end and the 3' end, respectively. The fluorescent group may be FAM, and the quenching group may be BHQ1.

[0031] Furthermore, the detection kit also includes a positive control and a negative control; the positive control is 100% methylated human genomic DNA modified with bisulfite; and the negative control is high-pressure double-distilled water.

[0032] Furthermore, the detection kit also includes a reagent for extracting genomic DNA from a sample (blood, including peripheral blood), a reagent for bisulfite modification of the sample genomic DNA, and a premixed PCR reaction system solution.

[0033] Furthermore, the gene sequence of 521-933 bp of the RNF41 promoter region is shown in SEQ ID NO.7:

[0034] 5'CTGGTACTACAGGTTCGCACTACCACCCTCGGCTAATTTCTGTATTT TTTTTGTAGAGACAGTTTCGCCATGTTTCCCAGGCTGGTCTCGGACTCATGACCTCAAGGGATCCGCCCACCTCGTCCTCCCAAAGTGCTAGGATTACAGGCGTGAGCCGCTGCACCTGGCCATACTACTCTTCCCCGCCCCGCCCCACCGCTCCACCCCGGCAAAGGAGTCTTGCTCTGTCGCCC AGGTTGGAGTGCAGTGGCGCGATCTCGGCTCACTGCAATGCAACCTCTGCCTCCCGGGTTCAAGCGATTCTCCTGTCTCAGCCTCCCGAGTAGCTGGGATTACAGGCGCCCGCCACCACGCCCGGCTACTTTTTTTGTATTTTTAGTAGAGACGGGGTTTCACCACGTTGGCCAGCCTGGGCTC3'.

[0035] The third technical solution adopted by the present invention is:

[0036] Provided is a system for diagnosing or assisting in the diagnosis of early-stage liver cirrhosis. The system comprises a quantitative detection unit for quantitatively detecting the DNA methylation level of the CpG island in the promoter region of RNF41 in a sample, and an analysis unit. The quantitative detection unit uses the above-described detection kit to perform real-time quantitative methylation-specific polymerase chain reaction. The analysis unit performs analysis based on the results obtained by the quantitative detection unit. When the RNF41 methylation rate is ≥16.138%, the subject is judged to have compensated hepatitis B cirrhosis.

[0037] The beneficial effects of the present invention include but are not limited to:

[0038] 1. The present invention uses real-time quantitative methylation-specific PCR based on Taqman fluorescent probes to track PCR products using fluorescently labeled Taqman fluorescent probes, reflecting the methylation-specific PCR process in real time and analyzing the methylation-specific PCR products to obtain the initial template amount of the sample to be tested. It can detect extremely small amounts of DNA in human peripheral blood mononuclear cells with high sensitivity and specificity, and is suitable for detecting specimens with low DNA content and high loss rate.

[0039] Compared with the methylation-specific polymerase chain reaction (MSP-PCR) qualitative detection method, the above-mentioned real-time quantitative methylation-specific PCR detection method based on Taqman fluorescent probe (Methylight) can eliminate nonspecific amplification, better avoid the influence of DNA contamination on the results, and ensure the specificity of the detection results.

[0040] 2. Based on existing studies that only suggest low RNF41 mRNA expression in cirrhotic livers, this study explored a direct correlation between cirrhosis, particularly compensated hepatitis B cirrhosis, and RNF41 promoter methylation levels in peripheral blood samples. Specifically, using 190 clinical samples, the study demonstrated a correlation between CpG island methylation levels within the 521-933bp region of the RNF41 promoter and compensated hepatitis B cirrhosis. This provides an effective and accurate approach for the early diagnosis of cirrhosis in clinical practice.

