Preparation method of biomimetic material for simulating oral cavity coated mucosa as well as product and application of biomimetic material
By constructing a dual network hydrogel material, the mechanical properties and structural shortcomings of the existing simulated materials are solved, and the accurate simulation of oral mucosa is achieved, and the reliability and effect of the experiment is improved.
Patent Information
- Application Number
- CN202510620597.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-15
AI Technical Summary
Existing simulation materials are difficult to take into account multiple mechanical properties and complex three-dimensional structures at the same time, and cannot accurately simulate the mechanical response and structure of the oral mucosa, which affects the reliability of the experimental results.
A double network hydrogel was constructed using protein-encoded genes containing VPGXG repeat units. By mixing ELP proteins and crosslinking agents acrylamide, N,N'-methylenebisacrylamide, hydrogel materials with mechanical properties and network structure similar to oral mucosa were prepared.
Accurate simulation of oral mucosa is achieved, and the reliability of the experiment is improved, especially in drug release and cell culture.
Smart Images
Figure CN120484095A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology and relates to a preparation method of a bionic material simulating oral mucosa, a product thereof and an application thereof. Background Art
[0002] The oral mucosa has unique mechanical properties and a fine three-dimensional structure, which enables it to play a key role in the oral environment, such as participating in food chewing and swallowing, and resisting external stimuli. In modern medical and biological research, in vitro experiments simulating the oral mucosal environment are of great significance for in-depth understanding of oral physiological and pathological mechanisms and the development of oral-related products. However, existing simulation materials have many shortcomings in accurately simulating the characteristics of the oral mucosa, and there is an urgent need to develop new materials to meet scientific research needs.
[0003] Existing simulation materials, such as some traditional hydrogels, are difficult to simulate multiple mechanical properties at the same time. For example, although some hydrogels have good flexibility, they are prone to deformation when subjected to large pressure and cannot return to their original state. They cannot simulate the mechanical response of the oral mucosa under long-term chewing pressure. Some materials with strong rigidity, although they can withstand large pressure, lack flexibility and cannot simulate the elastic deformation of the oral mucosa under stretching. Most existing simulation materials have simple structures, only a single homogeneous structure or a simple layered structure, and cannot accurately simulate the complex three-dimensional structure of the oral mucosa. This structural difference leads to a large gap between the simulation materials and the real oral mucosa in terms of cell adhesion, material transport, etc., which affects the reliability of the experimental results. For example, when studying the absorption mechanism of drugs through the oral mucosa, simulation materials with simple structures cannot accurately reflect the diffusion path and absorption efficiency of drugs in the complex structure of the real oral mucosa.
[0004] Therefore, developing a hydrogel that can accurately simulate the mechanical properties and three-dimensional structure of oral mucosa is of great practical significance. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a method for preparing a bionic material that simulates the oral mucosa, as well as its product and application.
[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:
[0007] In a first aspect, the present invention provides a method for preparing a biomimetic material that simulates oral mucosal lining, the preparation method comprising:
[0008] (1) cloning a gene encoding a protein containing VPGXG repeating units into an expression vector to obtain a first expression vector;
[0009] The gene encoding the protein containing the VPGXG repeating unit is cloned into an expression vector, and a cysteine is added to each end of the protein to obtain a second expression vector;
[0010] (2) respectively transferring the first expression vector and the second expression vector into competent cells for protein expression, separation, and purification to obtain the first expression vector protein and the second expression vector protein;
[0011] (3) Mix the first expression vector protein, the second expression vector protein, acrylamide, N,N'-methylenebisacrylamide and water to obtain.
[0012] The present invention constructs a fibrin composed of an ELP protein sequence and uses it to produce a fibrin-containing hydrogel material. The mechanical properties and network structure of the hydrogel material are similar to those of the oral mucosa lining animals. The simultaneous addition of a first carrier protein and a second carrier protein produces a double-network hydrogel that can better mimic the properties of biological tissue. The addition of cysteine does not necessarily need to be at the position of the terminal amino acid of the protein, as long as it can react smoothly to form a gel.
[0013] X in VPGXG refers to any amino acid.
[0014] Preferably, the expression vector contains a His tag.
[0015] Preferably, the number of repetitions of the repeating units is independently 10-100, for example, 10, 12, 15, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, etc. Other specific values within the above numerical range can be selected and will not be described here one by one.
