Application of cyanidin-3-O-galactoside in preparation of medicine for treating mastitis

Abstract

The invention relates to the technical field of veterinary medicine, and discloses application of cyanidin-3-O-galactoside in preparation of a medicine for treating mastitis. The cyanidin-3-O-galactoside has a structural formula as follows: # imgabs0 # is applied to (1) expression of a stable blood milk barrier key gene ZO-1; (2) the content and expression level of inflammatory factors IL-6, TNF-alpha and IL-1beta in the mammary gland are reduced; (3) reducing the number of somatic cells in milk; according to the application of the cyanidin-3-O-galactoside in preparation of the medicine for treating mastitis, the cyanidin-3-O-galactoside can stabilize expression of ZO-1 in the period of mastitis, protect integrity of a blood milk barrier, reduce inflammatory response, effectively relieve development of mastitis and reduce use of antibiotics, and is green and safe.

Description

Technical Field

[0001] The present invention relates to the technical field of veterinary medicine, in particular to application of cyanidin-3-O-galactoside in preparing medicine for treating mastitis. Background Art

[0002] Mastitis is an inflammatory response of mammary tissue, which is common in lactating women and dairy livestock, and is mainly caused by pathogen infection. Existing treatment methods usually use antibiotics, which are prone to drug resistance and can only reduce the inflammatory response, but cannot directly protect the blood-milk barrier function. The blood-milk barrier is composed of tight junctions between mammary epithelial cells, which is responsible for maintaining milk components and preventing leakage of blood components. During mastitis, the aggravation of the inflammatory response leads to downregulation of the expression of tight junction proteins (such as ZO-1), impaired barrier function, and aggravated tissue damage and spread of infection. ZO-1 is the core scaffold protein of tight junctions and maintains barrier integrity. In order to solve the above technical problems, the present invention provides a crude extract of anthocyanins from crabapple fruit. The crude extract of anthocyanins from crabapple fruit is a plant extract, which is safe and non-toxic, can stabilize the stable expression of tight junction proteins during mastitis, protect the blood-milk barrier, and reduce the inflammatory response. Summary of the Invention

[0003] The purpose of the present invention is to provide the use of cyanidin-3-O-galactoside in the preparation of a drug for treating mastitis. Cyanidin-3-O-galactoside can stabilize the expression of ZO-1 during mastitis, protect the blood-milk barrier, reduce inflammatory response, effectively alleviate the development of mastitis, reduce the use of antibiotics, and is green and safe.

[0004] To achieve the above object, the present invention provides the use of cyanidin-3-O-galactoside in the preparation of a drug for treating mastitis. The structural formula of cyanidin-3-O-galactoside is as follows:

[0005]

[0006] Further, it is applied to:

[0007] ① Stabilize the expression of ZO-1, a key gene in the blood-milk barrier;

[0008] ② Reduce the content and expression levels of inflammatory factors IL-6, TNF-α and IL-1β;

[0009] ③Reduce the number of somatic cells in breast milk.

[0010] The present invention also provides the use of cyanidin-3-O-galactoside in stabilizing the expression of ZO-1, a key gene of the blood-milk barrier.

[0011] Furthermore, the present invention also provides a crude extract of anthocyanin from crabapple fruit, the active ingredient of which is cyanidin-3-O-galactoside.

[0012] The present invention also provides the use of the above-mentioned crabapple fruit anthocyanin crude extract in the preparation of a drug for treating mastitis.

[0013] The preparation method of the above-mentioned crabapple fruit anthocyanin crude extract comprises the following steps:

[0014] The crabapple fruit was frozen at -80°C for 48 hours and then freeze-dried. After freeze-drying, the dried fruit was crushed and sieved. 2.0 g of the freeze-dried powder was mixed with 70% ethanol and extracted. The extract was treated with a rotary evaporator to obtain a crude crabapple fruit anthocyanin extract.

[0015] Furthermore, the present invention also provides a medicine for treating mastitis, the active ingredient of which is cyanidin-3-O-galactoside.