[0041] 3. The test sample of the present invention is obtained from the peripheral blood of a subject (e.g., a patient with hepatitis B-related compensated cirrhosis), which is convenient to obtain, easy to operate, and minimally invasive to the patient. The kit assembly has the advantages of easy sample collection, rapid detection, and accurate results compared to other detection technologies. It can serve as an aid for clinical physicians in the early diagnosis of patients with hepatitis B-related cirrhosis, has far-reaching clinical significance, and is suitable for large-scale promotion and application. Using a single kit, the entire process from blood sampling to quantitative detection of the methylation level of the RNF41 gene, which is relevant to the diagnosis of cirrhosis, can be completed. This is convenient, fast, and applicable, and has excellent practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Schematic diagram of target CpG selection in the promoter region of RNF41 gene of the present invention;

[0043] Figure 2 This is a comparison of the methylation levels of the RNF41 gene promoter in patients with hepatitis B-related compensated cirrhosis, patients with chronic hepatitis B, and healthy volunteers in the embodiments of the present invention;

[0044] Figure 3 Schematic diagram of the specific detection results of liver cirrhosis by qPCR in an embodiment of the present invention; wherein the ordinate represents the corrected fluorescence intensity value, the abscissa represents the number of cycles of fluorescence quantitative amplification, and the CT value represents the number of cycles required to reach the threshold line; RNF41 represents the methylation detection result of a liver cirrhosis-positive sample; ACTB amplification indicates that the sample content is normal;

[0045] Figure 4 The correlation between the methylation rate of the RNF41 gene promoter and the LSM detection coefficient in patients with liver cirrhosis in the embodiment of the present invention; wherein PMR: methylation rate; LSM: liver stiffness value;

[0046] Figure 5The figure shows the quantitative degree of methylation of the RNF41 gene promoter and the receiver operating characteristic curve of LSM used to judge the condition of patients with liver cirrhosis in the embodiment of the present invention; Sensitivity: sensitivity; Specificity: specificity. DETAILED DESCRIPTION

[0047] To clearly illustrate the technical features of this solution, the present invention is described in detail below through specific embodiments with reference to the accompanying drawings. It should be noted that the following detailed description is illustrative and is intended to further illustrate the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art to which this invention belongs.

[0048] As a typical embodiment of the present invention, a reagent for detecting methylation levels in the RNF41 gene promoter region is provided for use in the preparation of a diagnostic or auxiliary diagnostic product for liver cirrhosis. Methylation in the RNF41 gene promoter region refers to methylation of specific CpG islands in the RNF41 promoter region; the liver cirrhosis is hepatitis B-related compensated liver cirrhosis. The test sample is peripheral blood from the subject.

[0049] The above reagents can be used to detect the methylation level of the RNF41 gene using a real-time quantitative methylation-specific PCR detection method. Compared to the qualitative detection method of methylation-specific polymerase chain reaction (MSP-PCR), the real-time quantitative methylation-specific PCR detection method of the present invention can eliminate nonspecific amplification, better avoid the impact of DNA contamination on the results, and ensure the specificity of the test results.

[0050] After extensive and in-depth research, the present invention analyzed the methylation status of the DNA gene promoters in peripheral blood mononuclear cells of multiple patients with hepatitis B-related compensated liver cirrhosis (HBV-CLC), chronic hepatitis B (CHB) and normal subjects (HC), and conducted correlation analysis with the patients' non-invasive diagnostic markers (LSM). It was found that the promoter 521-933bp fragment of the RNF41 gene (such as Figure 1 The methylation status of the target CpG) in the RNF41 promoter is closely related to the progression of hepatitis B-related cirrhosis. Analysis of the methylation status of the RNF41 promoter in the peripheral blood mononuclear cell DNA of patients with hepatitis B-related cirrhosis and chronic hepatitis B can help clinicians identify patients with chronic hepatitis B who may progress to hepatitis B-related cirrhosis, so as to play a role in early diagnosis and guidance of treatment.

[0051] Another specific embodiment of the present invention provides a detection kit, which includes a methylation-specific primer pair and a Taqman fluorescent probe targeting the 521-933 bp fragment of the promoter region of the target gene RNF41; the specific sequence is as follows:

[0052] RNF41-upstream primer: 5′GGTTGGTTTCGGATTTATGATTTTA 3′ (SEQ ID NO. 1);

[0053] RNF41-downstream primer: 5'AACAAAACTCCTTTACCGAAATAA 3' (SEQ ID NO. 2);

[0054] RNF41-Taqman fluorescent probe: 5'

[0055] ACCAAATACAACGACTCACGCCTATAATCCT 3' (SEQ ID NO. 3);

[0056] The RNF41-Taqman fluorescent probe is provided with a fluorescent group and a quenching group at the 5' end and the 3' end, respectively. The fluorescent group is FAM and the quenching group is MGB.

