Application of APOA5 inhibitor in prevention and treatment of PD-L1 high-expression liver diseases and screening of drugs for regulating liver immune inflammatory microenvironment homeostasis
By developing APOA5 inhibitors to regulate the expression and activity of APOA5, the treatment problem of acute liver injury in sepsis was solved, and the effect of reducing hepatic cell apoptosis and reducing inflammatory factors was achieved, providing a new treatment approach for liver injury in sepsis.
Patent Information
- Application Number
- CN202510528359.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, sepsis-related acute liver injury (SALI) in early stages of sepsis lacks effective treatment methods, and the application of anti-PD-L1 therapy in sepsis is challenging. Direct regulation of PD-L1 expression is complex and it is difficult to effectively alleviate liver injury caused by sepsis.
By developing APOA5 inhibitors, the expression, secretion and activity of APOA5 are reduced, and the expression of PD-L1 is reduced, especially in macrophages. APOA5 is used as an alternative pathway for PD-L1 inhibitors, and small-molecular compounds such as metformin or gene editing techniques such as CRISPR-Cas9 knock out the APOA5 gene to regulate the liver immune microenvironment.
Effectively reduce hepatocyte apoptosis, reduce the level of macrophage inflammatory factors, prolong the survival time of mice with acute liver injury in sepsis, and reduce liver damage, providing a potential therapeutic target for acute liver injury in sepsis, and replacing direct anti-PD-L1 treatment methods.
Smart Images

Figure CN120478636A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and specifically to the use of APOA5 inhibitors in preventing and treating diseases related to high PD-L1 expression and screening drugs for regulating the homeostasis of the liver immune inflammatory microenvironment. Background Art
[0002] Sepsis is a life-threatening multi-organ dysfunction caused by a dysregulated immune response to infection. Sepsis-induced immune and metabolic disorders cause organ damage and dysfunction. The liver is the gateway organ for maintaining immune and metabolic homeostasis. In response to infection, changes in the liver's immune microenvironment can affect the secretion of inflammatory proteins, thereby affecting the clearance of pathogenic microorganisms. Therefore, it plays an important role in responding to infection (De Backer D, Deutschman CS, Hellman J, et al. Surviving Sepsis Campaign Research Priorities 2023[J]. Critical Care Medicine, 2024, 52(2): 268-296.; Beyer D, Hoff J, Sommerfeld O, et al. The liver in sepsis: molecular mechanism of liver failure and their potential for clinical translation[J]. Mol Med, 2022, 28(1): 84.). However, sepsis can easily cause sepsis-associated acute liver injury (SALI) in the early stages, which can lead to liver dysfunction and liver failure due to missed diagnosis and delayed treatment. The mortality rate of SALI in children with sepsis is as high as 54%-68% (Sun J, Zhang J, Wang X, et al. Gut-liver crosstalk in sepsis-induced liver injury[J]. Crit Care, 2020, 24(1): 614.). Therefore, early intervention and treatment of SALI is crucial.
[0003] Programmed death-ligand 1 (PD-L1) inhibits immune system responses and its expression is significantly elevated in patients with sepsis. It can not only inhibit T cell function through the action of PD-1 / PD-L1, but also activate intracellular inflammatory signaling pathways, leading to endogenous dysfunction of immune cells such as macrophages and B cells, ultimately aggravating septic organ damage (Nakamori Y, Park EJ, Shimaoka M. Immune Deregulation in Sepsis and Septic Shock: Reversing Immune Paralysis by Targeting PD-1 / PD-L1 Pathway[J]. Front Immunol, 2020, 11: 624279.). Studies have shown that anti-PD-L1 antibodies alleviate sepsis primarily by reducing T cell apoptosis and promoting T cell proliferation and activation (Hanieh H, Alfwuaires MA, Abduh MS, et al. Protective Effects of a Dihydrodiazepine Against Endotoxin Shock Through Suppression of TLR4 / NF-κB / IRF3 Signaling Pathways[J]. Inflammation, 2024.). Anti-PD-L1 therapy has been widely used in cancer treatment, but for sepsis, clinical treatment still relies on traditional antibiotics, fluid resuscitation, and organ support. Currently, only a few clinical trials have demonstrated the safety of anti-PD-L1 therapy for sepsis, suggesting its potential for treating sepsis, but no Phase III treatment results are available. Due to the complex pathophysiology of sepsis, direct anti-PD-L1 therapy is challenging. However, regulating the expression and effects of PD-L1 by regulating the regulatory molecules of PD-L1 in tumors can ultimately achieve the goal of disease treatment, which may have application prospects in the treatment of sepsis (He H, Chen S, Yu Y, et al. Comprehensive single-cell analysis deciphered microenvironmentaldynamics and immune regulator olfactomedin 4 in pathogenesis of gallbladdercancer[J]. Gut, 2024, 73(9): 1529-1542.). Summary of the Invention
[0004] Based on this, it is necessary to at least provide the use of APOA5 inhibitors in preventing and treating diseases related to high PD-L1 expression and screening drugs that regulate the homeostasis of the liver immune inflammatory microenvironment.