[0016] The advantages and positive effects of using the cyanidin-3-O-galactoside of the present invention in preparing a drug for treating mastitis are:

[0017] 1. The present invention provides a purified product of crabapple anthocyanin - cyanidin-3-O-galactoside. Cyanidin-3-O-galactoside is a plant extract, which is safe and non-toxic, can relieve mastitis, and reduce the use of antibiotics and the problem of drug resistance.

[0018] 2. The cyanidin-3-O-galactoside in the present invention can stabilize the expression of tight junction protein ZO-1 during mastitis, protect the blood-milk barrier, reduce inflammatory response, and effectively alleviate the development of mastitis. It is suitable for the prevention and treatment of mastitis in dairy animals and has broad market prospects.

[0019] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The HPLC results of the crude anthocyanin extract and its components in the examples of the present invention are as follows;

[0021] Figure 2 The safety evaluation results of the crude anthocyanin extracts in the examples of the present invention are as follows;

[0022] Figure 3 The results of the effects of oral administration of crude anthocyanin extracts on somatic cell count and pro-inflammatory factor expression in dairy cows according to the present invention are shown in Figure 1, where A represents somatic cell count analysis, B represents IL-6 content analysis, C represents TNFα content analysis, D represents IL-1β content analysis, E represents IL-6 mRNA expression, F represents IL-1β mRNA expression, and G represents TNFα mRNA expression.

[0023] Figure 4 The results of the effects of oral administration of crude anthocyanin extracts on somatic cell count and pro-inflammatory factor expression in dairy goats in the examples of the present invention are shown, wherein A is somatic cell count analysis, B is IL-6 content analysis, C is TNFα content analysis, D is IL-1β content analysis, E is IL-6 mRNA expression level, F is IL-1β mRNA expression level, and G is TNFα mRNA expression level;

[0024] Figure 5 The oral administration of crude anthocyanin extracts in the embodiments of the present invention can reduce the severity of mastitis in cows, goats and mice, wherein A is HE staining analysis of cow mammary tissue, Bar = 200 μm, B is ZO-1 immunofluorescence analysis of cow mammary tissue, Bar = 200 μm, C is HE staining analysis of goat mammary tissue, Bar = 200 μm, D is ZO-1 immunofluorescence analysis of goat mammary tissue, Bar = 200 μm, E is HE staining analysis of mouse mammary tissue, Bar = 200 μm, F is mouse ZO-1 immunofluorescence analysis of mammary tissue, Bar = 200 μm, G is the protein expression determination of ZO-1 and Occludin in mammary and colonic tissues, H is the TEM analysis of tight junction structure of mouse mammary tissue, green represents structural integrity, and red represents structural damage, I is the HE staining analysis of mouse colon tissue, J is the ZO-1 immunofluorescence staining analysis of mouse colon tissue, K is the TME analysis of tight junction structure of mouse colon tissue, green represents structural integrity, and red represents structural damage; scale bar is 200 μm;

[0025] Figure 6 The present invention is an analysis of pro-inflammatory factors in mouse blood and colon by oral administration of crude anthocyanin extracts, wherein A is an analysis of the IL-6 content in mouse blood, B is an analysis of the TNFα content in mouse blood, C is an analysis of the IL-1β content in mouse blood, D is an analysis of the IL-6 expression in mouse colon, E is an analysis of the IL-1β expression in mouse colon, and F is an analysis of the TNFα expression in mouse colon;

[0026] Figure 7 The figures show the effects of oral administration of crude anthocyanin extracts on ZO-1 and Occludin in the colon of mice according to the present invention, wherein A is the analysis result of ZO-1 protein, B is the analysis result of Occludin, C is the analysis result of ZO-1 mRNA expression, and E is the analysis result of Occludin mRNA expression;

[0027] Figure 8 This is the identification result of the purified product (P-C3Gal) of the crude anthocyanin extract in the examples of the present invention;

[0028] Figure 9 A is a flow chart of the purification of crude extracts from crabapple fruit, and B is the structural formula of cyanidin-3-O-galactoside (C3Gal);

[0029] Figure 10 This is a flow chart showing the use of E. coli to construct a goat mastitis model and the topical application of P-C3Gal in an embodiment of the present invention;