[0016] Preferably, the final concentration of the protein in step (3) is 10-500 mg / mL.
[0017] The final concentration of protein here refers to the sum of the final concentrations of the first carrier protein and the second carrier protein.
[0018] The final concentration of the protein can be selected as 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 350 mg / mL, 400 mg / mL, 450 mg / mL, 500 mg / mL, etc. Other specific point values within the above numerical range can be selected, which will not be repeated here.
[0019] Preferably, in step (3), the mass ratio of the first carrier protein to the second carrier protein is 1:(2-6), and the specific point values in (2-6) can be selected from 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, etc. Other specific point values within the above numerical range can be selected, and they will not be repeated here.
[0020] Preferably, in step (3), the final concentration of acrylamide is 10-500 mg / mL, and the final concentration of N,N'-methylenebisacrylamide is 0.01-10 mg / mL.
[0021] The final concentration of acrylamide can be selected from 10mg / mL, 20mg / mL, 30mg / mL, 40mg / mL, 50mg / mL, 60mg / mL, 70mg / mL, 80mg / mL, 90mg / mL, 100mg / mL, 150mg / mL, 200mg / mL, 250mg / mL, 300mg / mL, 350mg / mL, 400mg / mL, 450mg / mL, 500mg / mL, etc. N,N'- The final concentration of methylenebisacrylamide can be selected as 0.01 mg / mL, 0.05 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.5 mg / mL, 0.8 mg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, etc. Other specific points within the above numerical range can be selected, which will not be repeated here.
[0022] Preferably, step (3) further comprises mixing with an initiator.
[0023] Preferably, the initiator comprises LAP or APS.
[0024] Preferably, the method further comprises light initiation after mixing with LAP.
[0025] Preferably, the concentration of LAP is 0.1-1 mg / mL, for example, 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1 mg / mL, etc. Other specific point values within the above numerical range can be selected and will not be repeated here.
[0026] Preferably, the mixing with APS also includes mixing with TEMED.
[0027] Preferably, the expression conditions are: temperature of 10-37° C., time of 4-24 h, and induction using 0.1-2 mM IPTG.
[0028] The temperature can be selected as 10℃, 12℃, 15℃, 18℃, 20℃, 22℃, 25℃, 28℃, 30℃, 32℃, 35℃, 37℃, etc. The time can be selected as 4h, 8h, 12h, 16h, 20h, 24h, etc. The molar concentration of IPTG can be selected as 0.1mM, 0.2mM, 0.5mM, 0.8mM, 1mM, 1.2mM, 1.5mM, 1.8mM, 2mM, etc. Other specific point values within the above numerical range can be selected, so they will not be listed here.
[0029] Preferably, the purification comprises using Co 2+ -NTA protein resin purification and dialysis to obtain.
[0030] In a second aspect, the present invention provides a biomimetic material simulating oral mucosa prepared according to the method for preparing a biomimetic material simulating oral mucosa according to the first aspect.
[0031] In a third aspect, the present invention provides a use of the bionic material simulating oral mucosa according to the second aspect in gas composition testing or cell culture.
[0032] In a fourth aspect, the present invention provides a use of the bionic material simulating oral mucosa according to the second aspect in drug release research.
[0033] The hydrogel of the present invention simulates the mechanical properties, composition and network structure of the real oral mucosa, is non-cytotoxic, and can replace the real oral mucosa in experiments such as drug testing, cell culture, and gas composition detection.
[0034] Compared with the prior art, the present invention has the following beneficial effects:
[0035] (1) In terms of structural design, compared with ordinary hydrogels, ELP protein is introduced as the second layer of entanglement network, thereby simulating the real oral mucosa in terms of macroscopic mechanical properties, microscopic network structure and surface undulation.
[0036] (2) Acrylamide protein hydrogel has high water content and good biocompatibility, and can be used as the extracellular matrix of biomimetic oral mucosa for cell culture experiments.
[0037] (3) The network structure and composition of the hydrogel are close to those of the real oral mucosa, and can replace the real mucosa to test the release and diffusion of drug components, gas components, etc. in the mucosa.
[0038] (4) The hydrogel has good adhesion properties and is transparent in color, making it convenient to set up experiments and test results. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 It is a schematic diagram of the hydrogel network structure design of the present invention.
