Application of circRNA inhibitor in preparation of medicine for treating diabetic nephropathy

Abstract

The invention discloses application of a circRNA inhibitor in preparation of a medicine for treating diabetic nephropathy, and belongs to the field of biological medicine. Aiming at circRNA with a nucleotide sequence as shown in SEQ ID NO.1, the invention provides interfering RNA with a sequence as shown in SEQ ID NO.2-3 as a circRNA inhibitor, and provides application of the circRNA in preparation of medicines for treating diabetic nephropathy. Experimental results show that in high glucose-induced kidney podocytes, the circRNA inhibitor provided by the invention can efficiently reduce the expression level of the circRNA, improve the activity of the kidney podocytes, repair the aging level of the kidney podocytes, inhibit the migration level of the podocytes and control the apoptosis process of the kidney podocytes. The invention provides a new drug target and drug for treatment of diabetic nephropathy, and has great medical significance and wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of a circRNA inhibitor in the preparation of a drug for treating diabetic nephropathy. Background Art

[0002] Diabetes mellitus is a group of metabolic diseases characterized by chronic hyperglycemia, caused by multiple factors. It is caused by defects in insulin secretion and / or utilization and is characterized by impaired sugar, protein, and fat metabolism. Long-term metabolic disturbances lead to multi-system organ damage and failure, ultimately leading to serious complications. Diabetic nephropathy (DN) is one of the more common and serious complications, affecting approximately 40% of diabetic patients. The disease is characterized by damage to the glomeruli and blood vessels, leading to proteinuria, hypertension, and renal failure. Common treatments for DN include blood sugar control, blood pressure control, lipid management, smoking cessation, regular testing, lifestyle changes, and medications, but some patients still develop renal failure.

[0003] Non-coding RNA (ncRNA) performs a variety of biological functions in the human body and is involved in the development and progression of diabetes-related complications. Circular RNA (circRNA) is particularly well-regarded due to its relatively stable structure and resistance to degradation, making it a crucial regulator of gene expression. CircRNAs are rich in microRNA (miRNA) binding sites and can act as competitive endogenous RNAs for miRNAs, regulating the expression of downstream target genes. For example, circRNA_0076631 has been shown to act as a competitive endogenous RNA for miR-214, regulating the expression of factors in the pyroptosis signaling pathway and mediating the development of macrovascular complications in diabetes.

[0004] However, there are no reports on the use of circRNA as a target for the preparation of drugs for treating diabetic nephropathy. Therefore, there is an urgent need to provide a circRNA inhibitor that is highly effective in treating diabetic nephropathy to delay disease progression in patients with diabetic nephropathy. Summary of the Invention

[0005] The purpose of the present invention is to provide a circRNA inhibitor for use in the preparation of a drug for treating diabetic nephropathy, so as to solve the problems existing in the above-mentioned prior art. The circRNA inhibitor provided by the present invention can efficiently increase the activity of renal podocytes, repair the aging level of renal podocytes, inhibit the migration level of podocytes and control the apoptosis process of renal podocytes, and has great medical significance and broad application prospects.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of a circRNA as a drug target in the preparation of a drug for treating diabetic nephropathy, wherein the nucleotide sequence of the circRNA is shown in SEQ ID NO.1.

[0008] The present invention also provides a use of a circRNA inhibitor in the preparation of a drug for treating diabetic nephropathy, wherein the nucleotide sequence of the target circRNA of the circRNA inhibitor is shown in SEQ ID NO.1.

[0009] Preferably, the circRNA inhibitor is an interfering RNA of the target circRNA.

[0010] Preferably, the nucleotide sequence of the sense strand of the interfering RNA is shown as SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.3.

[0011] Preferably, the interfering RNA treats diabetic nephropathy by increasing the activity of renal podocytes, repairing the aging level of renal podocytes, inhibiting the migration level of podocytes and controlling the apoptosis process of renal podocytes.

[0012] The present invention also provides a drug for treating diabetic nephropathy, which contains a circRNA inhibitor as a main active ingredient;

[0013] The nucleotide sequence of the target circRNA of the circRNA inhibitor is shown in SEQ ID NO.1.

