Flagellin and application thereof in plant immune resistance inducer

Abstract

The invention belongs to the technical field of plant disease control, and discloses flagellin and application thereof in a plant immune resistance inducer. The flagellin is separated and extracted from bacillus amyloliquefaciens Ba168, has better bacteriostatic activity and has an immune induction effect on tobacco. According to the invention, a gene engineering technology is utilized to realize mass expression and purification of the flagellin, and it is identified that the flagellin can induce plant immune response, plant cell necrosis, plant reactive oxygen bursting and increase of plant defensive enzyme activity. The flagellin can induce the resistance of plants to PVX, and a novel resistance inducing material is provided for prevention and treatment of PVX.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease prevention and control, and relates to flagellin and application thereof in plant immune inducers. Background Art

[0002] Plant immune inducers, also known as plant vaccines, are a new class of biopesticides that are highly safe and environmentally friendly. They can also effectively enhance plant resistance and control plant diseases. While most plant immune inducers lack bactericidal activity themselves, they stimulate the plant's immune system. Even at low concentrations, these substances can be recognized by plants as signaling substances, activating the plant's immune system and effectively resisting and preventing diseases.

[0003] The induction mechanism of plant immune inducers includes causing changes in plant hydroxyproline glycoprotein (HRGP), promoting the deposition of lignin in cell walls, thereby improving the plant's resistance. It can also accelerate the accumulation of endogenous salicylic acid (SA), which in turn forms an oxidative surge, causing local cell apoptosis and forming a hypersensitive response (HR). When plant immune inducers come into contact with plants, they can induce the plant to produce disease resistance signals and transmit them into the plant body. After signal transmission, the plant, under the regulation of a series of disease resistance-related genes, induces changes in the activity of defense enzymes such as phenylalanine ammonia lyase (PAL), peroxidase (POD), chitinase, and β-1,3-glucanase, thereby effectively resisting the invasion of pathogens and playing a protective and defensive role.

[0004] Flagellin is the main structural protein of bacterial flagella and the main part of flagellar filaments, which can give bacteria the ability to move. Flagellin helps pathogenic bacteria to chemotaxis, adhere to and invade the host surface, promotes colonization on the host, secretion of virulence factors and infiltration. Potato virus X (PVX) is widely distributed throughout the world. It has a wide host range and can infect more than 240 plant species in 16 families, mainly Solanaceae species, causing economic losses. Due to the wide host range, strong stress resistance and diverse transmission routes of PVX, the prevention and control of this disease is relatively difficult. Currently, the prevention and control of PVX disease is mostly focused on the screening and use of synthetic compounds, plant-derived antiviral agents and microbial-derived antiviral agents. There are few reports on the use of plant immune inducers to prevent and control the disease. Therefore, it is of great significance to explore a plant immune inducer that can prevent and control PVX. Summary of the Invention

[0005] To address the above technical problems, the present invention provides flagellin and its use as a plant immune inducer. This flagellin, isolated and extracted from Bacillus amyloliquefaciens Ba168, can induce plant cell necrosis, induce a burst of reactive oxygen species in plants, increase the activity of plant defense enzymes, and induce plant resistance to polymorphonuclear erythrocyte sedimentation (PVX). This invention provides a novel immune-inducing material for the prevention and treatment of PVX.

[0006] To achieve the technical objectives of the present invention, in one aspect, the present invention provides a flagellin protein, the amino acid sequence of which is shown in SEQ ID NO: 2. A protein capable of inducing a tobacco allergic reaction was isolated and extracted from Bacillus amyloliquefaciens Ba168. The protein was identified as flagellin, which has good antibacterial activity and an immune-inducing effect on tobacco.

[0007] On the other hand, the present invention claims protection for a flagellin gene, which comprises a nucleotide sequence encoding the above-mentioned flagellin, and the nucleotide sequence of the flagellin gene is shown in SEQ ID NO: 1.

[0008] On the other hand, the present invention claims protection for a plant immunity inducer, the active ingredient of which comprises the above-mentioned flagellin.