[0005] In a first aspect of the present application, there is provided a use of an apolipoprotein A5 (APOA5) inhibitor in the preparation of a medicament for preventing and treating liver diseases associated with high PD-L1 expression; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of APOA5.
[0006] In a second aspect of the present application, there is provided a use of an APOA5 inhibitor as a PD-L1 inhibitor in the preparation of a medicament for preventing and treating liver diseases; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of APOA5.
[0007] In a third aspect of the present application, a drug combination for treating acute liver injury caused by sepsis is provided, comprising an APOA5 inhibitor; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of apolipoprotein A5.
[0008] In a fourth aspect of the present application, a method for screening a drug for regulating the homeostasis of the liver immune inflammatory microenvironment is provided, the method comprising:
[0009] administering the drug candidate to an animal model with immune inflammation of the liver;
[0010] After the candidate drug takes effect, at least one of the expression, secretion and activity of APOA5 in the liver cells of the animal model is measured.
[0011] In a fifth aspect of the present application, there is provided a use of an APOA5 inhibitor in the preparation of a drug for reducing macrophage inflammatory factors and / or reducing hepatocyte apoptosis, wherein the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of APOA5.
[0012] The inventors of this application discovered that knocking down APOA5 reduces PD-L1 expression levels (especially macrophage PD-L1 expression levels), and can be used to reduce hepatocyte apoptosis, lower the levels of macrophage inflammatory factors, and prevent and treat PD-L1 high expression-related diseases such as acute liver injury caused by sepsis; and using APOA5 as a screening target, it was found that inhibiting APOA5 (for example, through metformin) can inhibit PD-L1 expression in liver macrophages in the SALI model, thereby alleviating liver damage. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] In order to more clearly illustrate the technical solutions in the implementation methods and examples of this application and to more completely understand the application and its beneficial effects, the following briefly introduces the drawings required for the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.
[0014] Figure 1 A graph showing the test results of one embodiment of the present application showing that inhibition of APOA5 can improve acute liver injury caused by sepsis ("*" indicates p<0.05, "**" indicates p<0.01, and "***" indicates p<0.005).
[0015] Figure 2 A graph showing the test results of one embodiment of the present application describing that inhibition of APOA5 can inhibit the expression of PD-L1 in monocyte-derived macrophages ("*" indicates p<0.05).
[0016] Figure 3 A graph showing test results demonstrating that inhibition of PD-L1 can reduce apoptosis of septic hepatocytes and thereby improve acute liver injury caused by sepsis, as described in one embodiment of the present application ("*" indicates p<0.05, "**" indicates p<0.01).
[0017] Figure 4 A graph showing the test results of one embodiment of the present application describing the potential of inhibiting APOA5 to replace PD-L1 inhibitors ("*" indicates p<0.05, "**" indicates p<0.01, and "***" indicates p<0.005).
[0018] Figure 5 and Figure 6 A graph showing test results demonstrating that metformin inhibiting APOA5 can antagonize elevated PD-L1 levels and improve SALI, as described in one embodiment of the present application ("*" indicates p<0.05, "**" indicates p<0.01, and "***" indicates p<0.005). DETAILED DESCRIPTION
[0019] To facilitate understanding of the present application, a more comprehensive description of the present application will be provided below with reference to the accompanying drawings. The accompanying drawings illustrate preferred embodiments of the present application. However, the present application may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present application.
[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0021] In this application, unless otherwise specified, "one or more" refers to any one of the listed items or any combination of the listed items. Similarly, "one or more" and other similar expressions that refer to "one or more" are also understood in the same way unless otherwise specified.
[0022] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.
[0023] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.
[0024] In this application, the terms "further," "further," "particularly," "for example," "such as," "example," and "for example" are used for descriptive purposes to indicate that the preceding and following technical solutions are related in terms of the content covered, but should not be construed as limiting the preceding technical solution or the scope of protection of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it is understood that A is not limited to B.
[0025] In this application, the terms "optionally," "optional," and "optional" mean optional, that is, they refer to either option selected from the two parallel options of "yes" or "no." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "optional" is independent. Unless otherwise specified, the descriptions "optionally include," "optionally include," etc. in this application, taking "optionally include" as an example, mean "may include or not include."