[0030] Figure 11 The somatic cell count analysis results after local application of P-C3Gal in the goat mastitis model in the embodiment of the present invention;

[0031] Figure 12 A in the middle is the HE staining analysis result of the mammary gland tissue of dairy goats after local intervention with the purified product C3Gal; B is the ZO-1 immunofluorescence analysis result of the mammary gland tissue of dairy goats, the scale bar is 200 μm;

[0032] Figure 13 A in the middle is the expression levels of ZO-1 and Occludin after local breast intervention with P-C3Gal, B is the analysis result of ZO-1 protein, C is the analysis result of Occludin, D is the analysis result of ZO-1 mRNA expression, and E is the analysis result of Occludin mRNA expression;

[0033] Figure 14 These are the analysis results of pro-inflammatory factors after local breast intervention using P-C3Gal in the examples of the present invention, wherein A is the analysis result of the IL-6 content in milk, B is the analysis result of the TNFα content in milk, C is the analysis result of the IL-1β content in milk, D is the expression analysis result of IL-6 in breast tissue, E is the expression analysis result of IL-1β in breast tissue, and F is the expression analysis result of TNFα in breast tissue. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0035] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0036] All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Experimental methods in the following examples where specific conditions are not specified are generally determined in accordance with national standards. Experimental instruments, equipment, and reagents in the following examples where the sources are not specified are all commercially available raw materials.

[0037] Unless otherwise defined or indicated, all technical and scientific terms used in this invention have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein may be applied to the methods of the present invention. It should be noted that, unless there is a conflict, the embodiments and features of the embodiments of the present invention may be combined with each other.

[0038] Example 1 Materials and Methods

[0039] 1.1 Extraction and purification:

[0040] The crabapple fruits were obtained from the crabapple germplasm resource garden of Northwest Agriculture and Forestry University and used as experimental materials.

[0041] First, the crabapple fruits were frozen at -80°C for 48 hours and then freeze-dried. After freeze-drying, the dried fruits were crushed and sieved. 2.0 g of the freeze-dried powder was mixed with 70% ethanol and extracted. The extract was treated with a rotary evaporator to obtain a crude anthocyanin extract. The crude extract was then purified using AB-8 macroporous resin to obtain a purified product, which was characterized by HPLC-DAD to determine its composition.

[0042] 1.2 Safety Assessment of Anthocyanin Extracts: To evaluate the safety of anthocyanin extracts, six-week-old mice were fed a single dose of anthocyanin extracts from dairy cows and goats for 15 days. Following the experiment, blood samples were collected and assayed for IL-6, TNFα, and IL-1β expression using ELISA.

[0043] 1.3 Animal oral administration experiment:

[0044] ① In the Holstein cow experiment, cows with a parity of 2, an average body weight of 590±15.30kg, and a daily milk production of approximately 36±2.3kg were selected. The study started on the 14th day of pregnancy and the cows were divided into three groups: (1) the control group, which was fed a standard formula diet; (2) the mastitis group, which was fed the same diet and mammary gland modeling was performed in the last 3 days; (3) the oral group, which was fed a standard diet mixed with ACN extract. The experiment lasted for five weeks, with the first week being an adaptation period and the following four weeks being an experimental feeding period. Anthocyanin extract was fed twice a day, 25g each time, at 7:00 and 17:00 respectively. Each cow was housed individually in a clean stable to ensure full diet intake and free movement. The stable was cleaned regularly, water was available freely, and milking was performed every day. Mastitis tests were performed three times a week throughout the experiment.

[0045] ② For the dairy goat study, Saanen goats were selected. They were parity two, had an average body weight of 45.26 ± 2.10 kg, and produced approximately 2.01 ± 0.30 kg of milk per day. The experimental design, grouping, and environmental conditions were consistent with those used in the dairy cow study. Anthocyanin extract was administered twice daily, 15 g each time.

[0046] ③ In the mouse experiment, female mice weighing 20-23g and of the same genetic background were housed under specific SPF conditions. The experiment lasted for three weeks, during which time the mice were orally fed 200mg / kg of anthocyanin extract daily. In the third week of the experiment, which was the first week postpartum, mastitis was induced using Escherichia coli on the sixth day postpartum.

