Cell penetrating inhibitory peptide and application thereof in breast cancer treatment

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a cell-penetrating inhibitory peptide and application thereof in breast cancer. Specifically, aiming at the interaction between circHIF-1 alpha (11, 12) and IGF2BP2, the invention designs a novel compound named as cell-penetrating IGF2BP2 inhibitory peptide (IIP) for intervention so as to inhibit the energy metabolism reregulation and tumor progression of breast cancer. The invention discloses the new application of IIP as the circHIF-1 alpha (11, 12) inhibitor for the first time. In-vitro experiments prove that the IIP can significantly inhibit energy metabolism reprogramming and tumor progression of breast cancer cells. In conclusion, the invention provides an innovative breast cancer treatment method based on interaction of circRNA and protein, through design and application of IIP, the disease progress of breast cancer is successfully intervened, and a new direction and possibility are opened up for development of breast cancer treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a cell-penetrating inhibitory peptide and its application in breast cancer. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Breast cancer is one of the most common malignant tumors in women, with its incidence showing an upward trend worldwide, becoming a major factor seriously threatening women's health. Circular RNA (circRNA) plays an important role in cell regulation. Compared with linear RNA, it is more stable, less immunogenic, and more conserved. In recent years, circRNA research has attracted much attention, demonstrating its important role in transcriptional regulation and cell survival. In the field of oncology, abnormal expression of circRNA is closely related to the occurrence and development of tumors. Studying circRNA will help us gain a deeper understanding of gene regulation and provide new ideas for tumor diagnosis and treatment. Especially in tumors such as breast cancer, the study of circRNA is expected to reveal its mechanism in the occurrence and development of cancer and provide a theoretical basis for the development of more effective treatments.

[0004] However, despite certain progress in the study of circRNAs, the expression profile and regulatory mechanism of circRNAs in breast cancer remain to be elucidated. Summary of the Invention

[0005] To address the aforementioned issues in the prior art, the present invention provides a cell-penetrating inhibitory peptide and its application in breast cancer. Specifically, the present invention reveals and utilizes the interaction between circHIF-1α(11,12) and IGF2BP2 to design a cell-penetrating IGF2BP2 inhibitory peptide (IIP). This peptide successfully inhibits breast cancer cell proliferation and tumor progression, providing a new strategy for breast cancer treatment. Based on these research findings, the present invention was completed.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] In a first aspect, the present invention provides a cell-penetrating inhibitory peptide, which comprises a polypeptide having a cell-penetrating function and a polypeptide targeting circHIF-1α (11, 12).

[0008] The polypeptide having cell-penetrating function may be transactivative transcription protein (TAT), which is an arginine-rich polypeptide found in human immunodeficiency virus and has the property of a penetrating peptide, and its amino acid sequence is YGRKKRRQRRR (SEQ ID NO: 1).

[0009] The polypeptide targeting circHIF-1α (11, 12) has an amino acid sequence of TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 2).

[0010] In a specific embodiment of the present invention, the amino acid sequence of the cell penetrating inhibitory peptide is YGRKKRRQRRR-TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 3).

[0011] Furthermore, in order to facilitate tracing of the cell-penetrating inhibitory peptide, biotin and a fluorescent marker may be provided at both ends thereof. The fluorescent marker may be FITC, which is not specifically limited here.

[0012] The second aspect of the present invention provides the use of the above-mentioned cell-penetrating inhibitory peptide in the preparation of a circHIF-1α (11,12) inhibitor.

[0013] In a third aspect of the present invention, a circHIF-1α(11,12) inhibitor is provided, wherein the active ingredient of the circHIF-1α(11,12) inhibitor comprises at least the above-mentioned cell-penetrating inhibitory peptide.

[0014] A fourth aspect of the present invention provides the use of the above-mentioned cell-penetrating inhibitory peptide or the above-mentioned circHIF-1α (11,12) inhibitor in the preparation of anti-tumor drugs.

[0015] Specifically, the present invention has found through research that the cell-penetrating inhibitory peptide competitively binds to circHIF-1α (11, 12) with IGF2BP2 to inhibit its cancer-promoting function.

[0016] It should be noted that the term "tumor" as used herein, as known to those skilled in the art, includes benign and / or malignant tumors. Benign tumors are defined as excessive cell proliferation that is incapable of forming aggressive, metastatic tumors in the body. Conversely, malignant tumors are defined as cells with multiple cellular and biochemical abnormalities that are capable of developing systemic diseases (e.g., metastasis to distant organs).