[0040] Figure 2 Figure 3 is a stress-strain curve comparing the mechanical properties of the hydrogel of the present invention and the oral mucosa of animals, wherein Figure A is the result of a uniaxial tensile test, Figure B is the result of a uniaxial single-cycle tensile test, and Figure C is the result of a pre-shear tensile test.
[0041] Figure 3 The network structure of the hydrogel of the present invention is compared with the mucous membrane lining the oral cavity of an animal.
[0042] Figure 4 The surface undulations of the hydrogel of the present invention are compared with the surface undulations of the mucous membrane lining the oral cavity of an animal.
[0043] Figure 5 These are the experimental results of examining the adsorption of particles on the oral mucosa by the hydrogel of the present invention, wherein Figure A is the result of fluorescence microscopy observation, and Figure B is the statistical result. DETAILED DESCRIPTION
[0044] The technical solution of the present invention is further described below by way of specific embodiments. It should be understood by those skilled in the art that the embodiments are merely to help understand the present invention and should not be regarded as specific limitations of the present invention.
[0045] Example 1
[0046] This embodiment provides a method for preparing a biomimetic material that simulates oral mucosal lining, the preparation method comprising:
[0047] (1) The nucleotide sequence shown in SEQ ID No. 1 was cloned into an expression vector to obtain a first expression vector, wherein the expression vector is pQE80L and the restriction enzyme cleavage site is BamhI-KpnI;
[0048] The nucleotide sequence shown in SEQ ID No. 2 was cloned into an expression vector to obtain a second expression vector, the expression vector being pQE80L with a restriction enzyme cleavage site of BamhI-KpnI;
[0049] (2) The first expression vector and the second expression vector were transferred into Escherichia coli competent cells for protein expression. The expression conditions were as follows: temperature 20°C, time 16 h, IPTG addition amount 0.2 mM, and the protein was separated and purified, dialyzed into PBS buffer, and the purification was carried out using Co 2+ -NTA protein resin to obtain the first carrier protein and the second carrier protein;
[0050] (3) Acrylamide, N,N'-methylenebisacrylamide, the first carrier protein, the second carrier protein, LAP, and water were mixed to a final concentration of 150 mg / mL for acrylamide, 3 mg / mL for N,N'-methylenebisacrylamide, 20 mg / mL for the first carrier protein, 80 mg / mL for the second carrier protein, and 0.25 mg / mL for LAP. The mixture was irradiated with UV light for 30 minutes to form a gel.
[0051] SEQ ID No. 1:
[0052]
[0053] SEQ ID No.2:
[0054] ATGAGAGGATCGCATCACCATCACCATCACTGTGGATCCGTGCCGGGCGTCGGCGTGCCGGGCGTAGGTGTTCCGGGCGAGGGTGTTCCGGGCGTTGGTGTGCCGGGCGTCGGCGTGCCGGGCGTGGGTGTTCCGGGCGTAGGTGTGCCGGGCGAGGGTGTGCCGGGCGGGCTGAGATCCGTGCCGGGCGTCGGCGTGCCGGGCGTAGGTGTTCCGGGCGAGGGTGTTCCGGGCGTTGGTGTGCCGGGCGTCGGCGTGCCGGGCGTGGGTGTTCCGGGCGTAGGTGTGCCGGGCGAGGGTGTGCCGGGCGGGCTGAGATCTGGTACCTGTTAA。
[0055] The amino acid sequence encoded by SEQ ID No.1 is shown in SEQ ID No.3.
[0056] SEQ ID No.3:
[0057] MRGSHHHHHHGSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRS。
[0058] The amino acid sequence encoded by SEQ ID No.2 is shown in SEQ ID No.4.
[0059] SEQ ID No.4:
[0060] MRGSHHHHHHCGSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVP GGLRSVPGVGVPGVGVPGEGVPGVGVPGVGVPGVGVPGVGVPGEGVPGGLRSGTC.
[0061] Test Example 1
[0062] Mechanical effect test method:
[0063] At room temperature, uniaxial single tensile, pre-shear uniaxial tensile, and uniaxial single cycle tensile tests were performed using an Instron-5944 tensile testing machine equipped with a 10N static load cell. All mechanical test specimens maintained a standard size of 10×10×1mm. Each experiment was repeated three times, and the average value was reported. The results are shown in Figure 2. Figure 2 shown.