[0026] As used herein, the terms "comprising," "including," and "include" are synonymous and are inclusive or open-ended, not excluding additional, unrecited members or features. Examples of members or features include materials or components, structures, elements, and instruments. Non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, and states.
[0027] In this application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.
[0028] In this application, exemplary descriptions such as "in some embodiments (or examples)" and "in one embodiment (or example)" may include but are not limited to the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.
[0029] In this application, the terms "first," "second," "third," "fourth," etc. in "the first aspect," "the second aspect," "the third aspect," "the fourth aspect," etc. are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor should they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc. serve only for the purpose of non-exhaustive enumeration and description, and should be understood not to constitute a closed-ended limitation on quantity.
[0030] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values in the numerical interval is considered to be continuous and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval only refers to an integer in the numerical interval, including the two endpoint integers of the numerical range and each integer between the two endpoints, is equivalent to directly enumerating each integer. When multiple numerical ranges are provided to describe a feature or characteristic, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.
[0031] In this application, if a method flow involves multiple steps, unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and they can be executed in an order other than the order described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages do not necessarily need to be completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating, or simultaneously with other steps or parts of sub-steps or stages of other steps.
[0032] One aspect of the present application relates to a molecule that regulates the immune microenvironment of acute liver injury in sepsis, namely the secreted protein apolipoprotein A5 (APOA5), whose encoding gene is located 30kbp downstream of the APOA-I / CIII / A-IV gene cluster on human chromosome 11q23 and consists of 366 amino acids.
[0033] PD-L1 is an immune checkpoint molecule that undergoes significant changes during sepsis. APOA5 regulates PD-L1 expression. By establishing an LPS-induced model of acute liver injury in sepsis, single-cell sequencing revealed reduced PD-L1 expression in monocyte-derived macrophages in Apoa5 knockout mice. This led to the discovery of a targeted effect: inhibition of APOA5 can suppress PD-L1 expression in macrophages.
[0034] Currently, there are no studies reporting on regulating APOA5 and thereby regulating macrophage PD-L1 to treat liver diseases (e.g., liver injury, such as acute liver injury caused by sepsis), nor are there any studies on inhibiting APOA5 as an alternative treatment to PD-L1 inhibitors.
[0035] For example, by creating APOA5 knockout mice and establishing an LPS-induced acute liver injury model, it was found that APOA5 knockout mice survived longer, had reduced levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) in their blood, and exhibited less liver damage. This finding suggests that reducing liver-specific secretion of APOA5 can alleviate liver diseases associated with overexpression of PD-L1, such as reducing acute liver injury caused by sepsis and prolonging the survival of mice in an LPS-induced acute liver injury model. Therefore, this application provides APOA5 as a potential therapeutic target for liver diseases associated with overexpression of PD-L1, such as acute liver injury caused by sepsis.
[0036] It should be understood that the liver diseases referred to in this application are not limited to inducible (e.g., LPS-induced) acute liver injury models. Other liver diseases with similar mechanisms / pathologies can also be treated by regulating APOA5 and, in turn, macrophage PD-L1. Without wishing to be bound by any theory, it is believed that the mechanism of liver injury is hepatocellular necrosis and liver dysfunction, which in turn leads to liver failure. Therefore, the liver diseases referred to in this application may include, for example, liver injury, liver dysfunction, liver failure, and hepatic immune inflammation. One aspect of this application provides the use of APOA5 inhibitors in the preparation of medicaments for preventing or treating liver diseases associated with overexpression of PD-L1.
[0037] Unless otherwise specified, the term "inhibitor" in this application refers to a regulator that can inhibit or downregulate the expression, secretion, or activity of a substance. For example, it can be an siRNA that can specifically knock down or silence APOA5 or an antibody that can specifically bind to and inhibit the activity of APOA5.
[0038] Unless otherwise specified, the term "antibody" in this application is an immunoglobulin molecule that can specifically bind to a target such as a carbohydrate, polynucleotide, lipid, or polypeptide via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used in this application, the term encompasses not only complete polyclonal or monoclonal antibodies, but also fragments thereof (such as Fab, Fab', F(ab')2, Fv), single-chain (scFv), and domain antibodies (including, for example, shark and camel antibodies), as well as fusion proteins comprising antibodies, and any other modified configurations of immunoglobulin molecules comprising antigen recognition sites. Antibodies include antibodies of any class, such as IgG, IgA, or IgM (or its subclass), and the antibody need not be any particular class. According to the antibody amino acid sequence of the constant region of its heavy chain, immunoglobulins can be classified into different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different classes of immunoglobulins are referred to as α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known. As used herein, the term "antibody" includes complete antibodies and any antigen-binding fragment (i.e., "antigen-binding portion") or a single chain thereof. "Antibody" refers to a protein comprising at least two heavy chains (H) and two light chains (L) interconnected by disulfide bonds, or an antigen-binding portion thereof. Each heavy chain consists of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region consists of three domains, CH1, CH2, and CH3. Each light chain consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region consists of a single domain, CL. The VH and VL regions can be further subdivided into hypervariable regions, called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain the binding domain that interacts with the antigen.