[0017] In another specific embodiment of the present invention, the medicine of the present invention can be used to treat malignant tumors. Examples of malignant tumors that can be treated with the medicine of the present invention include solid tumors and hematologic tumors. Solid tumors can be tumors of the breast, bladder, bone, brain, central and peripheral nervous systems, colon, endocrine glands (such as thyroid and adrenal cortex), esophagus, endometrium, germ cells, head and neck, liver, lung, larynx and hypopharynx, mesothelioma, ovary, pancreas, prostate, rectum, kidney, small intestine, soft tissue, testicle, stomach, skin (such as melanoma), ureter, vagina and vulva. Hematologic tumors are a type of malignant tumor originating from the hematopoietic system, including leukemia, lymphoma, multiple myeloma, etc., which are not specifically limited here. In addition, malignant tumors include primary tumors in the organs and corresponding secondary tumors (tumor metastasis) in distal organs.

[0018] Furthermore, the tumor is a tumor closely related to the expression of circHIF-1α(11,12), further a tumor that highly expresses circHIF-1α(11,12); further, the tumor is breast cancer.

[0019] Therefore, the fifth aspect of the present invention provides an anti-tumor drug, the active ingredient of which comprises the above-mentioned cell-penetrating inhibitory peptide or circHIF-1α (11,12) inhibitor.

[0020] According to the present invention, the drug may further include at least one other inactive pharmaceutical ingredient.

[0021] The inactive ingredients of the drug can be carriers, excipients, diluents, etc. commonly used in pharmacy. Moreover, according to common methods, the drug can be prepared into oral dosage forms, external preparations, suppositories, and sterile injection solutions in the form of powders, granules, suspensions, emulsions, syrups, sprays, etc.

[0022] The non-drug active ingredients such as carriers, excipients and diluents that may be included are well known in the art, and those skilled in the art can determine whether they meet clinical standards.

[0023] In another embodiment of the present invention, the medicine of the present invention can be administered to the body in a known manner. For example, it can be delivered to the tissue of interest by intravenous systemic delivery or local injection (such as intratumoral injection). Such administration can be carried out via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be administered in the present invention can vary depending on various factors to a great extent, such as the target cell, the type of organism or its tissue, the general condition of the subject to be treated, the route of administration, the mode of administration, etc.

[0024] In another embodiment of the present invention, the subjects of drug administration can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, etc.

[0025] A sixth aspect of the present invention provides a method for treating tumors, comprising administering a therapeutically effective amount of the above-mentioned drug to a subject.

[0026] The term "subject" refers to an animal, preferably a mammal, and most preferably a human, that has been the subject of treatment, observation, or experimentation. The term "therapeutically effective amount" refers to the amount of an active compound or agent, including a compound of the invention, that elicits the biological or medical response sought by the researcher, veterinarian, physician, or other medical professional in a tissue system, animal, or human, including alleviation or partial alleviation of the symptoms of the disease, syndrome, condition, or disorder being treated. It is recognized that the optimal dosage and interval of administration of the active ingredients of the invention are determined by their properties and external factors such as the form, route, and site of administration, as well as the specific mammal being treated, and that this optimal dosage can be determined using conventional techniques. It is also recognized that the optimal course of treatment, i.e., the daily dosage of the compound over a specified period of time, can be determined using methods known in the art.

[0027] The tumor is a tumor closely related to the expression of circHIF-1α(11,12), and in particular, can be a tumor that highly expresses circHIF-1α(11,12); further, the tumor is breast cancer.

[0028] Beneficial technical effects of the above technical solution:

[0029] 1. Inhibition of Tumor Proliferation: By leveraging the interaction between circHIF-1α (11,12) and IGF2BP2, we successfully designed and synthesized IIP, a cell-penetrating inhibitory peptide. In vitro cell experiments demonstrated that IIP significantly inhibited breast cancer cell proliferation, providing a novel and highly effective approach for tumor therapy.

[0030] 2. Blocking tumor progression: The present invention also effectively blocks tumor progression by interfering with the interaction between circHIF-1α (11, 12) and IGF2BP2. This property makes this treatment method particularly beneficial in treating advanced or highly aggressive tumors.

[0031] 3. Superior cell penetrability and biosafety: As a cell-penetrating peptide, IIP possesses excellent cell penetration and can rapidly penetrate tumor cells to exert its effects. This invention simultaneously possesses anti-tumor activity and biosafety, ensuring the reliability of therapeutic effects and the biosafety of patients.