[0057] The above detection kit may also include a specific primer pair and a Taqman fluorescent probe for an internal reference gene; the internal reference gene may be ACTB, the specific sequence of which is as follows:

[0058] ACTB-upstream primer: 5'TGGTGATGGAGGAGGTTTAGTAAGT 3' (SEQ ID NO. 4);

[0059] ACTB-downstream primer: 5'AACCAATAAAACCTACTCCTCCCTTAAA 3' (SEQ ID NO. 5);

[0060] ACTB-Taqman fluorescent probe: 5'

[0061] ACCACCACCCAACACACAATAACAAACACA 3' (SEQ ID NO. 6).

[0062] Similarly, the ACTB-Taqman fluorescent probe is provided with a fluorescent group and a quencher group at the 5' end and the 3' end, respectively. The fluorescent group is FAM and the quencher group is BHQ1.

[0063] To facilitate quality control, the test kit also includes positive and negative controls. The positive control is bisulfite-modified, 100% methylated human genomic DNA; specifically, DNA extracted from healthy human leukocytes, methylated in vitro with CpG methyltransferase, and then modified with bisulfite. The negative control is high-pressure double-distilled water.

[0064] Furthermore, the detection kit also includes reagents for extracting genomic DNA from blood (such as peripheral blood), reagents for bisulfite modification of genomic DNA, premixed PCR reaction system liquid, etc. The above reagents can be completed using existing products and will not be repeated here.

[0065] As another specific embodiment of the present invention, a system for diagnosing or assisting in the diagnosis of liver cirrhosis is provided, the system comprising a quantitative detection unit and an analysis unit; wherein the quantitative detection unit comprises: performing a real-time quantitative methylation-specific polymerase chain reaction using the above-mentioned detection kit; and the analysis unit comprises analyzing the results obtained by the quantitative detection unit, detecting the degree of methylation of the DNA promoter of RNF41 in the sample to be tested, and judging the condition of the subject.

[0066] Specifically, the methylation degree of the RNF41 promoter was calculated according to the following formula:

[0067] Methylation rate=100%×2exp.[ΔCt(sample RNF41 Ct value−sample ACTB Ct value)−ΔCt(positive control RNF41 Ct value−positive control ACTB Ct value)].

[0068] The above methylation rate (PMR) ≥ 16.138% was defined as a positive result (hypermethylation) and diagnosed as hepatitis B-related compensated cirrhosis; PMR < 16.138% was defined as a negative result (hypomethylation) and could not be diagnosed as hepatitis B-related compensated cirrhosis.

[0069] The technical solutions of the present invention will be described in detail below with reference to specific embodiments. The equipment, raw materials, and reagents used are all commercially available or commonly used in the art. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art.

[0070] The present invention collected 105 cases of hepatitis B-related compensated cirrhosis patients, 50 cases of chronic hepatitis B patients, and 35 healthy volunteers. The cases were collected from Qilu Hospital of Shandong University. The case details are shown in Table 1:

[0071] Table 1: Case details

[0072]

[0073] Peripheral blood samples were collected from the above patients, and peripheral blood mononuclear cell genomic DNA was extracted, DNA concentration was measured, bisulfite conversion was performed, and real-time quantitative methylation-specific PCR reaction system, reaction conditions, and methylation degree calculation were performed.

[0074] 1. DNA Extraction

[0075] After drawing blood from a patient, DNA can be extracted from the patient using the following procedures, or other methods can be used to extract DNA.

[0076] (1) Prepare reagents: TRIzol reagent, ethanol, sodium citrate, sodium hydroxide, chloroform, Tris-EDTA solution, and HEPES;

[0077] (2) Collect cells by centrifugation, each (5-10) × 10 6 Add 1 ml of TRIzol to the peripheral blood mononuclear cells and pipette repeatedly. Place at room temperature (15-30°C) for 5 minutes to completely separate the nucleic acid-protein complex.