[0014] Preferably, the circRNA inhibitor is an interfering RNA of the target circRNA.

[0015] Preferably, the nucleotide sequence of the sense strand of the interfering RNA is shown as SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.3.

[0016] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0017] Preferably, the dosage form of the drug is an injection.

[0018] The present invention discloses the following technical effects:

[0019] The present invention provides interfering RNAs with sequences such as SEQ ID NO.2-3 as circRNA inhibitors for circRNAs with nucleotide sequences such as SEQ ID NO.1, and provides the use of the circRNAs in the preparation of drugs for treating diabetic nephropathy. Experimental results show that in high-glucose-induced renal podocytes, the circRNA inhibitors provided by the present invention can effectively reduce the expression level of the above-mentioned circRNAs, increase the activity of renal podocytes, repair the aging level of renal podocytes, inhibit the migration level of podocytes and control the apoptosis process of renal podocytes. The present invention provides new drug targets and drugs for the treatment of diabetic nephropathy, which has great medical significance and broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 Statistical graph of the expression of mmu_circRNA_0001148 in mouse podocytes induced by high glucose; Control is the control group; HG is the high glucose induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group; compared with the control group, **P<0.01; compared with the high glucose induced group, ### P < 0.001;

[0022] Figure 2 Statistical diagram of the effect of mmu_circRNA_0001148_si on the proliferation of podocytes induced by high glucose in mice; Control is the control group; HG is the high glucose induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group; compared with the control group, ***P<0.001; compared with the high glucose induced group, ## P < 0.01;

[0023] Figure 3 Figure 2 is a microscopic observation of the effect of mmu_circRNA_0001148_si on high glucose-induced podocyte senescence in mice; Control is the control group; HG is the high glucose-induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group;

[0024] Figure 4Statistical diagram of the effect of mmu_circRNA_0001148_si on podocyte senescence induced by high glucose in mice; Control is the control group; HG is the high glucose induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group; compared with the control group, ***P<0.001; compared with the high glucose induced group, # P < 0.05;

[0025] Figure 5 Figure 2 is a microscopic observation of the effect of mmu_circRNA_0001148_si on podocyte migration induced by high glucose in mice; Control is the control group; HG is the high glucose-induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group;

[0026] Figure 6 Statistical graph of the effect of mmu_circRNA_0001148_si on podocyte migration in mice induced by high glucose; Control is the control group; HG is the high glucose induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group; compared with the control group, ***P<0.001; compared with the high glucose induced group, # P < 0.05;

[0027] Figure 7 Microscopic observation of the effect of mmu_circRNA_0001148_si on high glucose-induced mouse podocyte apoptosis; Control is the control group; HG is the high glucose-induced group; HG+mmu_circRNA_0001148_si is the circRNA inhibitor treatment group. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The circRNA of the present invention is named mmu_circRNA_0001148, and its nucleotide sequence is shown in SEQ ID NO.1.

[0034] SEQ ID NO.1:

[0035] GTTCCCAGTCAGCTTCCGATAAACCTTCCCAGCGATCATCAGAAAGCACAAATTGTAGCCCTACTCGTAAAAGGTCTTCATCTGAGAGTACTTCTTCAACAGTGAATGGAGTTCCTTCCAGAAGTCCCAGATTGGTTGCTTCTATGGATGATTCTGTAGACAGTCTGTTGCAGCGGATAGTACATCACGATGAGCAAGAGTCCATGGAGAAAAACGGTGATGCTTCCATTACAACTGTGTCTGCACCACCTTCTTCCAGTCCAGGCCATAGCTACAGCAAGGAGCGAGCCTTAGGTAAATCAGACAGCCTTCTAGTGCCTGCAGTCCCGAATGACTCTTGCAGTAATATCCCACTTCTTTCTGAAAAGTCAGCAAGTAGGTGTTCCCCCCATCACATCAAGAGAAGTGTAGTTGAAGCTATGCAACGCCAAGCTCGGAAAATGTGCAATTATGACAAAATCTTGGCCACCAAGAAAAACCTGGACCATGTTAATAAAATTTTAAAAGCCAAAAAACTTCAAAGGCAGGCCAGGACAGGAAACAATTTTGTGAAACGCAGACCAGGTCGACCTCGGAAATGCCCCCTCCAAGCAGTGGTGTCAATGCAAGCCTTCCAGGCCGCCCAGTTTGTCAGCCCGGAATTGAATGAAGGCGAAGACATGTCCCTGCACCTAAGTCCAGACACAGTCACTGATGTGATCGAGGCTGTGGTTCAGAGTGTGAACCTCACTTCAGAACATAAGAAGGGGGTGAAGAGGAAAAATTGGCTGTTAGAAGAACAGACTAGGAAAAAGCAGAAGACAGTACCAGAGGAAGAAGAGCAAGAAAACAATAAAAG。