[0039] Unless otherwise specified, the term "siRNA" in this application stands for small interfering RNA (siRNA), a double-stranded RNA molecule of 20 to 25 nucleotides in length that can specifically silence target gene expression through the RNA interference (RNAi) mechanism. siRNA recognizes target mRNA through complementary base pairing and guides the RNA-induced silencing complex (RISC) to degrade the mRNA, thereby inhibiting the translational or post-transcriptional expression of the corresponding gene.
[0040] In some embodiments, the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion, and activity of APOA5.
[0041] Exemplarily, the APOA5 inhibitor exerts at least one of the following effects:
[0042] (1) Reduce the expression of APOA5;
[0043] (2) Inhibit the expression of APOA5;
[0044] (3) Reduce the secretion (amount) of APOA5;
[0045] (4) Inhibit the secretion of APOA5;
[0046] (5) Reduce the activity of APOA5, etc.
[0047] Exemplarily, the drug includes or is a PD-L1 inhibitor.
[0048] Unless otherwise specified, the term "PD-L1 inhibitor" refers to an agent comprising a molecule that can detectably inhibit at least one function of PD-L1 directly and / or indirectly.
[0049] As used herein, the term "high expression of PD-L1" refers to a value or level of PD-L1 in a biological sample that is higher than the value or level of PD-L1 detected in a biological sample obtained from a healthy or wild-type (normal) individual, where PD-L1 indicates an abnormal process, disease, or other disease condition in an individual, or a marker thereof. In addition, the term "high expression" may refer to a "differential level" or "differential value" or "differential expression" compared to a "normal" expression level or value of PD-L1, and may include both quantitative and qualitative differences in expression levels.
[0050] In some embodiments, the PD-L1 inhibitor is a macrophage PD-L1 inhibitor.
[0051] The inventors of this application have also discovered a method for knocking down APOA5 to reduce macrophage inflammatory responses by inhibiting PD-L1. Because PD-L1 can affect T cells by binding to PD-1, causing T cell dysfunction and leading to immunosuppression, and can also cause multiple cell damage and dysfunction through endogenous intracellular effects, exacerbating inflammation, another aspect of this application aims to reveal how APOA5 regulates the endogenous effects of PD-L1 on macrophages. Immunofluorescence staining revealed reduced PD-L1 expression and decreased secretion of inflammatory factors in macrophages from APOA5-knockdown mice.
[0052] The study also revealed that inhibiting APOA5, in turn, inhibits the hepatocyte-damaging effects of overexpression of PD-L1 in macrophages. Furthermore, a PD-L1 knockdown macrophage cell line was constructed. Using cell co-culture, it was found that knocking down PD-L1 reduced hepatocyte apoptosis in an LPS-induced acute liver injury model. This suggests that APOA5 could serve as a target for inhibiting hepatocyte damage caused by overexpression of PD-L1 in macrophages.
[0053] It should be understood that the APOA5 inhibitor can exert its effect in any manner and can directly or indirectly reduce and / or inhibit at least one of the expression, secretion and activity of APOA5.
[0054] In some embodiments, the APOA5 inhibitor causes the entire or partial deletion of the gene expressing apolipoprotein A5 (gene Apoa5) by gene knockout, gene knockdown, sequence point mutation, or sequence point deletion; the gene Apoa5 includes itself and its homologous genes or alleles.
[0055] Unless otherwise specified, the term "gene knockout" in this application refers to the permanent inactivation of a target gene in a cell or organism by completely disrupting its function. For example, homologous recombination (such as CRISPR-Cas9, TALENs, or ZFNs) is used to introduce double-strand breaks (DSBs) into the genome, which are then deleted or inserted into the gene coding region or key exons through non-homologous end joining (NHEJ) or homology-directed repair (HDR), rendering the gene unable to be expressed or producing a non-functional protein.
[0056] Unless otherwise specified, the term "gene knockdown" in this application may refer to temporarily reducing the level of gene expression by interfering with the stability or translation of mRNA, for example, by RNA interference (introducing siRNA or shRNA that complementary binds to the target mRNA and guides the RISC complex to degrade the mRNA).