[0078] (3) Add 0.3 ml of chloroform to every 1 ml of TRIzol, shake vigorously for 30 seconds, and let stand at room temperature for 2 minutes;

[0079] (4) Centrifuge at 12,000 × g for 15 minutes at 2-8°C. The sample separates into three layers: a red organic phase at the bottom, a colorless aqueous phase at the top, and an intermediate layer.

[0080] (5) Remove the upper aqueous phase and precipitate the DNA in the intermediate and organic phases with ethanol. For every 1 ml of TRIzol, add 0.3 ml of anhydrous ethanol and mix thoroughly. Incubate at room temperature for 3 minutes and centrifuge at 14,800 × g for 5 minutes at 2-8°C.

[0081] (6) Remove the supernatant and wash the DNA precipitate with 0.1 mol / L sodium citrate containing 10% ethanol. For every 1 ml of TRIzol, add 1 ml of 0.1 mol / L sodium citrate (containing 10% ethanol), shake at room temperature for 30 minutes, centrifuge at 14,800 × g for 5 minutes at 2-8°C, discard the supernatant, and repeat twice.

[0082] (7) Wash the DNA pellet again with 75% ethanol. For every 1 ml of TRIzol, add 1.5–2 ml of 75% ethanol, shake at room temperature for 10–20 min, centrifuge at 14,800 × g for 5 min at 2–8°C, discard the supernatant, and repeat once.

[0083] (8) Wash the DNA pellet again with anhydrous ethanol. For every 1 ml of TRIzol, add 1.5-2 ml of anhydrous ethanol, shake at room temperature for 10-20 minutes, centrifuge at 14,800 × g for 5 minutes at 2-8°C, discard the supernatant, and repeat once.

[0084] (9) Let the DNA dry at room temperature for 5-15 minutes, and dissolve it with 8mmol / L sodium hydroxide. 7The DNA isolated from each cell is dissolved in 300-600 μl of 8 mmol / L sodium hydroxide. The concentration of DNA is usually 0.2-0.3 μg / μl. After dissolving the DNA, the pH can be adjusted to about 7.5 with Tris-EDTA solution and HEPES to obtain DNA extracted from the sample peripheral blood mononuclear cells.

[0085] 2. Bisulfite modification

[0086] Methylate the genomic DNA using bisulfite to convert unmethylated cytosine into uracil for use as an amplification template. This involves treating and converting the extracted genomic DNA sample with bisulfite (using the EZ DNA Methylation-Gold Kit, catalog number: D5005). The steps are as follows:

[0087] (1) Prepare the transformant: add 900 μl of water, 300 μl of dilution buffer, and 50 μl of solubilization buffer to the transformant tube and vortex to mix thoroughly.

[0088] (2) Add 130 μl of conversion reagent to 20 μl of DNA sample;

[0089] (3) Place the sample in a PCR instrument, incubate at 98°C for 10 minutes, then at 72°C for 2.5 hours, and store at 4°C.

[0090] (4) Add 600 μl of binding buffer to the spin column and place in a collection tube;

[0091] (5) Add the sample from step (2) to the centrifuge column filled with binding buffer, tightly cap the tube and repeatedly invert to mix for 1 minute;

[0092] (6) Centrifuge at 13400 × g for 30 seconds and discard the filtrate;

[0093] (7) Add 100 μl of wash buffer to the above spin column and centrifuge at 13400 × g for 30 seconds;

[0094] (8) Add 200 μl of desulfonation buffer to the centrifuge column and incubate at room temperature for 15-20 minutes, then centrifuge at 13,400 × g for 30 seconds;

[0095] (9) Add 200 μl of wash buffer to the centrifuge column and centrifuge at 13,400 × g for 30 seconds. Add another 200 μl of wash buffer and centrifuge at 13,400 × g for 30 seconds. Repeat once.

[0096] (10) Place the spin column in a 1.5 ml EP tube, add 20 μl of elution buffer to the spin column, and centrifuge at maximum speed for 30 seconds to elute the DNA;

[0097] (11) DNA concentration and purity were measured by spectrophotometry and stored at -20°C.