[0009] In another aspect, the present invention seeks protection for the use of the flagellin protein, or a flagellin gene, or a recombinant expression vector containing the flagellin protein, or a recombinant bacterium containing the flagellin protein, or a plant immune elicitor in inducing a plant immune response. The plant immune response includes plant cell hypersensitivity necrosis, plant reactive oxygen species burst, and increased plant defense enzyme activity.

[0010] Furthermore, the plant active oxygen burst includes accumulation of hydrogen peroxide and / or superoxide anions in the plant, and the plant defense enzymes include superoxide dismutase, peroxidase and phenylalanine ammonia lyase.

[0011] Specifically, the present invention detects the effect of flagellin on the allergic necrosis reaction of tobacco leaves and finds that treatment of tobacco leaves with flagellin solution can induce typical necrotic spots; Evans blue staining is performed on the leaf tissue infiltrated with spots at the treatment site and the absorbance value is measured. It is found that the absorbance increases significantly after 4 hours of treatment with the flagellin solution, reaches a maximum value 16 hours after treatment, and then continues to decrease. It is thus determined that the tobacco leaf cell tissue is necrotic after treatment with the flagellin solution, and is basically completely necrotic after about 24 hours; trypan blue staining is performed on the tobacco leaves with necrotic spots and it is found that the control group cannot be stained blue, while the tobacco leaves treated with flagellin can be stained blue, further verifying that flagellin can induce tobacco leaf cell death.

[0012] Specifically, the present invention examined the effect of flagellin on the reactive oxygen species burst on tobacco leaves and found that after DAB staining, flagellin-treated tobacco leaves showed a distinct brown precipitate, while the buffer-treated control tobacco leaves showed no noticeable color change, indicating that flagellin induced the accumulation of hydrogen peroxide on the tobacco leaves. After NBT staining, flagellin-treated leaves showed a distinct blue precipitate, while the control tobacco leaves showed no color, indicating that flagellin induced the accumulation of superoxide anions on the tobacco leaves.

[0013] Specifically, the present invention detected the effect of flagellin on the activity of tobacco defense enzymes and found that after spraying the flagellin solution, the activities of superoxide dismutase, peroxidase and phenylalanine ammonia lyase in the tobacco leaves were all increased, and after 5 days of treatment, the superoxide dismutase activity was 3.32 times that of the control group, after 7 days of treatment, the peroxidase activity was 5.95 times that of the control group, and after 5 days of treatment, the phenylalanine ammonia lyase activity was 5.01 times that of the control group.

[0014] Furthermore, the present invention seeks protection for the use of the flagellin, or flagellin gene, or recombinant expression vector containing the flagellin, or recombinant bacteria containing the flagellin, or plant immunity elicitor in inducing resistance in plants to viruses, including potato virus X.

[0015] Specifically, the present invention detected the effect of flagellin on the PVX resistance of tobacco and found that after the tobacco leaves were treated with flagellin solution, there were only a few striped patterns, the leaves were not obviously curled, and the symptoms were significantly milder than those of the treatment group inoculated with PVX, indicating that flagellin can induce tobacco to produce resistance to PVX, and the symptoms of tobacco in the group (P3) that was first sprayed with flagellin solution and then inoculated with PVX and the group (P5) that was first inoculated with PVX and then sprayed with flagellin were both milder, indicating that flagellin has a certain preventive and therapeutic effect on tobacco PVX disease.

[0016] Those skilled in the art can easily mutate the nucleotide sequence encoding the flagellin of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that have 75% or greater identity to the nucleotide sequence of the flagellin gene isolated from the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode flagellin and have the same function.