[0032] 4. Innovative drug design: The synthesis and application of IIP not only brings new ideas for the treatment of tumors such as breast cancer, but also provides feasibility for drug design in the field of tumor treatment.

[0033] 5. Promising Future Clinical Applications: The therapeutic approach provided by this invention has promising application prospects and is expected to become an important treatment strategy for tumors such as breast cancer. The flexibility and adjustability of its structure also offer the potential for further optimization and adaptation to different tumor types, opening up new avenues for clinical tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without any creative work.

[0035] Figure 1 circHIF-1α(11,12) promotes aerobic glycolysis and tumor progression in breast cancer; A shows that after knocking down circHIF-1α(11,12) in breast cancer cells, the glucose energy absorption of cells is reduced; B shows that after knocking down circHIF-1α(11,12) in breast cancer cells, the lactate production capacity of cells is reduced; C shows that after overexpressing circHIF-1α(11,12) in breast cancer cells, the glucose absorption capacity of cells is increased; D shows that after overexpressing circHIF-1α(11,12) in breast cancer cells, the lactate production capacity of cells is increased; E shows that after knocking down circHIF-1α(11,12) in breast cancer cells, the proliferation capacity of cells is reduced; F shows that after knocking down circHIF-1α(11,12) in breast cancer cells, the migration and invasion capacity of cells are reduced.

[0036] Figure 2 Figure 5 (A) shows the results of IIP inhibiting the binding ability between circHIF-1α(11,12) and IGF2BP2; Figure 5 (B) shows the effect of IIP on the binding ability between IGF2BP2 and circHIF-1α(11,12) using RIP experiments. The results showed that in breast cancer cells, IIP could significantly inhibit the binding of IGF2BP2 to circHIF-1α(11,12) compared with the control group CTLP.

[0037] Figure 3Figure 5 is the result of IIP reversing the promoting effect of circHIF-1α(11,12) on the glycolysis ability of breast cancer; AB is the result of IIP reversing the promoting effect of circHIF-1α(11,12) on the glucose absorption ability of breast cancer cells; CD is the result of IIP reversing the promoting effect of circHIF-1α(11,12) on the lactate production ability of breast cancer cells.

[0038] Figure 4 Figure 1 shows the results of IIP reversing the promoting effect of circHIF-1α(11,12) on breast cancer progression. A shows that IIP can reverse the promoting effect of circHIF-1α(11,12) on breast cancer cell proliferation. B shows that IIP can reverse the promoting effect of circHIF-1α(11,12) on breast cancer cell migration. DETAILED DESCRIPTION

[0039] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0040] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0041] Explanation of terms:

[0042] Cell penetrating peptides (CPPs) are a class of small, short amino acid sequence polypeptides that bind to the lipid bilayer with high affinity. When bound to the cell membrane, these polypeptide sequences are responsible for membrane translocation, promoting the internalization of the penetrating peptides into the cell. Typically, CPPs are taken up into cells through direct cell membrane penetration and / or endocytosis. CPPs have been widely used to deliver membrane-permeable drugs, peptides, proteins, and nucleic acids to target cells and tissues, and are considered a promising alternative to viral vectors. This technology is expected to provide new possibilities for overcoming obstacles in the drug delivery process and improving therapeutic effects.

[0043] Transactivator transcription protein (TAT) is an arginine-rich peptide found in human immunodeficiency virus (HIV) that possesses penetrating peptide properties. Its amino acid sequence is YGRKKRRQRRR. Its chemical structure is as follows:

[0044]

[0045] TAT-mediated peptide transduction offers numerous advantages: ① The transduction process is independent of receptors and transporters and can proceed even at 4°C. ② Transduction efficiency is high and easily regulated. ③ Low toxicity and minimal cell damage.

[0046] As mentioned above, although some progress has been made in the study of circRNAs, the expression profile and regulatory mechanism of circRNAs in breast cancer remain to be elucidated.