[0057] Unless otherwise specified, the term "sequence point mutation" in this application refers to the introduction of single or multiple base substitutions into a DNA sequence, which may result in an amino acid change or a silent mutation. For example, precise editing can be achieved using CRISPR-Cas9 or base editors (e.g., CBEs, ABEs, etc.).
[0058] In some embodiments, the APOA5 inhibitor uses monoclonal antibodies against APOA5, polyclonal antibodies against APOA5, small molecule compounds, natural extracts, CRISPR / Cas technology, SiRNA technology, or technology that changes the APOA5 promoter region to inhibit the activity of the gene Apoa5 and / or reduce the expression level of APOA5.
[0059] Unless otherwise specified, the term "small molecule compound" in this application refers to organic or inorganic compounds with a relatively small molecular weight (usually less than 1000 Daltons, i.e., <1000 Da). These compounds have a well-defined chemical structure and can be obtained through chemical synthesis or natural extraction.
[0060] CRISPR / Cas technology is a highly efficient and precise gene editing tool inspired by bacterial immune defense mechanisms. Its core approach is to use guide RNA (gRNA) to direct the Cas9 protein to the target DNA sequence, cutting specific gene sites to achieve gene knockout, insertion, or modification.
[0061] siRNA technology is a method to silence the expression of specific genes through the RNA interference (RNAi) mechanism.
[0062] Exemplarily, the APOA5 inhibitors in the present application include, but are not limited to, one or more of gene editing reagents for knocking out or knocking down the gene Apoa5, RNA interference reagents for silencing or downregulating the gene Apoa5, small molecule inhibitors or natural extracts targeting the gene Apoa5, antibodies targeting APOA5, and compounds that inhibit APOA5 secretion.
[0063] Using APOA5 as a screening target, we found that metformin can inhibit the secretion of APOA5 under inflammatory stimulation, inhibit the expression of PD-L1 in liver macrophages, and thus treat SALI.
[0064] It has been confirmed that metformin can inhibit the secretion of APOA5 by the liver under LPS stimulation, reduce the expression of PD-L1 in liver macrophages, and improve LPS-induced acute liver injury. This application provides a new application for the wide application of metformin in clinical treatment.
[0065] In some embodiments, the APOA5 inhibitor includes or is metformin.
[0066] The chemical name of metformin is 1,1-dimethylbiguanidine (N,N-Dimethylimidodicarbonimidicdiamide), and its molecular formula is C4H 11 N5. Currently, it is mainly used to treat diabetes and is a first-line drug for treating type 2 diabetes.
[0067] It can be understood that the liver diseases associated with high PD-L1 expression include liver diseases associated with high PD-L1 expression in macrophages, such as, for example, liver damage, liver dysfunction, liver failure and liver immune inflammation.
[0068] The liver injury may be, for example, septic liver injury, or further may be septic acute liver injury, such as lipopolysaccharide-induced septic acute liver injury.
[0069] One aspect of the present application provides that targeted inhibition of APOA5 expression can serve as an alternative approach for PD-L1 inhibitors.
[0070] The PD-L1 pathway inhibitor BMS-1 inhibits the binding of PD-1 by inhibiting the changes in the PD-L1 structure. This application found that this drug can also alleviate SALI. By injecting BMS-1 in vivo, it was found that the APOA5 knockout effect was similar to that of BMS-1, both of which can alleviate liver damage and reduce PD-L1 expression. Therefore, it provides an alternative path for targeted inhibition of APOA5 expression as a PD-L1 pathway inhibitor.
[0071] Another aspect of the present application provides the use of an APOA5 inhibitor as a PD-L1 inhibitor in the preparation of a medicament for preventing and treating liver disease. The functions of the APOA5 inhibitor and the mechanism by which it exerts its functions can be found in the above content.
[0072] Unless otherwise specified, the term "prevention and treatment" in this application refers to prevention and / or treatment, bringing about positive physiological and / or pharmacological effects, such as but not limited to improving symptoms, alleviating symptoms, slowing or delaying disease progression or preventing disease.
[0073] The present application also provides a drug combination for treating acute liver injury caused by sepsis, which comprises an APOA5 inhibitor.
[0074] In some embodiments, the medicament further comprises BMS-1.
[0075] BMS-1 (1675201-83-8) is a small molecule inhibitor that primarily targets the PD-1 / PD-L1 immune checkpoint pathway and is an immunotherapy drug.
[0076] The drug combinations described herein may be mixed in a single formulation, such as a pharmaceutical composition, or provided in separate formulations for combined administration. For example, the combined administration may be administered to a subject simultaneously or at different times, such as sequentially within the same time period, or by administering one formulation followed by the other formulation at a specific time interval.