[0017] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to the nucleotide sequence encoding the flagellin protein set forth in SEQ ID NO: 2 of the present invention. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

[0018] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0019] Those skilled in the art can use existing expression vectors to construct a recombinant vector containing the flagellin gene. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also contain the 3' non-translated region of the foreign gene, that is, a polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor. ′ End, such as Agrobacterium crown gall induction (Ti) plasmid genes (such as nopaline synthase gene Nos), plant genes (such as soybean storage protein gene) 3 ′The non-translated regions of the ends of the transcription all have similar functions.When using the gene construction plant expression vector of the present invention, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, but must be identical with the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the start codon is extensive and can be natural or synthetic. The translation initiation region can be from a transcription initiation region or a structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene, luciferase gene), antibiotic marker genes (such as the nptII gene, which confers resistance to kanamycin and related antibiotics; the bar gene, which confers resistance to the herbicide phosphinothricin; the hph gene, which confers resistance to the antibiotic hygromycin; the dhfr gene, which confers resistance to methotrexate; and the EPSPS gene, which confers resistance to glyphosate), chemical resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes, which provide the ability to metabolize mannose. For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen transformed plants using stress.

[0020] The above-mentioned vector or expression vector can be a plasmid, cosmid, phage or viral vector.

[0021] The microorganisms may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0022] The above-mentioned transgenic plant cell lines do not include propagation materials.

[0023] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0024] (1) The present invention isolates and extracts a protein that can induce an allergic reaction in tobacco from Bacillus amyloliquefaciens Ba168. The protein is identified as flagellin, which has good antibacterial activity and an immune-inducing effect on tobacco. The present invention clones the protein gene from Bacillus amyloliquefaciens Ba168 using chromosome walking, and uses genetic engineering technology to achieve large-scale expression and purification of flagellin. Through identification, it is found that the flagellin can induce plant immune responses, improve plant resistance, and induce tobacco resistance to PVX. The present invention provides a new immune-inducing material for the prevention and treatment of PVX.

[0025] (2) The flagellin provided by the present invention can induce a plant immune response, specifically a plant cell allergic necrosis response. The present invention detected the effect of flagellin on the allergic necrosis response of tobacco leaves and found that the treatment of tobacco leaves with flagellin solution can induce the production of typical necrotic spots. Evans blue staining was performed on the infiltrated spot tissue of the treated area and the absorbance value was measured. It was found that the absorbance increased significantly after 4 hours of treatment with the flagellin solution, and the absorbance value reached a maximum value 16 hours after treatment, and then continued to decrease. It was thus determined that the tobacco leaf cell tissue was necrotic after the flagellin solution treatment, and was basically completely necrotic after about 24 hours. Trypan blue staining was performed on the tobacco leaves with necrotic spots and found that the control group could not be stained blue, while the tobacco leaves treated with flagellin could be stained blue, further verifying that flagellin can induce tobacco leaf cell death.

[0026] (3) The flagellin provided by the present invention can induce plant immune responses, specifically plant reactive oxygen species bursts. By detecting the effect of flagellin on the reactive oxygen species burst on tobacco leaves, the present invention found that after DAB staining, the tobacco leaves treated with flagellin had obvious brown precipitates, while the tobacco leaves of the control group treated with buffer showed no obvious color change, indicating that flagellin induced the accumulation of hydrogen peroxide on the tobacco leaves. After NBT staining, the leaves treated with flagellin showed obvious blue precipitates, while the tobacco leaves of the control group showed no color, indicating that flagellin induced the accumulation of superoxide anions on the tobacco leaves.

[0027] (4) The flagellin provided by the present invention can induce a plant immune response, specifically an increase in the activity of plant defense enzymes. By testing the effect of flagellin on the activity of tobacco defense enzymes, the present invention found that the activities of superoxide dismutase, peroxidase, and phenylalanine ammonia lyase in tobacco leaves increased after spraying the flagellin solution. Furthermore, after 5 days of treatment, the superoxide dismutase activity was 3.32 times that of the control group, after 7 days of treatment, the peroxidase activity was 5.95 times that of the control group, and after 5 days of treatment, the phenylalanine ammonia lyase activity was 5.01 times that of the control group.