[0047] 1.4 Establishment of Mastitis Model: Mastitis model was established in dairy cows and goats. The concentration of Escherichia coli (ATCC25922) was 6×10 6 CFU / mL, and the infection period lasted three days. During this period, the animals' environment was thoroughly cleaned daily and infection was performed at the same time each day. Briefly, the mammary area was cleaned and disinfected with warm water, followed by disinfection with 75% alcohol. The E. coli suspension was then injected into the udder using a sterile syringe and lactation needle. The mammary gland was gently massaged to evenly distribute the bacteria. Finally, after the animals were stabilized, they were allowed to move around normally and housed in conditions and environments consistent with their typical living environment. In addition, the control group received the same volume of PBS and topical application of P-C3Gal. The application dose was 15 or 30 g.

[0048] In the mouse mastitis induction experiment, the infection duration was 1 day. The concentration of Escherichia coli (CVCC1418) was 1×10 7 CFU / 50 μL. Mice were housed under standard housing conditions consistent with a typical living environment. Following treatment, mammary gland and colon tissues were collected after euthanasia for further analysis.

[0049] 1.5 Somatic cell count: Somatic cells in milk were counted. The milk sample was centrifuged to separate the precipitate, which was then resuspended in PBS and counted using Countess TM 3. Automated cell counter (AMQAX2000, Thermo Fisher Scientific, USA) was used for determination.

[0050] 1.6 RT-qPCR: Total RNA was extracted from cells using TRIzol reagent (15596026CN, Thermo Fisher Scientific, USA) and reverse transcribed into cDNA using a reverse transcription kit (Takara Bio Inc., China). Gene expression was quantified using QuantStudio design and analysis software. The total reaction volume was 10 μL, containing 0.3 μL each of the forward and reverse primers, 5 μL of FastStart Universal SYBR Master (ROX; Roche, USA), and 3.4 μL of RNase-free water. Primer sequences are shown in Tables 1, 2, and 3.

[0051] Table 1 RT-qPCR primers for goat breeds

[0052] Primer sequences IL-6 (NM_001285640.1) F TGATGACTTCTGCTTTCCCTAC (SEQ ID NO.1) IL-6 (NM_001285640.1) R AACCTTTGCGTTCTTTACCC (SEQ ID NO.2) IL-1β (XM_013967700.2) F CATGTGTGCTGAAGGCTCTC (SEQ ID NO.3) IL-1β (XM_013967700.2) R AGTGTCGGCGTATCACCTTT (SEQ ID NO.4) TNFα (XM_005696606) F CAAGTAACAAGCCGGTAGCC (SEQ ID NO.5) TNFα (XM_005696606) R AGATGAGGTAAAGCCCGTCA (SEQ ID NO.6) β-actin (NM_001314342.1) F ATGACCCAGATCATGTTTGAGACC (SEQ ID NO.7) β-actin (NM_001314342.1) R CGTGGTGGTGAAGCTGTAGCC (SEQ ID NO.8) ZO-1 (XM_018066118.1) F ACAGATGCAAAGACGCTGAT (SEQ ID NO.9) ZO-1 (XM_018066118.1) R CTTGTGGTGAGTAGGGAGGAT (SEQ ID NO.10) Occlduin (XM_018065677.1) F CCAGCGTTGTAAGGTCAGGC (SEQ ID NO.11) Occlduin (XM_018065677.1) R TTTCCGTCGGTCGTAATCTC (SEQ ID NO.12)

[0053] Table 2 RT-qPCR primers for cattle

[0054]

[0055]