[0064] Test Example 2
[0065] Test method:
[0066] The hydrogel prepared in Example 1 and the oral mucosa of animals were observed under a scanning electron microscope and an atomic force microscope, and the network structure and surface undulation were compared. Figure 3 As shown, the surface undulation degree is compared with Figure 4 shown.
[0067] Test Example 3
[0068] Particle adsorption effect
[0069] Test method: Fluorescent polystyrene nanoparticles (1 μm, 3 μm, 5 μm, purchased from Regeneron Biotechnology Co., Ltd.) were dispersed in PBS buffer at a concentration of 1 mg / mL and sonicated for 10 minutes to form a uniform suspension.
[0070] The hydrogel was fixed to the substrate surface, ensuring that the bottom surface of the sample remained sealed and not in direct contact with the fluorescent particles. A fluorescent particle suspension was sprayed onto the exposed top surface of the sample using an atomizer to simulate particle deposition, ensuring that the amount of fluorescent particle suspension sprayed per unit area remained consistent. The sample was then incubated at 37°C for 8 hours to promote particle diffusion. Imaging was performed using a fluorescence microscope with an excitation wavelength of 488 nm and an emission band of 510-550 nm, and the fluorescence intensity distribution was quantitatively analyzed using ImageJ software.
[0071] The results are as follows Figure 5 shown.
[0072] The applicant states that the present invention uses the above-described embodiments to illustrate the preparation method of a biomimetic material simulating the oral mucosa, its product, and its application. However, the present invention is not limited to the above-described embodiments, nor does it necessarily rely on the above-described embodiments for implementation. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for raw materials in the present invention's products, addition of auxiliary ingredients, and selection of specific methods, etc., fall within the scope of protection and disclosure of the present invention.
[0073] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.
[0074] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.
Claims
1. A method for preparing a bionic material simulating oral mucosa, characterized in that: The preparation method comprises: (1) cloning a gene encoding a protein containing VPGXG repeating units into an expression vector to obtain a first expression vector; The gene encoding the protein containing the VPGXG repeating unit is cloned into an expression vector, and a cysteine is added to each end of the protein to obtain a second expression vector; (2) respectively transferring the first expression vector and the second expression vector into competent cells for protein expression, separation, and purification to obtain the first expression vector protein and the second expression vector protein; (3) Mix the first expression vector protein, the second expression vector protein, acrylamide, N,N'-methylenebisacrylamide and water to obtain.
2. The method for preparing a bionic material simulating oral mucosa according to claim 1, characterized in that: The expression vector contains a His tag.
3. The method for preparing a bionic material simulating oral mucosa according to claim 1 or 2, characterized in that: The number of repetitions of the repeating units is independently 10-100.
4. The method for preparing a bionic material simulating oral mucosa according to any one of claims 1 to 3, characterized in that: The final concentration of the protein in step (3) is 10-500 mg / mL; Preferably, in step (3), the mass ratio of the first carrier protein to the second carrier protein is 1:(2-6).
5. The method for preparing a bionic material simulating oral mucosa according to any one of claims 1 to 4, characterized in that: In step (3), the final concentration of acrylamide is 10-500 mg / mL, and the final concentration of N,N'-methylenebisacrylamide is 0.01-10 mg / mL; Preferably, step (3) further comprises mixing with an initiator; Preferably, the initiator comprises LAP or APS; Preferably, after mixing with LAP, light initiation is also employed; Preferably, the concentration of LAP is 0.1-1 mg / mL; Preferably, the mixing with APS also includes mixing with TEMED.
6. The method for preparing a bionic material simulating oral mucosa according to any one of claims 1 to 5, characterized in that: The expression conditions are: temperature of 10-37° C., time of 4-24 h, and induction with 0.1-2 mM IPTG.
7. The method for preparing a bionic material simulating oral mucosa according to any one of claims 1 to 6, characterized in that: The purification includes the use of Co 2+ -NTA protein resin purification and dialysis to obtain. 8 . The biomimetic material simulating oral mucosa prepared by the method for preparing a biomimetic material simulating oral mucosa according to any one of claims 1 to 7 .
9. Use of the bionic material simulating oral mucosa according to claim 8 in gas composition testing or cell culture.
10. Use of the biomimetic material simulating oral mucosa according to claim 8 in drug release research.