[0028] (5) The flagellin provided by the present invention can induce plant resistance to PVX. By detecting the effect of flagellin on tobacco's PVX resistance, the present invention found that after the flagellin solution was treated, the tobacco leaves had only a small amount of striped patterns, the leaves were not obviously curled, and the symptoms were significantly milder than those in the PVX-inoculated group, indicating that flagellin can induce tobacco to produce resistance to PVX. In addition, the symptoms of tobacco in the group (P3) that was first sprayed with flagellin solution and then inoculated with PVX and the group (P5) that was first inoculated with PVX and then sprayed with flagellin were both milder, indicating that flagellin has a certain preventive and therapeutic effect on tobacco PVX disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Figure 2 is an agarose gel electrophoresis diagram of the flagellin gene. M is a DNA marker.

[0030] Figure 2 The agarose gel electrophoresis diagram of the recombinant vector after enzyme digestion.

[0031] Figure 3 The following is an SDS-PAGE analysis of the protein of the recombinant strain after IPTG induction. Lane 1 is the total protein; lane 2 is the supernatant after induction at 20°C; lane 3 is the precipitate after induction at 20°C; lane 4 is the supernatant after induction at 37°C; and lane 5 is the precipitate after induction at 37°C.

[0032] Figure 4 This is an SDS-PAGE electrophoresis analysis of flagellin purified by nickel-agarose gel affinity chromatography. M represents protein marker; lane 1 is the loading buffer; lane 2 is the flowthrough; lane 3 is the eluate after washing with 20 mM imidazole to remove impurities; lane 4 is the eluate after washing with 50 mM imidazole to remove impurities; and lane 5 is the eluate after washing with 500 mM imidazole to remove impurities.

[0033] Figure 5 The figure shows the results of the hypersensitive necrosis reaction induced by flagellin in tobacco leaves. Figure 5 A in the figure is the phenotypic diagram of the hypersensitive necrosis reaction of tobacco leaves after being treated with flagellin solution; Figure 5 B is a dynamic diagram of cell death induced by flagellin-induced hypersensitive necrosis;

[0034] Figure 5 C in the figure is the trypan blue staining image of tobacco leaves after treatment with flagellin solution; Figure 5 D in the figure is the trypan blue staining image of tobacco leaves in the control group.

[0035] Figure 6 This figure shows the effect of flagellin solution on the active oxygen burst of tobacco leaves. Figure 6 A in the figure is the DAB staining image of tobacco leaves after being treated with flagellin solution; Figure 6 B is the DAB staining image of tobacco leaves in the control group; Figure 6 C in the figure is the NBT staining image of tobacco leaves after being treated with flagellin solution. Figure 6 D in the figure is the NBT staining image of tobacco leaves in the control group.

[0036] Figure 7 This figure shows the effect of flagellin solution on the activity of tobacco leaf defense enzymes. Figure 7 A in the figure is the SOD activity curve of tobacco leaves after being treated with flagellin solution; Figure 7B in the figure is the POD activity curve of tobacco leaves after being treated with flagellin solution; Figure 7 C in the figure is the PAL activity curve of tobacco leaves after being treated with flagellin solution.

[0037] Figure 8 Figure 1 shows the results of PVX resistance induced by flagellin solution in tobacco plants. P1 is the control group; P2 is the group sprayed with flagellin solution alone; P3 is the group sprayed with flagellin solution 24 hours later and then inoculated with PVX; P4 is the group inoculated with PVX alone; and P5 is the group sprayed with flagellin solution 24 hours after inoculation with PVX. DETAILED DESCRIPTION

[0038] The technical solutions of the present invention are now described with reference to the following examples. However, the present invention is not limited to the following examples. The experimental methods and detection methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0039] Example 1

[0040] This example provides the acquisition of the flagellin gene.