[0056] Table 3 Mouse RT-qPCR primers

[0057] Primer sequences IL-6 (NM_001314054.1) F GTTGCCTTCTTGGGACTGAT (SEQ ID NO.2l) IL-6 (NM_001314054.1) R CTGGCTTTGTCTTTCTTGTTAT (SEQ ID NO.22) TNFα (NM_001278601.1) F GTGCCTATGTCTCAGCCTCTTC (SEQ ID NO.23) TNFα (NM_001278601.1) R TCCTCCACTTGGTGGTTTGT (SEQ ID NO.24) IL-1β (NM_008361.4) F AACTGCACTACAGGCTCCGAGA (SEQ ID NO.25) IL-1β(NM_008361.4)R GCCACAGGTATTTTGTCGTTGCTT(SEQ ID NO.26) ZO-1(NM_001163574.2)F GCCGCTAAGAGCACAGCAA(SEQ ID NO.27) ZO-1(NM_001163574.2)R GCCCTCCTTTTAACACATCAGA(SEQ ID NO.28) Occludin(NM_001360536.1)F TTGAAAGTCCACCTCCTTACAGA(SEQ ID NO.29) Occludin(NM_001360536.1)R CCGGATAAAAAGAGTACGCTGG(SEQ ID NO.30) β-actin(NM_007393.5)F TGCTGTCCCTGTATGCCTCT(SEQ ID NO.31) β-actin(NM_007393.5)R TTTGATGTCACGCACGATTT(SEQ ID NO.32)

[0058] 1.7 Western Blotting: The antibodies used are shown in Table 4. The cells were lysed using RIPA buffer (Santa Cruz, USA) containing a protease inhibitor cocktail. Then, the protein concentration was quantified using an enhanced BCA protein detection kit (P0009, Beyotime, China). The proteins were separated on 10% and 12% SDS-PAGE gels, transferred to a PVDF membrane (Roche, USA), and blocked with a 5% skim milk solution at room temperature for 2 h. After washing three times with TBST, the PVDF membrane was incubated with the primary antibody at 4 ° C overnight. After another round of three washes with TBST, the membrane was incubated with the secondary antibody at room temperature for 2 h. The protein expression level was detected using the ECL Western blotting system (ChemiDoc Image Analysis System, BIO-RAD, USA), and the grayscale value of the bands was quantified using ImageJ software.

[0059] 1.8ELISA:

[0060] All procedures were performed strictly according to the manufacturer's instructions. Goat IL-6 (MM-35226O2), TNFα (MM-0096O2), and IL-1β (MM-1751O2) were purchased from ELISA (Jiangsu, China); bovine IL-6 (F4043-A), TNF-α (F6720-B), and IL-1β (F4049-A) were purchased from FANKEW (Shanghai, China); and mouse IL-6 (JL20268), TNFα (JL10484), and IL-1β (JL18442) were purchased from Jianglai Biotechnology (Shanghai, China).

[0061] 1.9 HE staining: Animal tissues for histological analysis were promptly sent to Shaanxi Yike Biotechnology Service Co., Ltd. (Shaanxi, China). The animal tissues were embedded in paraffin and sliced at a thickness of 5 μm using a rotary microtome (RM2245, Wetzlar, Germany). The sections were analyzed by HE staining under an optical microscope (Olympus, Tokyo, Japan).

[0062] 1.10 Transmission Electron Microscopy Analysis: First, mammary gland and intestinal specimens from mice in the different treatment groups were prefixed with 2.5% glutaraldehyde. Subsequently, the specimens were refixed with 1% osmium tetroxide and dehydrated using a gradient of acetone (30%, 50%, 70%, 80%, 90%, 95%, and 100%), with the 100% acetone step repeated three times. After dehydration, the specimens were infiltrated with a mixture of dehydrating agent and embedding medium in ratios of 3:1, 1:1, and 1:3. Finally, the specimens were embedded in resin. Sections were examined under a light microscope, and ultrathin sections (60–90 nm) were prepared using an ultramicrotome and mounted on copper grids. These grids were stained with uranyl acetate for 10–15 min and then with lead citrate for 1–2 min at room temperature. Ultrastructural images were acquired using a JEM-1400 FLASH transmission electron microscope (JEOL, Japan).

[0063] 1.11 Tissue Immunofluorescence Analysis: Tissues obtained from each group were subjected to immunofluorescence experiments. Fluorescence images were captured using a fluorescence microscope (Nikon, Tokyo, Japan). The antibodies used are listed in Table 4.