[0047] The present invention identified and characterized a circRNA, circHIF-1α(11,12), which is formed by the head-to-tail splicing of exons 11 and 12 of its host gene, HIF-1α (its nucleotide sequence is shown in SEQ ID NO.4). It can promote breast cancer energy metabolism reprogramming (aerobic glycolysis) and tumor progression. EIF4A3 is involved in inducing the circularization and nucleocytoplasmic translocation of circHIF-1α(11,12), and promotes the upregulation of circHIF-1α(11,12) expression in breast cancer by binding to the circHIF-1α(11,12) precursor. Further studies found that circHIF-1α(11,12) can act as a scaffold to recruit IGF2BP2 and HIF-1α mRNA to form an RNA-protein ternary complex. Through this complex, circHIF-1α(11,12) promotes the binding of IGF2BP2 to HIF-1α mRNA, enhances its stability, and upregulates the expression of its target genes, including LDHA, GLUT1, and PDK1.

[0048] This study discovered and revealed the key role of circHIF-1α(11,12) in promoting tumor aerobic glycolysis and progression in breast cancer. Blocking the interaction between circHIF-1α(11,12) and IGF2BP2 may open up new avenues for the therapeutic management of breast cancer.

[0049] In light of this, the present invention designed a peptide that simultaneously targets circHIF-1α(11,12) and possesses cell-penetrating properties. This peptide is a tandem peptide consisting of a TAT and a targeting sequence. It is also fluorescently labeled with biotin and FITC on either side for traceability. This peptide can competitively bind to circHIF-1α(11,12), thereby specifically inhibiting the cancer-promoting function of circHIF-1α(11,12) through IGF2BP2.

[0050] The present invention is further explained by the following examples, but it does not constitute a limitation of the present invention. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. Breast cancer cells MDA-MB-231, MDA-MB-468, BT-474 and MCF-7 are available from ATCC. The tandem peptide IIP used in the example was synthesized by Boshang Biotechnology Co., Ltd. (Shanghai), and its amino acid sequence is as follows: IIP: biotin-YGRKKRRQRRR-TQAVGAIIGK-KGATSA-EVIVPR-DQT-FITC, purity ≥95%, powder, stored dry at -20°C away from light.

[0051] Example 1. circHIF-1α(11,12) promotes aerobic glycolysis and tumor progression in breast cancer

[0052] Our experimental results showed that when we reduced the expression of circHIF-1α(11,12), the aerobic glycolysis capacity of breast cancer cells was significantly inhibited. This was manifested as reduced lactate production and decreased glucose absorption capacity. At the same time, CCK8 proliferation assays and Transwell chamber assays showed that the proliferation and migration abilities of cells were also significantly inhibited. On the contrary, when we overexpressed circHIF-1α(11,12), the opposite results were observed, that is, the aerobic glycolysis capacity of breast cancer cells was enhanced and tumor progression was also promoted. Therefore, we concluded that circHIF-1α(11,12) can promote aerobic glycolysis and tumor progression of breast cancer ( Figure 1 ). The following is the specific test method.

[0053] 1. Lactic acid production experiment

[0054] (1) Seed 3000-5000 cells per well of a 96-well plate. After the cells adhere, add IIP to a final concentration of 5 μM to the experimental group and an equal amount of the negative control CTLP to the control group. Continue to culture the cells for 4 hours, then replace with fresh complete medium and continue culturing. After 6-12 hours, collect 10 μl of cell supernatant for analysis.

[0055] (2) Using 2 mM standard, prepare the standard according to the following table:

[0056] Table 1 Preparation method of standard products

[0057]

[0058] (3) Prepare the working solution according to the instructions in the manual. Add 50 μl of working solution to each sample and standard and gently tap the plate to mix thoroughly.

[0059] (4) Immediately measure the absorbance of each well at 450 nm using a microplate reader, then incubate at 37°C for 30 minutes and read the absorbance again.

[0060] (5) The calculation process is as follows: First, a standard curve is drawn based on the absorbance value and the concentration of the standard. Then, the concentration of lactic acid in each well is calculated using the standard curve and multiplied by the corresponding dilution factor.

[0061] 2. Glucose absorption experiment

[0062] (1) 3000-5000 cells were seeded per well of a 96-well plate. After the cells adhered, IIP was added to the experimental group at a final concentration of 5 μM, and an equal amount of negative control CTLP was added to the control group. The cells were cultured for 4 h and then replaced with serum-free medium for overnight culture.

[0063] (2) The next day, the cells were washed three times with PBS, and the starved cells were incubated with 100 μl of KRPH / 2% BSA buffer for 40 min, and the standard was serially diluted.

[0064] (3) Prepare the standard curve dilutions using 0.01 mM 2-DG6P standard according to the following steps.