[0041] The genome of Bacillus amyloliquefaciens Ba168 (deposit number CGMCC No. 6462) disclosed in patent application number CN201210342838.X was used as a template, and intermediate sequence primers 212F (CTCTTATCCAAACATCTGAGGGTG) and 988R (ATT GAAGAACTTGCTGAGGCTGT) were used for amplification. The intermediate PCR product was recovered and sequenced for verification. The PCR reaction system of the intermediate product is shown in Table 1, and the PCR program is shown in Table 2. The chromosome walking method was used to further amplify the sequence. First, the intermediate PCR product was digested with EcoR I, and then the digested product was ligated with the adapter primers P1 (GTAATACGACTCACTATAGGGC) and P2 (TCGACGGCCCGGGCTGGTAG CT) using T4 ligase to form a fragment. The fragment was used as a template and amplified using the adapter primers P1 / P2 and the walking primers R1 (TTTTGCGCAGTTCCGTCAAGAAGTT) / R2 (TCGTATTGAACTCAGTGTCAGTAGAGATTCTTGT) to obtain the first round of walking PCR products. The PCR reaction system of the walking product is shown in Table 3, and the PCR program is shown in Table 4. The PCR product was used as a template and amplified using the adapter primers P1 / P2 and the walking primers R1 / R2 to obtain the PCR product. The PCR reaction system of the walking product is shown in Table 3, and the PCR program is shown in Table 4. The PCR product was subjected to agarose gel electrophoresis, and a 1000 bp band consistent with the expected size was obtained ( Figure 1 ), the nucleotide sequence of the target product is shown in SEQ ID NO: 1, and the target band is detected by agarose gel electrophoresis and recovered to obtain the target DNA fragment.

[0042] Table 1 PCR reaction system of intermediate products

[0043]

[0044]

[0045] Table 2 PCR program for intermediate products

[0046]

[0047] Table 3 PCR reaction system of transfer products

[0048]

[0049] Table 4 PCR program for step 4 products

[0050]

[0051] Example 2

[0052] This example provides the construction of a flagellin expression vector and recombinant bacteria.

[0053] The target DNA fragment recovered and purified in Example 1 was ligated with the pET30a vector. The ligation system consisted of 8.5 μL of seamless cloning mixture, 4 μL of pET30a vector, 4 μL of the recovered and purified target DNA fragment, and ddH₂O to 20 μL. The ligation reaction was carried out in a PCR instrument at 50°C for 1 hour. The fragment was then transformed into Rosetta (DE3) competent cells, and positive clones were screened and sent to Shanghai Sangon Biotechnology Service Co., Ltd. for sequencing. Plasmid DNA was extracted from the correctly sequenced bacterial solution using a plasmid extraction kit (SanPrep Column-Based Plasmid DNA Miniprep Kit).

[0054] The plasmid and pET30a vector with correct sequencing were double-digested with restriction endonucleases NcoI and XhoI, respectively. The enzyme digestion system was: 4 μg plasmid DNA, 4 μg pET30a vector, 5 μL FD Buffer (10×), 0.5 μL restriction endonuclease NcoI (10 U / μL), 0.5 μL restriction endonuclease XhoI (10 U / μL), ddH2O was added to 50 μL, and the mixture was reacted in a constant temperature water bath at 37°C for 2 h. After enzyme digestion, agarose gel electrophoresis was performed ( Figure 2 ) and recovered the digested vector and target DNA fragment. PCR and enzyme digestion results revealed that the target DNA fragment had been successfully introduced into the prokaryotic expression vector pET30a, and the size of the target DNA fragment was consistent with the gene coding region. The target DNA fragment was recovered from gel excision and ligated to the pET30a(+) vector using T4 DNA ligase. The ligation product was transformed into Rosetta (DE3) competent cells to generate recombinant bacteria. Plasmid DNA from the recombinant bacteria was extracted and analyzed by PCR, confirming that the target vector contained the target DNA fragment, thus obtaining a recombinant vector that met the requirements.

[0055] Example 3

[0056] This example provides the inducible expression and purification of the fusion protein.

[0057] 1. Inducible expression of fusion protein

[0058] Take 1 μL of recombinant bacteria, heat shock at 42°C for 90 seconds, let it stand on ice for 5 minutes, and then spread it in LB liquid medium containing 30 μg / mL kanamycin and 34 μg / mL chloramphenicol at a final concentration of 37°C and 220 rpm overnight. Then dilute the culture medium at a ratio of 1:100 and culture at 37°C and 220 rpm until the OD 600When the concentration was 0.6, 0.5 mM IPTG was added, the concentration was maintained at 220 rpm, and two temperatures (20 ° C and 37 ° C) were set for overnight induction to investigate the induction effect of different temperatures. After 4 hours of overnight induction, the negative control was set without adding IPTG. The centrifuge was centrifuged at 4000 rpm for 10 minutes, the cells were collected and the supernatant was removed. It was found that the highly expressed protein bands were detected in the cells ( Figure 3 ).