[0064] Table 4 Antibodies

[0065] protein company Catalog Number Dilution ratio WB / IF ZO-1 Proteintech 21773-1-AP 1:500 WB / IF Occludin Proteintech 66378-1-Ig 1:500 WB / IF IL-6 Proteintech 66146-1-Ig 1:500 WB CK18 Invitrogen 3D103A08 1:500 WB β-actin Proteintech 20536-1-AP 1:500 WB

[0066] 1.12 Statistical Analysis: SPSS 20 and GraphPad Prism (version 8.0) were used for analysis and plotting. Data from at least three independent replicates are presented as mean ± SEM. Comparisons between two groups were performed using an unpaired t-test. Comparisons between more than two groups were performed using one-way analysis of variance. *: indicates a significant difference (P < 0.05); **: indicates an extremely significant difference (P < 0.01); ns: indicates a non-significant difference (P > 0.05).

[0067] Example 2 Result Analysis

[0068] 2.1 Crabapple crude extract and its components:

[0069] The crude anthocyanin extract and its components were determined by high performance liquid chromatography-diode array detection (HPLC-DAD). Figure 1As shown, cyanidin-3-O-galactoside (C3Gal) was identified as the main component, and cyanidin-3-O-arabinoside, cyanidin-3-5-diglucoside, epicatechin, procyanidin B2, eriodictyol, chlorogenic acid, coumalic acid, gallic acid and phlorizin were also included.

[0070] 2.2 Safety Assessment

[0071] The safety of anthocyanin crude extract was evaluated in a feeding experiment with mice using the same feeding doses as those used for cows (25g) and goats (15g). Figure 2 As shown in the results, compared with the normal group, there was no significant difference in the expression levels of interleukin-6 (IL-6), tumor necrosis factor (TNF-α) and interleukin-1β (IL-1β) in the blood of mice fed with high-dose anthocyanin extract for 15 days (P>0.05), indicating that anthocyanin extract is non-toxic and safe.

[0072] 2.3 Oral administration of ACN extract can improve the ability of dairy cows, goats and mice to relieve mastitis:

[0073] To evaluate whether oral administration of anthocyanin extracts has anti-mastitis effects, anthocyanin crude extracts were orally administered to cows, goats, and mice, and mastitis was induced by infection with Escherichia coli for functional verification. Figure 3 and Figure 4 The results showed that the somatic cell count (SCC) in milk and the expression of pro-inflammatory cytokines IL-6, TNF-α and IL-1β in milk decreased (P<0.05), indicating that oral administration of anthocyanin extract significantly improved the anti-mastitis ability of dairy cows and goats, inhibited the aggregation of immune cells, maintained the normal distribution of ZO-1 and Occludin in mammary tissue, and protected the integrity of the blood-milk barrier (BMB) ( Figure 3 and 4 In AG, Figure 5 AD).

[0074] In a mouse model, oral administration of crude anthocyanin extracts also effectively maintained the distribution of ZO-1 in mammary tissue and maintained the integrity of the BMB ( Figure 5 In addition, the expression of ZO-1 and Occludin increased ( Figure 5 Middle G). Transmission electron microscopy (TEM) confirmed the structural integrity of tight junctions between mammary epithelial cells. ( Figure 5These results indicate that oral administration of crude anthocyanin extracts reduced the severity of mastitis in different species and maintained the integrity of the BMB. However, the impact of oral administration of anthocyanin extracts on the intestinal tract remains unclear. Notably, in the mouse mastitis model, mastitis was associated with colitis and systemic inflammatory responses, as evidenced by the significant increase in IL-6, TNFα, and IL-1β levels in the blood and colon (P<0.01). Figure 6 HE and immunofluorescence staining results showed that a large number of immune cells infiltrated the colon ( Figure 5 I and J in the middle), disrupted the distribution of ZO-1 protein, and significantly downregulated the expression of ZO-1 (P<0.01) ( Figure 5 Middle G and Figure 7 Further TEM analysis demonstrated disordered tight junction structure, missing villi, and irregular arrangement of colonic villi ( Figure 5 K in the figure), and oral administration of anthocyanin crude extracts alleviated systemic inflammatory response, colitis and mastitis in mice ( Figure 5 、 Figure 6 and Figure 7 These results suggest that mastitis is accompanied by a systemic inflammatory response that disrupts intestinal barrier integrity, which may be associated with BMB damage. Furthermore, anthocyanin extracts demonstrated a protective effect on the intestinal barrier, exhibited no adverse effects, and provided additional therapeutic benefits.