[0098] 3. Real-time quantitative methylation-specific PCR reaction

[0099] A methylation-specific primer pair and probe targeting the 521-933bp fragment of the target gene RNF41 promoter region, a specific primer pair and Taqman fluorescent probe for the internal reference gene; a real-time quantitative methylation-specific PCR method was used to amplify the target gene RNF41 promoter and the internal reference gene.

[0100] (1) Primer design:

[0101] RNF41-upstream primer: 5′GGTTGGTTTCGGATTTATGATTTTA 3′;

[0102] RNF41-downstream primer: 5′AACAAAACTCCTTTACCGAAATAA3′;

[0103] RNF41-probe: 5′FAMACCAAATACAACGACTCACGCCTATAATCCT 3′MGB;

[0104] ACTB-upstream primer: 5′TGGTGATGGAGGAGGTTTAGTAAGT 3′;

[0105] ACTB-downstream primer: 5′AACCAATAAAACCTACTCCTCCCTTAAA 3′;

[0106] ACTB-probe: 5'FAMACCACCACCCAACACACAATAACAAACACA 3'BHQ1.

[0107] (2) Real-time quantitative methylation-specific polymerase chain reaction to detect the methylation degree of RNF41 promoter: The treated DNA was subjected to real-time quantitative polymerase chain (PCR) reaction using methylation-specific primer pairs of the target gene RNF41 promoter and the internal reference gene and Taqman fluorescent probe sequence probes, respectively. The negative control was to replace the DNA template in the system with double-distilled water, and the positive control was to replace the DNA template in the system with 100% methylated human genomic DNA, i.e., DNA extracted from healthy human leukocytes, methylated in vitro by CpG methyltransferase, and then modified by bisulfite.

[0108] The reagents for the real-time quantitative methylation-specific PCR reaction system are as follows in Table 2:

[0109] Table 2

[0110]

[0111] In Table 2, upstream primers and downstream primers refer to the specific primer pairs of the target gene RNF41 and the internal reference gene, namely, the RNF41-upstream primer and RNF41-downstream primer described above; ACTB-upstream primer and ACTB-downstream primer; probes refer to the fluorescent probes of the target gene and the internal reference gene, namely, the RNF41 probe and ACTB probe described above.

[0112] (3) The 5× premixed PCR reaction system is a commercially available product, which contains hot-start Taq polymerase, deoxyribonucleoside triphosphate, magnesium chloride, reaction buffer, PCR reaction enhancer, optimizer, and stabilizer.

[0113] (4) The reaction conditions were as follows: heating to 95°C, holding for 1-15 minutes, for a total of 1 cycle; heating to 95°C, holding for 15 seconds, annealing at 58-64°C for 40-60 seconds, for 35-60 cycles.

[0114] 4. Data Calculation

[0115] Real-time quantitative analysis was performed on the test samples to determine the degree of DNA methylation. The threshold cycle value (Ct value, the number of cycles required for the fluorescence signal in each reaction tube to reach the set threshold) for the methylation reaction was obtained using the software of the fluorescence PCR instrument. The RNF41 methylation level was calculated using the following formula.

[0116] Methylation rate=100%×2exp.[ΔCt(sample RNF41 Ct value−sample ACTB Ct value)−ΔCt(positive control RNF41 Ct value−positive control ACTB Ct value)].

[0117] A methylation rate (PMR) ≥ 16.138% was defined as a positive result (hypermethylation) and diagnosed as hepatitis B-related compensated cirrhosis; a PMR < 16.138% was defined as a negative result (hypomethylation) and could not be diagnosed as hepatitis B-related compensated cirrhosis.

[0118] 5. Results Analysis

[0119] The RNF41 gene promoter methylation index in 105 patients with hepatitis B-related compensated cirrhosis was 19.98% (16.85–25.6%), which was significantly higher than that in patients with chronic hepatitis B (14.23% (10.67–15.31%)) (P < 0.0001) and healthy volunteers (12.77% (10.06–13.96%) (P < 0.0001). Figure 2 .