[0077] In some embodiments, the pharmaceutical combination is in the form of a pharmaceutical composition. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.
[0078] Unless otherwise specified, the carriers and excipients used in this application include any and all solvents, diluents or other liquid excipients, dispersants or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc. that are suitable for the desired specific dosage form. In Remington: The Science and Practice of Pharmacy, 2005, ed. DB Troy, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and JC Boylan, 1988-1999, Marcel Dekker, New York, various carriers for preparing pharmaceutically acceptable compositions and known techniques for their preparation are disclosed, and their contents are all incorporated into this application by reference.
[0079] Another aspect of the present application provides a method for screening a drug for regulating the homeostasis of the liver immune-inflammatory microenvironment, the method comprising:
[0080] administering the drug candidate to an animal model with immune inflammation of the liver;
[0081] After the candidate drug takes effect, at least one of the expression, secretion and activity of APOA5 in the liver cells of the animal model is measured.
[0082] Without wishing to be bound by any theory, it is believed that if at least one of the expression, secretion and activity of APOA5 in the liver cells of the animal model is reduced, it is preliminarily believed that the candidate drug has a certain therapeutic effect. For example, it can act as an APOA5 inhibitor to reduce the inflammatory response of liver macrophages by inhibiting PD-L1, thereby effectively regulating the homeostasis of the liver immune inflammatory microenvironment.
[0083] Another aspect of the present application is the use of an APOA5 inhibitor in the preparation of a drug for reducing macrophage inflammatory factors and / or reducing hepatocyte apoptosis, wherein the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of APOA5.
[0084] Another aspect of the present application provides a method for treating liver diseases, comprising administering a therapeutically effective amount of the above-mentioned drug combination or APOA5 inhibitor to a subject.
[0085] "Therapeutically effective amount" may refer to any amount that, when administered to a subject with liver disease, can effectively act to cause reduction, alleviation, or recovery of the disease.
[0086] The term "subject" means any mammal, including mice, rabbits, and humans. In some embodiments, the subject is a human. The terms "individual" or "patient" are interchangeable with "subject." In some embodiments, the subject has a liver disease as defined above.
[0087] Some examples are provided below.
[0088] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and may also be based on the experimental manuals or conventional conditions in this area, or on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0089] Example 1. This example is a study on the treatment of acute liver injury caused by sepsis by inhibiting APOA5
[0090] 1.1 Experimental Materials
[0091] Male C57BL / 6N wild-type (WT) mice and Apoa5 knockout mice (Apoa5 - / - ), age 8-12 weeks; lipopolysaccharide (LPS).
[0092] 1.2 Experimental methods
[0093] Survival experiments were performed with WT and Apoa5 - / - Mice were intraperitoneally injected with a lethal dose (15 mg / kg) of LPS and observed for seven days. The method for establishing a sepsis-induced acute liver injury model was as follows: mice were intraperitoneally injected with 5 mg / kg of LPS from Escherichia coli O111: B4. Liver and serum were collected 24 hours after injection. Serum was tested for liver injury indicators ALT and AST, and liver tissue was stained with HE. Groups were divided into WT control group, WT model group, Apoa5 - / - Control group, Apoa5 - / - Model group.
[0094] 1.3 Experimental Results
[0095] Figure 1 A description of Apoa5 - / - The mice survived longer; Figure 1 B and C show that Apoa5 - / - The liver damage in mice was significantly improved, so it can be concluded that inhibition of APOA5 can improve acute liver injury induced by sepsis.
[0096] Example 2. This example studies the effect of inhibiting APOA5 on PD-L1 in acute liver injury caused by sepsis.
[0097] 2.1 Experimental Materials
[0098] WT and Apoa5 - / - Mouse, LPS, F4 / 80 (macrophage marker) antibody, PD-L1 antibody, three-color fluorescent staining kit.
[0099] 2.2 Experimental methods
[0100] WT and Apoa5 were extracted separately - / - Single-cell sequencing (scRNA-seq) of non-parenchymal liver cells from the control and LPS model groups was performed using the 10× Genomics platform. Immunofluorescence staining of the livers of the four groups of mice was performed to label PD-L1 and F4 / 80 and analyze their co-localization.
[0101] 2.3 Experimental Results
[0102] Figure 2 Middle A is the result of single-cell sequencing analysis, showing that in the SALI model, Apoa5 - / - PD-L1 (encoded by Cd274) expression is reduced in mouse liver macrophages, especially monocyte-derived macrophages (MoMFs); Figure 2 Immunofluorescence staining colocalization analysis in Figure B further confirmed the results of single-cell sequencing. Therefore, it was concluded that inhibition of APOA5 could inhibit PD-L1 expression in monocyte-derived macrophages.