[0036] The interfering RNA (mmu_circRNA_0001148_si) of mmu_circRNA_0001148 of the present invention includes a sense strand and an antisense strand, and their nucleotide sequences are respectively shown in SEQ ID NO.2-3:

[0037] mmu_circRNA_0001148-si sequence:

[0038] Sense strand: AACAAUAAAAGGUUCCCAGTT (SEQ ID NO. 2);

[0039] Antisense strand: CUGGGAACCUUUUAUUGUUTT (SEQ ID NO 3).

[0040] The cell source of the present invention is mouse kidney podocytes (MPC-5) purchased from Shanghai Fuheng Biotechnology Co., Ltd.

[0041] MPC-5 cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco), 1% penicillin-streptomycin (HyClone), and 4.5 mmol / L D-glucose at 37°C and 5% CO2 in a constant temperature and humidity environment. Fresh medium was replaced every 48 h.

[0042] Transfection experiments were performed using 6-well culture plates (Corning) with 5×10 4 MPC-5 cells were seeded at a cell / well density and transfected when the confluency reached 30%-50%. According to the manufacturer's operating instructions, 3 μL of 20 μM mmu_circRNA_0001148-si (Herui Biotechnology) was mixed with 9 μL of RNAFit transfection reagent (Herui Biotechnology) in 200 μL of serum-free 4.5 mmol / L D-glucose DMEM, gently pipetted to mix, and incubated at room temperature for 15 minutes; at the same time, the well plate medium was replaced with 0.8 mL of serum-free 4.5 mmol / L D-glucose DMEM. The transfection complex was added to the well plate, and after 6 hours, 1 mL of high-glucose medium containing 10% FBS was added. After further culture for 24-48 hours, the cells were collected for subsequent analysis.

[0043] In the examples of the present invention, mouse podocytes were divided into a control group (Control), a high glucose induction group (HG), and a circRNA inhibitor treatment group (HG+mmu_circRNA_0001148_si) treated with mmu_circRNA_0001148_si after high glucose induction.

[0044] Example 1 qRT-PCR observation of the expression of mmu_circRNA_0001148 in mouse podocytes induced by high glucose

[0045] 1. Materials and Methods

[0046] Total RNA was isolated from MPC-5 cells using a tissue / cell RNA rapid extraction kit (HRbio, HR001). TM 1st Strand cDNA Synthesis SuperMix for qPCR (OneStep gDNARemoval, Herui Biotechnology, China, HR200) ​​was used for genomic DNA removal and cDNA synthesis. qPCR reactions were performed in QuantStudio TM 6Flex system (Applied Biosystems) using HRbio TM qPCR GreenMaster Mix (No Rox, Herui Biotechnology, China, HR300) was prepared according to the manufacturer's standard protocol. -ΔΔCt The specific primers used in the experiment were designed and synthesized by Shangya Biotechnology (China).

[0047] 2. Experimental Results

[0048] like Figure 1 As shown in the results, compared with the control group (Control), the expression of mmu_circRNA_0001148 in the podocytes of the mice in the high glucose induction group (HG) was significantly higher (P<0.01), and the application of mmu_circRNA_0001148 interfering RNA (mmu_circRNA_0001148_si) could significantly inhibit the expression of mmu_circRNA_0001148 in podocytes.