[0065] Table 2 Preparation method of standard products

[0066]

[0067] (4) 10 μl of 2-DG (final concentration of 10 mM) was added to the experimental group and incubated for 20 minutes, while no 2-DG was added to the background control sample. Subsequently, the cells were washed three times with PBS to remove exogenous 2-DG.

[0068] (5) Add 80 μl of lysis buffer to the sample and shake well to fully lyse.

[0069] (6) The cell lysate was subjected to one freeze / thaw cycle, then heated at 85°C for 40 minutes, and finally cooled on ice for 5 minutes.

[0070] (7) Add 10 μl of neutralization buffer and mix thoroughly by inverting the tube.

[0071] (8) Dilute the sample 1:10 by adding 45 μl of assay buffer to 5 μl of sample.

[0072] (9) Add 10 μl of reaction mixture A to each sample and standard well, mix well, and incubate at 37°C for 1 hour.

[0073] (10) Add 90 μl of lysis buffer to each well, seal with sealing film, and heat at 90°C for 40 minutes.

[0074] (11) Cool on ice for 5 minutes and add 12 μl of neutralization buffer to neutralize the reaction.

[0075] (12) Add 38 μl of reaction mixture B to each well, mix well, and measure the absorbance at 412 nm using a microplate reader in a dark environment at 37°C. Measure the absorbance every 2-3 minutes until the absorbance of standard 6 (100 pmol / well) is reached.

[0076] (13) Data analysis: First, a standard curve is drawn based on the absorbance value and the concentration of the standard. Then, the concentration of glucose in each well is calculated based on the standard curve and multiplied by the corresponding dilution factor.

[0077] 3.CCK8 proliferation assay

[0078] (1) Seeding: Breast cancer cells were seeded in 96-well plates, with 5,000 cells per well. Each experimental group contained five replicate wells. After the cells adhered, IIP was added to the experimental group at a final concentration of 5 μM, while an equal amount of the negative control CTLP was added to the control group. The cells were cultured for 4 hours, then replaced with new complete medium. The assay was performed at 24, 48, and 72 hours.

[0079] (2) Detection: Add 10 μl of CCK8 detection solution to each well, then place the plate in a cell culture incubator and incubate for 2 h, and then use a microplate reader to detect the absorbance value (wavelength 450 nm).

[0080] 4. Transwell chamber assay (cell migration ability)

[0081] (1) Breast cancer cells were seeded in 6-well plates. After the cells adhered, IIP was added to the experimental group at a final concentration of 5 μM, while an equal amount of negative control CTLP was added to the control group. The cells were cultured for 4 hours, then replaced with new complete medium and continued to be cultured. After the cells adhered, they were trypsinized and resuspended in 180-200 μl of serum-free incomplete medium and added to the upper layer of the Transwell chamber. 600-800 μl of serum-containing complete medium was added to the lower layer of the 24-well plate.

[0082] (2) After the infiltration experiment was performed for 16 h and the migration experiment was performed for 24 h, the Transwell chamber was removed, the culture medium therein was aspirated, and then 600 μl of 4% paraformaldehyde was added and incubated at room temperature for 30 min.

[0083] (3) After removing the paraformaldehyde, add 600 μl of crystal violet and let it stand at room temperature for 15 minutes. The preparation method of crystal violet is: 0.05g crystal violet + 40ml PBS + 10ml methanol.

[0084] (4) Absorb the crystal violet and rinse the residual crystal violet on the upper layer of the Transwell chamber with running double distilled water, and then wipe the water on the upper layer of the Transwell chamber with a cotton swab.

[0085] (5) Observe, photograph, and count the cells under an inverted microscope.

[0086] Example 2. IIP inhibits the binding of circHIF-1α(11,12) to IGF2BP2

[0087] We confirmed through RIP experiments that when IIP was added to the cells, the content of circHIF-1α(11,12) in the IGF2BP2 protein pull-down product was reduced compared with the negative control group CTLP, suggesting that IIP inhibits the binding of circHIF-1α(11,12) to IGF2BP2 by competitively binding to circHIF-1α(11,12), thereby inhibiting its cancer-promoting function ( Figure 2 ). The following is the RIP test method.

[0088] 1. Cell Lysis:

[0089] (1) Breast cancer cells were inoculated in 75cm 2 In the culture flask, when the cell confluence reached 50%, IIP with a final concentration of 5 μM was added to the experimental group, and an equal amount of negative control CTLP was added to the control group. After culturing for 4 hours, new complete medium was replaced and cultured. When the cells reached a density of 90%, they were cultured at 75 cm 2 The culture flask was washed twice with 10 ml of PBS.