[0103] Example 3. This example is a study on the liver damage caused by inhibiting PD-L1.
[0104] 3.1 Experimental Materials
[0105] RAW264.7 macrophage cell line, AML12 hepatocyte cell line, LPS, Cd274 lentivirus, caspase3 antibody.
[0106] 3.2 Experimental methods
[0107] RAW264.7 cells were seeded onto 12-well plates containing lenti-Cd274-shRNA (CCGAAATGATACACAATTCGA, SEQ ID NO: 1) or lenti-NC (MOI = 100) for 72 hours. Stable transfected cells, namely the lentiviral-transfected RAW264.7 shCd274 cell line, were then selected with puromycin (5 μg / mL) and co-cultured with the AML12 hepatocyte line. shCd274 RAW264.7 cells were treated with 100 ng / mL LPS for 24 hours, and protein samples were collected for Western blot experiments.
[0108] 3.3 Experimental Results
[0109] Figure 3 The results showed that knockdown of PD-L1 (encoded by Cd274) in RAW264.7 cells reduced caspase-3 expression in AML12 hepatocytes stimulated by LPS. This suggests that knockdown of PD-L1 in RAW264.7 macrophages can reduce damage to AML12 hepatocytes and reduce apoptosis in these cells under LPS stimulation. Therefore, it can be concluded that inhibition of PD-L1 can reduce apoptosis in septic hepatocytes and thereby improve acute liver injury caused by sepsis.
[0110] Example 4. This example is a study comparing the effects of APOA5 inhibition and PD-L1 inhibitors on improving liver damage.
[0111] 4.1 Experimental Materials
[0112] WT and Apoa5 - / - Mouse, LPS, BMS-1 (PD-L1 inhibitor), F4 / 80 antibody, PD-L1 antibody, three-color fluorescent staining kit.
[0113] 4.2 Experimental methods
[0114] WT and Apoa5 - / - One and a half hours after LPS treatment, mice were intraperitoneally injected with PD-L1 inhibitor BMS-150 μg. 24 hours after LPS injection, liver and serum were collected. Serum was tested for liver damage indicators ALT and AST, and liver tissue was stained with HE and PD-L1 and F4 / 80 immunofluorescence. - / - Model group, WT BMS-1 treatment group, Apoa5 - / - BMS-1 treated group.
[0115] 4.3 Experimental Results
[0116] Figure 4Middle A shows that the PD-L1 inhibitor BMS-1 reduces the levels of ALT and AST in the serum of mice with LPS-induced acute liver injury, indicating that the effect of the PD-L1 inhibitor BMS-1 in reducing macrophage PD-L1 is similar to that of APOA5 knockdown, and that inhibition of APOA5 more significantly reduces the increase in macrophages caused by LPS; Figure 4 Figures B and C show that both the PD-L1 inhibitor BMS-1 and APOA5 inhibition reduced liver injury scores and the colocalization of F4 / 80 and PD-L1 in the LPS-induced acute liver injury model, indicating that the PD-L1 inhibitor BMS-1 can improve LPS-induced acute liver injury, an effect similar to that of APOA5 knockdown. Therefore, it is concluded that inhibition of APOA5 to antagonize PD-L1 and thus treat SALI has a similar therapeutic effect to PD-L1 inhibitors, and it has the potential to replace PD-L1 inhibitors.
[0117] Example 5. This example studies the effect of metformin on inhibiting APOA5 on SALI and PD-L1.
[0118] 5.1 Experimental Materials
[0119] WT mice, metformin (Met), LPS, F4 / 80 antibody, PD-L1 antibody, and three-color fluorescent staining kit.
[0120] 5.2 Experimental methods
[0121] WT mice were first intraperitoneally injected with 5 mg / kg LPS, followed by 100 mg / kg metformin 1 hour later. Liver and serum samples were collected 24 hours later. Serum samples were assayed for ALT, AST, and APOA5 ELISAs, while liver tissue was stained with HE and immunofluorescence staining for colocalization of PD-L1 and F4 / 80.
[0122] 5.3 Experimental Results
[0123] Figure 5 Middle A shows that metformin can inhibit the increase of serum APOA5 levels induced by LPS; Figure 5 Middle BC showed that ALT and AST in the serum of mice decreased after metformin injection, indicating that metformin could alleviate SALI after inhibiting APOA5; Figure 6 The results showed that metformin reduced the colocalization of F4 / 80 and PD-L1 in the LPS-induced acute liver injury model, indicating that metformin can inhibit the LPS-induced increase in PD-L1 levels in macrophages. Therefore, it is concluded that metformin can antagonize the increase in PD-L1 levels and improve SALI by inhibiting APOA5.