[0049] Example 2 CCK8 method to detect the effect of mmu_circRNA_0001148 on the proliferation ability of renal podocytes

[0050] 1. Materials and Methods

[0051] Cell Counting Kit-8 (GLPBIO, GK10001) was used to evaluate the effects of different treatments on cell viability. Briefly, successfully transfected MPC-5 cells were seeded in 96-well plates (5 × 10 cells per well). 3 After the cells adhered, 10 μL of working reagent was added to each well strictly according to the instructions. The absorbance at a wavelength of 450 nm was then quantitatively analyzed using a Thermo Scientific MultiskanMK3 microplate reader.

[0052] 2. Experimental Results

[0053] like Figure 2As shown in the results, compared with the control group (Control), the proliferation ability of renal podocytes in the high glucose induced group (HG) of mice was significantly decreased (P<0.001), and the application of mmu_circRNA_0001148 interfering RNA (mmu_circRNA_0001148_si) could effectively repair the proliferation ability of podocytes induced by high glucose (P<0.01).

[0054] Example 3 Observation of the effect of mmu_circRNA_0001148 on the senescence level of mouse podocytes induced by high glucose by β-galactosidase staining

[0055] 1. Materials and Methods

[0056] MPC-5 mouse renal podocytes (adherent) were seeded in 6-well culture plates (Corning) and cultured to the predetermined density. The cells were then stained according to the following procedure: the culture medium was discarded, the plates were gently washed once with ice-cold PBS (HyClone), and fixed for 15 min at room temperature with 1 mL of β-galactosidase fixative (Beijing Solebow, G1580). The fixative was removed, and the plates were washed three times with 1× PBS (3 min / wash). The staining working solution (Beijing Solebow, G1580) was prepared according to the reagent instructions, and 1 mL of fresh staining solution was added to each well. The plates were incubated at 37°C in the dark for 16 h (sealed with sealing film, Thermo Scientific). The formation of blue precipitate was observed using an inverted microscope, and three random fields of view were selected for quantitative analysis.

[0057] 2. Experimental Results

[0058] β-galactosidase is the earliest and most widely used lysosomal aging marker. It can increase lysosomal biogenesis in aging cells and is considered to be a specific marker of cell aging and the gold standard for aging detection.

[0059] The results are as follows Figure 3 and Figure 4 As shown in the results, compared with the control group (Control), the renal podocytes of mice in the high glucose induced group (HG) showed significant senescence (P<0.001), and the application of mmu_circRNA_0001148 interfering RNA (mmu_circRNA_0001148_si) could effectively repair the senescence level of podocytes induced by high glucose (P<0.05).

[0060] Example 4 Cell scratch assay to observe the effect of mmu_circRNA_0001148 on the senescence level of mouse podocytes induced by high glucose

[0061] 1. Materials and Methods

[0062] MPC-5 cells were transfected and cultured in 6-well plates until the confluence reached 90%. A 200 μL sterile pipette tip (Axygen) was used to create a linear scratch perpendicular to the bottom of the well plate, followed by gentle washing three times with pre-chilled PBS (HyClone) to remove suspended cells and debris. The culture medium was replaced with low-serum DMEM medium (Gibco) containing 1% FBS and incubated in a 37°C, 5% CO2 incubator. Five field-of-view images were randomly collected by inverted phase contrast microscopy at 0 h (baseline) and 24 h after the scratch, with an image resolution of 1920 × 1440 pixels. The scratch area was quantified using ImageJ software (v1.53) equipped with the MRI Wound Healing Tool plug-in, and the cell migration rate was calculated according to the following formula:

[0063]

[0064] Among them A 0h With A 24h The experimental results were repeated three times, and the data were analyzed by Student's t test using GraphPad Prism 9.0 and grouped bar graphs were plotted.

[0065] 2. Experimental Results

[0066] like Figure 5 and Figure 6 As shown in the results, compared with the control group (Control), the cell migration area of ​​the podocytes in the high glucose induction group (HG) mice kidney was significantly increased after 24 hours (P<0.001), and the application of mmu_circRNA_0001148 interfering RNA (mmu_circRNA_0001148_si) could effectively inhibit the migration level of podocytes induced by high glucose (P<0.05).