[0075] 2.3 The purified anthocyanin product (P-C3Gal) can effectively alleviate the severity of mastitis in dairy goats:

[0076] In vivo studies have shown that oral administration of anthocyanin extracts effectively reduces the severity of mastitis. C3Gal is the most abundant key component in anthocyanin extracts. To determine whether C3Gal plays a key role, the crude anthocyanin extracts were purified and the presence of only C3Gal was confirmed in the purified product. The identification results of the purified product are shown in Figure 2. Figure 8 As shown, the purification process and molecular formula are as follows Figure 9 shown.

[0077] A goat mastitis model was established using Escherichia coli infection, and the function of P-C3Gal was verified by injecting it into the mammary gland of the goat. The experimental process was as follows: Figure 10 As shown. After E. coli infection, the number of SCC in milk increased significantly (P<0.01) ( Figure 11 As shown). Immune cell infiltration in the mammary gland was significant, the alveolar structure was destroyed, the distribution of ZO-1 became diffuse, and the expression level was significantly reduced (P<0.01) ( Figure 12 and Figure 13In addition, the expression levels of proinflammatory cytokines IL-6, TNF-α, and IL-1β in milk and mammary tissue were significantly increased (P<0.01) ( Figure 14 ), confirming the successful establishment of the mastitis model.

[0078] After treatment with P-C3Gal, SCC in milk was significantly reduced (P<0.01) ( Figure 11 As shown). The aggregation of immune cells in the mammary gland decreased, the alveolar structure was restored, the distribution of ZO-1 was more uniform, and the expression level was significantly increased (P<0.01) ( Figure 12 and Figure 13 The expression of IL-6, TNFα and IL-1β in milk and mammary tissue was also significantly decreased (P<0.01) ( Figure 14 These findings indicate that C3Gal, the key active ingredient in anthocyanin extracts, has a protective effect against mastitis. Most importantly, C3Gal effectively mitigated the severity of E. coli-induced mastitis in dairy goats, preserved the structural integrity of the BMB, and modulated the inflammatory response in a dose-dependent manner.

[0079] Therefore, the present invention uses the above-mentioned cyanidin-3-O-galactoside in the preparation of a drug for treating mastitis. Cyanidin-3-O-galactoside can stabilize the expression of ZO-1 during mastitis, protect the blood-milk barrier, reduce inflammatory response, effectively alleviate the development of mastitis, reduce the use of antibiotics, and is green and safe.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. Use of cyanidin-3-O-galactoside in the preparation of a drug for treating mastitis, characterized in that: The structural formula of cyanidin-3-O-galactoside is as follows:

2. The use according to claim 1, characterized in that Applies to: ① Stabilize the expression of ZO-1, a key gene in the blood-milk barrier; ② Reduce the content and expression levels of inflammatory factors IL-6, TNF-α and IL-1β; ③Reduce the number of somatic cells in breast milk.

3. Application of cyanidin-3-O-galactoside in stabilizing the expression of ZO-1, a key gene of the blood-milk barrier.

4. A crude extract of anthocyanins from crabapple fruit, characterized by: Its active ingredient is cyanidin-3-O-galactoside.

5. Use of the crude crabapple anthocyanin extract according to claim 4 in the preparation of a drug for treating mastitis.

6. The method for preparing the crude extract of anthocyanins from crabapple fruit according to claim 4, wherein: Here are the steps: The crabapple fruit was frozen at -80°C for 48 hours and then freeze-dried. After freeze-drying, the dried fruit was crushed and sieved. 2.0 g of the freeze-dried powder was mixed with 70% ethanol and extracted. The extract was treated with a rotary evaporator to obtain a crude crabapple fruit anthocyanin extract.

7. A medicine for treating mastitis, characterized in that: Its active ingredient is cyanidin-3-O-galactoside.

Images