[0059] The collected bacteria were fully suspended with 500 μL bacterial lysis buffer (50 mM Tris, 300 mM NaCl, pH 8.0), lysozyme was added at a final concentration of 0.5 mM, and ultrasonic disruption was performed for 6 min (ultrasonication for 0.5 s and stop for 1.5 s). The supernatant and precipitate were separated and the precipitate was dissolved with 500 μL inclusion body dissolution solution (8 M Urea, 50 mM Tris-HCl, 300 mM NaCl, pH 8.0). 40 μL of sample and 10 μL of protein buffer (PBS buffer: NaCl: 8 g / L, KCl: 0.2 g / L, Na2HPO4: 1.44 g / L, KH2PO4: 0.24 g / L) were taken respectively, mixed, and boiled in a boiling water bath for 10 min. After high-speed centrifugation (12000 rpm, 5 min) at room temperature, the supernatant was taken and subjected to gel electrophoresis detection: 12% SDS-PAGE, Tris-Gly running buffer (Tris 3.0 g, glycine 14.4 g, SDS 1.0 g, fixed to 1 L) was prepared, the sample volume was 10 μL, the stacking gel voltage was 80 V for separation for 20 min, the separation gel voltage was 120 V for separation for 60 min, and the gel electrophoresis was completed with Coomassie brilliant blue staining for 20 minutes. After decolorization, the protein bands were analyzed, and it was found that the fusion protein was induced in large quantities.

[0060] 2. Purification of fusion protein

[0061] The collected bacterial cells were dissolved in disruption buffer (0.2 mM PMSF, 0.1% Triton X-100, 50 mM Tris, 300 mM NaCl, pH 8.0) and disrupted by sonication for 20 min in an ice bath (sonication for 2 s, pause for 6 s). After sonication, the cells were centrifuged at 12,000 rpm for 20 min at 4°C, and the supernatant was collected for purification.

[0062] Nickel agarose gel affinity chromatography was used to purify flagellin expressed in large quantities in Escherichia coli: 5 mL of Ni-NTA was aspirated and the column was washed and balanced with 5 times column bed Binding buffer (50 mM Tris, 300 mM NaCl, pH 8.0) at a flow rate of 5 mL / min. The sample and filler were appropriately incubated for 1 hour before being loaded onto the column and the flow-through was collected. Subsequently, impurities were washed away with Wash buffer (50 mMTris, 300 mM NaCl, 20 / 50 mM Imidazole, pH 8.0) and the eluate was collected. Elution buffer (50 mM Tris, 300 mM NaCl, 500 mM Imidazole, pH 8.0) was used to elute and the eluate was collected. The eluate was subjected to SDS-PAGE detection, and the protein fraction was dialyzed into buffer (50 mM Tris, 300 mM NaCl, pH 8.0) for SDS-PAGE electrophoresis analysis ( Figure 4 ), and the amino acid sequence of flagellin was found to be as shown in SEQ ID NO: 2. After dialysis, the solution was concentrated with PEG20000, filtered through a 0.22 μm filter membrane, and dispensed into 1 mL / tubes and stored at -80°C.

[0063] Depend on Figure 4 It can be seen that when eluted with Imidazole at different concentrations of 20, 50, and 500 mM, obvious bands appeared at 35-40 kDa, which is consistent with the size of flagellin, indicating that 20-500 mM Imidazole can better separate and purify flagellin.

[0064] Example 4

[0065] This example provides the effect of flagellin on the hypersensitive necrotic response (HR) of tobacco leaves.