[0067] Example 5 Annexin V / PI double staining to observe the effect of mmu_circRNA_0001148 on high glucose-induced mouse podocyte apoptosis

[0068] 1. Materials and Methods

[0069] MPC-5 cells were digested with 0.25% trypsin (EDTA-free, Sigma-Aldrich, T4049) and then terminated with DMEM (Gibco) supplemented with 10% FBS. Cells were harvested by centrifugation at 300 × g for 5 min at 4°C (Eppendorf 5430R). To avoid false positives, trypsinization was performed within 2 min. The cell pellet was washed twice with pre-chilled PBS (HyClone) (300 × g, 4°C, 5 min each) and resuspended in 100 μL of 1× Binding Buffer (Bioss Annexin V-FITC / PI Apoptosis Detection Kit, BA00101, diluted in DEPC water according to the manufacturer's instructions). Add 5 μL of Annexin V-FITC (Bioss Annexin V-FITC / PI Cell Apoptosis Detection Kit, BA00101) and 5 μL of PI staining solution (Bioss Annexin V-FITC / PI Cell Apoptosis Detection Kit, BA00101), vortex to mix, and incubate at room temperature in the dark for 15 minutes. Staining was terminated by adding 400 μL of pre-cooled Binding Buffer. Samples were immediately examined under a fluorescence microscope (Nikon Eclipse Ti2, FITC filters: Ex / Em = 488 / 530 nm, PI filters: Ex / Em = 535 / 617 nm). Ten randomly selected fields of view were collected for each sample. Early apoptotic cells were identified as FITC single-positive (green fluorescence), while late apoptotic cells were identified as FITC / PI double-positive (overlapping red and green fluorescence). The experiment was repeated three times with independent biological replicates.

[0070] 2. Experimental Results

[0071] Annexin V / PI staining results are as follows Figure 7 As shown, early apoptotic cells show only green fluorescence, while late apoptotic cells show dual staining with green and red fluorescence. Compared to the control group, the HG group showed increased red fluorescence and a significant increase in dual staining with red and green fluorescence, indicating a significant increase in the number of late apoptotic cells. The application of mmu_circRNA_0001148 interfering RNA (mmu_circRNA_0001148_si) reduced red fluorescence and dual staining with red and green fluorescence, indicating that the number of late apoptotic cells was controlled to a certain extent.

[0072] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of a circRNA as a drug target in the preparation of a drug for treating diabetic nephropathy, characterized in that: The nucleotide sequence of the circRNA is shown in SEQ ID NO.

1.

2. Use of a circRNA inhibitor in the preparation of a drug for treating diabetic nephropathy, characterized in that: The nucleotide sequence of the target circRNA of the circRNA inhibitor is shown in SEQ ID NO.

1.

3. The use according to claim 2, characterized in that The circRNA inhibitor is an interfering RNA of the target circRNA.

4. The use according to claim 3, characterized in that The nucleotide sequence of the sense strand of the interfering RNA is shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.

3.

5. The use according to claim 4, characterized in that The interfering RNA treats diabetic nephropathy by improving the activity of renal podocytes, repairing the aging level of renal podocytes, inhibiting the migration level of podocytes and controlling the apoptosis process of renal podocytes.

6. A drug for treating diabetic nephropathy, characterized in that: The main active ingredient is a circRNA inhibitor; The nucleotide sequence of the target circRNA of the circRNA inhibitor is shown in SEQ ID NO.

1.

7. The drug according to claim 6, characterized in that The circRNA inhibitor is an interfering RNA of the target circRNA.

8. The drug according to claim 7, wherein The nucleotide sequence of the sense strand of the interfering RNA is shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.

3.

9. The drug according to any one of claims 6 to 8, characterized in that The drug also includes pharmaceutically acceptable excipients.

10. The drug according to claim 9, characterized in that The dosage form of the medicine is injection.

Images