[0120] like Figure 4 As shown, the methylation rate of the RNF41 gene promoter in patients with cirrhosis was positively correlated with the LSM coefficient.

[0121] like Figure 5 As shown, the area under the receiver operating characteristic curve (ROC) for the RNF41 methylation index in predicting liver cirrhosis was 0.932 (95% confidence interval: 0.893-0.972). With a cutoff of 16.138% methylation rate, the sensitivity was 86.67% and the specificity was 81.00%. Compared to the LSM coefficient, the area under the ROC curve (ROC) was 0.848, with a sensitivity of 70.48% and a specificity of 92.00%. The results are shown in Table 3.

[0122] Table 3

[0123]

[0124] In summary, the CpG in the 521-933bp range of the RNF41 gene promoter is highly methylated in patients with hepatitis B-related compensated cirrhosis, indicating that the methylation level of the RNF41 gene promoter region can be used to predict the condition of patients with early cirrhosis and provide a reference for physicians' clinical diagnosis and subsequent treatment effects.

[0125] The above specific implementation manner cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art, any replacement, improvement or transformation made to the implementation manner of the present invention falls within the protection scope of the present invention.

[0126] Any matters not described in detail in the present invention are well-known technologies to those skilled in the art.

Claims

1. Use of a reagent for detecting the methylation level of the RNF41 gene in the preparation of a product for the diagnosis or auxiliary diagnosis of liver cirrhosis, characterized in that: The RNF41 gene methylation level refers to the methylation level of a specific CpG island in the RNF41 promoter region; the liver cirrhosis is hepatitis B-related compensated liver cirrhosis.

2. The use according to claim 1, characterized in that RNF41 gene methylation refers to the methylation of the CpG island in the range of 521-933bp in the RNF41 promoter region; the reagent is a reagent for detecting the methylation level of the CpG island in the range of 521-933bp in the RNF41 promoter region; when the RNF41 gene is highly methylated, the subject suffers from hepatitis B-related compensated cirrhosis.

3. The use according to claim 1, characterized in that The samples used for the test were peripheral blood mononuclear cells.

4. The use according to any one of claims 1 to 3, characterized in that The reagents include primers, probes, antibodies or nucleic acid chips.

5. The use according to claim 4, characterized in that The reagents include an RNF41 primer pair and an RNF41-Taqman fluorescent probe for quantitative methylation-specific PCR detection of the methylation level of the RNF41 gene.

6. The use according to claim 5, characterized in that The RNF41 primer pair includes: RNF41-upstream primer, as shown in SEQ ID NO.1; RNF41-downstream primer as shown in SEQ ID NO.2; and the RNF41-Taqman fluorescent probe as shown in SEQ ID NO.

3.

7. A detection kit, characterized in that It comprises the RNF41 primer pair and RNF41-Taqman fluorescent probe as described in claim 5 or 6.

8. The detection kit according to claim 7, characterized in that It also includes an internal reference gene-specific primer pair and an internal reference gene Taqman fluorescent probe; the internal reference gene-specific primer pair includes an ACTB-upstream primer, as shown in SEQ ID NO.4; an ACTB-downstream primer, as shown in SEQ ID NO.5; and an ACTB-Taqman fluorescent probe as shown in SEQ ID NO.

6.

9. The detection kit according to claim 8, characterized in that The detection kit further comprises a positive control and a negative control; the positive control is 100% methylated human genomic DNA modified with bisulfite; and the negative control is water.

10. A system for diagnosing or assisting in the diagnosis of early-stage liver cirrhosis, characterized in that: The system includes a quantitative detection unit and an analysis unit for quantitatively detecting the DNA methylation level of the promoter region of RNF41 in a sample, wherein the quantitative detection unit uses the detection kit described in any one of claims 7 to 9 to perform real-time quantitative methylation-specific polymerase chain reaction; the analysis unit performs analysis based on the results obtained by the quantitative detection unit, and when the RNF41 methylation rate is ≥16.138%, it is determined that the subject suffers from compensated hepatitis B cirrhosis.

Images