[0066] The tobacco leaves were injected with 100 μg / mL flagellin solution (the eluate after elution with Wash buffer (containing 20 mM Imidazole) in Example 3). The control group was injected with Wash buffer. The injection volume was 100 μL. The tobacco leaves were observed at 0, 4, 8, 12, 16, and 24 hours after treatment. Figure 5 ) and the infiltrated leaf tissue of the treated area was stained with Evans blue and its absorbance at a wavelength of 600 nm was measured ( Figure 5 When obvious necrotic spots appear on tobacco leaves, cut off the leaves and stain them with trypan blue solution for identification ( Figure 5 ).

[0067] Depend on Figure 5 As shown in A, the treatment of tobacco leaves with flagellin solution can induce typical necrotic spots (red circles), indicating that flagellin can induce cell death on tobacco leaves. Figure 4 As shown in Figure B, the absorbance value of the control group at a wavelength of 600nm is basically stable, indicating that the tobacco leaf cell tissue is normal; the absorbance of the treatment group increased significantly 4 hours after the injection of the flagellin solution. The tobacco leaf surface can obviously absorb Evans blue, and the absorption level is increasing. The absorbance value reaches the maximum value 16 hours after the treatment, and then continues to decrease. It can be judged that the tobacco leaf cell tissue is necrotic after the flagellin solution treatment, and is basically completely necrotic around 24 hours. Figure 5 As shown in C and D, the control group cannot be stained blue, but the tobacco leaves treated with flagellin can be stained blue, which further verifies that flagellin can induce cell death on tobacco leaves.

[0068] Example 5

[0069] This example provides the effect of flagellin on the reactive oxygen species burst on tobacco leaves.

[0070] Using a needleless syringe, 50 μL of 100 μg / mL flagellin solution was injected into the stomata of healthy tobacco leaves. The injection buffer was used as the control group. After 8 hours, the leaves were cut and divided into triangular flasks. 0.5 mg / mL NBT dye solution was added to the flasks. A vacuum pump was used to allow the dye solution to penetrate the leaves. The leaves were stained for 2 hours in the dark. The stained leaves were then immersed in ethanol to remove the chlorophyll. The amount of NBT deposition in the leaves was observed and photographs were taken ( Figure 6 ). 1mg / mL DAB staining method is the same as above, observe the amount of DAB deposition in the leaves and take photos ( Figure 6 Reactive oxygen species (ROS) are important signals for elicitors to induce plant immune responses. ROS in plants include superoxide radicals, hydrogen peroxide, hydroxyl radicals, and lipid oxygen radicals. The present invention uses DAB and NBT to stain and analyze the hydrogen peroxide and superoxide anions produced by flagellin-induced tobacco leaves.

[0071] Depend on Figure 6 As can be seen, after DAB staining, the flagellin-treated tobacco leaves had a distinct brown precipitate, while the buffer-treated control tobacco leaves showed no obvious color change, indicating that flagellin induced the accumulation of hydrogen peroxide on the tobacco leaves. After NBT staining, the flagellin-treated leaves showed a distinct blue precipitate, while the control tobacco leaves showed no color, indicating that flagellin induced the accumulation of superoxide anions on the tobacco leaves.

[0072] Example 6

[0073] This example provides the effect of flagellin on the activities of tobacco defense enzymes.

[0074] Tobacco leaves were sprayed with a 100 μg / mL flagellin solution until the leaf surface was fully moistened but the solution did not flow down from the leaves. The control group was treated with a buffer solution. The changes in the activities of superoxide dismutase (SOD), peroxidase (POD), and phenylalanine ammonia lyase (PAL) on the tobacco leaves were measured 1, 3, 5, 7, 9, 11, and 13 days after spraying. The results are shown in Figure 2. Figure 7 As shown in Figure 2, superoxide dismutase (SOD) is an antioxidant enzyme that catalyzes the dismutation of superoxide anion radicals into H2O2 and O2, thereby reducing or eliminating harmful substances produced during the body's metabolism. Peroxidase, as an antioxidant enzyme, is closely related to plants' resistance to environmental influences. Phenylalanine ammonia lyase (PAL), as a plant defense enzyme, is closely related to plant resistance.