[0124] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0125] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the patent in this application shall be determined by the appended claims, and the specification and drawings shall serve to interpret the claims.
Claims
1. Use of an apolipoprotein A5 (APOA5) inhibitor in the preparation of a medicament for preventing or treating liver diseases associated with overexpression of PD-L1; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion, and activity of APOA5.
2. The use according to claim 1, characterized in that The drugs for preventing and treating liver diseases associated with high PD-L1 expression include PD-L1 inhibitors; Optionally, the PD-L1 inhibitor is a macrophage PD-L1 inhibitor.
3. The use according to claim 1, characterized in that The APOA5 inhibitor causes the entire or partial deletion of the gene expressing apolipoprotein A5 (gene Apoa5) by gene knockout, gene knockdown, sequence point mutation or sequence point deletion; the gene Apoa5 includes itself and its homologous genes or alleles; And / or, the APOA5 inhibitor uses a monoclonal antibody against APOA5, a polyclonal antibody against APOA5, a small molecule compound, a natural extract, CRISPR / Cas technology, SiRNA technology or technology for changing the APOA5 promoter region to inhibit the activity of the gene Apoa5 and / or reduce the expression level of APOA5.
4. The use according to claim 3, characterized in that The APOA5 inhibitor includes one or more of a gene editing agent that knocks out or knocks down the Apoa5 gene, an RNA interference agent that silences or downregulates the Apoa5 gene, a small molecule inhibitor or natural extract targeting the Apoa5 gene, an antibody targeting APOA5, and a compound that inhibits APOA5 secretion; Optionally, the APOA5 inhibitor includes or is metformin.
5. The use according to any one of claims 1 to 4, characterized in that The liver disease associated with high PD-L1 expression includes a liver disease associated with high PD-L1 expression in macrophages; Optionally, including liver damage, liver dysfunction, liver failure and liver immune inflammation; The liver injury may be septic liver injury, and the septic liver injury may be septic acute liver injury, such as lipopolysaccharide-induced septic acute liver injury.
6. Use of an APOA5 inhibitor as a PD-L1 inhibitor in the preparation of a medicament for preventing or treating liver disease; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion, and activity of APOA5; Optionally, the liver disease includes liver damage, liver dysfunction, liver failure and liver immune inflammation; The liver injury may be septic liver injury, and the septic liver injury may be acute septic liver injury, such as lipopolysaccharide-induced acute septic liver injury; Optionally, the APOA5 inhibitor causes the entire or partial deletion of the gene expressing apolipoprotein A5 (gene Apoa5) by gene knockout, gene knockdown, sequence point mutation or sequence point deletion; the gene Apoa5 includes itself and its homologous genes or alleles; Optionally, the APOA5 inhibitor uses monoclonal antibodies against APOA5, polyclonal antibodies against APOA5, small molecule compounds, natural extracts, CRISPR / Cas technology, SiRNA technology or technology for changing the APOA5 promoter region to inhibit the activity of the gene Apoa5 and / or reduce the expression level of APOA5.
7. The use according to claim 6, characterized in that The APOA5 inhibitor includes one or more of a gene editing agent that knocks out or knocks down the Apoa5 gene, an RNA interference agent that silences or downregulates the Apoa5 gene, a small molecule inhibitor or natural extract targeting the Apoa5 gene, an antibody targeting APOA5, and a compound that inhibits APOA5 secretion; Optionally, the APOA5 inhibitor includes or is metformin.
8. A drug combination for treating acute liver injury caused by sepsis, characterized in that: It comprises an APOA5 inhibitor; the APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of apolipoprotein A5 (APOA5), and BMS-1; Optionally, the APOA5 inhibitor is as defined in claim 3 or 4.
9. A method for screening drugs that regulate the homeostasis of the liver immune inflammatory microenvironment, characterized in that: The method comprises: administering the drug candidate to an animal model with immune inflammation of the liver; After the candidate drug takes effect, at least one of the expression, secretion and activity of APOA5 in the liver cells of the animal model is measured.
10. Use of an APOA5 inhibitor in the preparation of a drug for reducing macrophage inflammatory factors and / or reducing hepatocyte apoptosis, characterized in that: The APOA5 inhibitor reduces and / or inhibits at least one of the expression, secretion and activity of APOA5; Optionally, the APOA5 inhibitor is as defined in claim 3 or 4.