[0075] Depend on Figure 7 As shown in A, spraying flagellin solution has a significant effect on the superoxide dismutase (SOD) activity in tobacco leaves. The SOD activity curve of the flagellin solution treatment group is significantly different from that of the control group. The SOD activity of the flagellin solution treatment group is significantly increased and reaches the highest point after 5 days of treatment. The SOD activity is 3.32 times that of the control group, and then begins to gradually decline. Figure 7 As shown in Figure B, the POD activity in tobacco leaves increased significantly after flagellin solution treatment. Compared with the control group, the POD activity in tobacco leaves increased the most after 3 days of flagellin solution treatment, showing a significant statistical difference. The specific trend of POD activity was first increased and then decreased, and then slowly remained stable. The POD activity in tobacco leaves in the treatment group was higher than that in the control group, and reached the maximum value after 7 days of treatment. The POD activity in tobacco leaves was 5.95 times that of the control group. Figure 7 As shown in Figure C, compared with the control group, the PAL activity in the tobacco leaves after 5 days of treatment with flagellin solution reached a peak value, which was 5.01 times that of the control.

[0076] Example 7

[0077] This example provides information on flagellin-induced potato virus X (PVX) resistance in tobacco.

[0078] The experiment was designed with five treatments. Healthy Nicotiana benthamiana plants with 5 to 6 leaves were selected and treated as follows: P1 (control group): sprayed with buffer solution; P2: sprayed with flagellin solution; P3: sprayed with flagellin solution 24 hours later with PVX; P4: inoculated with PVX; P5: sprayed with flagellin solution 24 hours after inoculation with PVX. After treatment, the tobacco leaves were placed in a greenhouse and the disease status of the tobacco leaves was observed every day. The disease status of the tobacco leaves after 5 days of treatment was as follows: Figure 8 shown.

[0079] Depend on Figure 8 As shown, the control group (P1) and the group sprayed with flagellin solution alone (P2) grew well. Tobacco inoculated only with PVX (P4) displayed typical PVX symptoms, with severe leaf curling and delayed growth of new leaves. Tobacco treated with flagellin solution before inoculation with PVX (P3) and with PVX before spraying with flagellin (P5) showed milder symptoms, with only minor streaking and less noticeable leaf curling. This suggests that flagellin can induce PVX resistance in tobacco, potentially providing a preventive and therapeutic benefit for PVX.

[0080] As described above, the basic principles, main features and advantages of the present invention are well described. The above embodiments and descriptions are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the scope of protection determined by the present invention.

Claims

1. A flagellin, characterized in that The amino acid sequence of the flagellin is shown in SEQ ID NO:

2.

2. A flagellin gene, characterized in that: The flagellin gene comprises a nucleotide sequence encoding the flagellin according to claim 1; The nucleotide sequence of the flagellin gene is shown in SEQ ID NO:

1.

3. A plant immune inducer, characterized in that The active ingredient comprises the flagellin according to claim 1.

4. Use of the flagellin according to claim 1, or the flagellin gene according to claim 2, or a recombinant expression vector comprising the flagellin according to claim 1, or a recombinant bacterium comprising the flagellin according to claim 1, or the plant immunity elicitor according to claim 6 in inducing a plant immune response.

5. The use according to claim 4, characterized in that The plant immune response includes plant cell allergic necrosis response, plant active oxygen burst, and increase in plant defense enzyme activity.

6. The use according to claim 5, characterized in that The plant reactive oxygen burst includes the accumulation of hydrogen peroxide and / or superoxide anions in the plant.

7. The use according to claim 5, characterized in that The plant defense enzymes include superoxide dismutase, peroxidase and phenylalanine ammonia lyase.

8. Use of the flagellin according to claim 1, or the flagellin gene according to claim 2, or the recombinant expression vector comprising the flagellin according to claim 1, or the recombinant bacterium comprising the flagellin according to claim 1, or the plant immunity elicitor according to claim 6 in inducing plant resistance to viruses.

9. The use according to claim 8, characterized in that Such viruses include potato virus X.

Images