[0090] (2) Add 10 ml of PBS to the flask, scrape the cells to form a cell suspension, place it in a centrifuge tube at 4°C, centrifuge at 1500 rpm for 5 minutes, discard the supernatant, and retain the precipitate.

[0091] (3) Prepare 100 μl of complete lysis buffer for each sample: Add 0.5 μl of ribonuclease inhibitor and 0.25 μl of protease inhibitor cocktail to 100 μl of RIP lysis buffer. Add the prepared complete lysis buffer to the cell pellet, pipette thoroughly to mix, and place on ice for 5 minutes to fully lyse. Proceed to the next step or temporarily store in a -80°C freezer.

[0092] 2. Immunoprecipitation magnetic bead configuration:

[0093] (1) Pre-mix the magnetic beads at 4°C and pipette 50 μl of magnetic beads into an EP tube for each group.

[0094] (2) Add 500 μl of washing buffer to each EP tube, vortex briefly to mix, place on a magnetic stand, let stand for 1 minute, discard the supernatant, and repeat the wash once.

[0095] (3) Add 100 μl of washing buffer to each group and mix thoroughly. Add 1 μg of IgG antibody to the negative control group and add IGF2BP2 antibody from the same species as the control group to the experimental group. Incubate with rotation at room temperature for 30 minutes.

[0096] (4) Vortex centrifugation was performed instantaneously, and the EP tube was placed on a magnetic rack. The tube was allowed to stand for 1 minute and the supernatant was discarded.

[0097] (5) Add 500 μl of washing buffer to the EP tube, mix gently, and place on a magnetic rack for 1 minute. Discard the supernatant and repeat the washing process.

[0098] (6) Add 500 μl of washing buffer to the EP tube, mix gently, and place on ice until ready to use.

[0099] 3. RNA Binding Protein / RNA Complex Immunoprecipitation

[0100] (1) Prepare 900 μl of immunoprecipitation buffer (860 μl RIP wash buffer + 5 μl ribonuclease inhibitor + 35 μl 0.5 M EDTA) for each group.

[0101] (2) Centrifuge the lysate obtained in the above step at 14,000 rpm for 10 minutes at 4°C. Transfer the supernatant to a new enzyme-free EP tube, remove 10 μl of the supernatant as input, and temporarily store at -80°C.

[0102] (3) 100 μl of supernatant from each group was added to 900 μl of immunoprecipitation buffer and incubated with rotation at 4°C overnight.

[0103] (4) Vortex the EP tube and centrifuge it briefly, place it on a magnetic stand for 1 minute, and discard the supernatant.

[0104] (5) Add 500 μl of washing buffer, mix gently, and place on a magnetic rack for 1 minute. Discard the supernatant. Repeat the washing process 6 times.

[0105] 4. Purification

[0106] (1) Prepare 150 μl of proteinase K buffer (117 μl wash buffer + 18 μl proteinase K + 15 μl 10% SDS) for each group. For the corresponding input group, prepare 140 μl of proteinase K buffer, add it to the washed magnetic beads, and mix gently.

[0107] (2) Incubate at 55°C with shaking for 30 minutes.

[0108] (3) Vortex centrifugation briefly, place the EP tube on a magnetic stand for 1 minute, transfer the supernatant to a new enzyme-free EP tube, and add 250 μl of washing buffer.

[0109] (4) Add 400 μl of phenol:chloroform:isoamyl alcohol to the EP tube, vortex mix for 15 seconds, centrifuge at 14,000 rpm for 10 minutes at room temperature, and draw 350 ml of the upper aqueous phase into a new enzyme-free EP tube.

[0110] (5) Add 400 μl of chloroform to the tube, vortex mix for 15 seconds, centrifuge at 14,000 rpm for 10 minutes at room temperature, and transfer 300 μl of the upper aqueous phase to a new enzyme-free EP tube.

[0111] (6) Add 50 μl of saline solution I, 15 μl of saline solution II, and 5 μl of precipitation enhancer to each tube. Add 850 μl of anhydrous ethanol and vortex to mix. Place the mixture in a -80°C refrigerator for 1 hour or overnight.

[0112] (7) Centrifuge at 4°C, 14,000 rpm for 30 minutes, discard the supernatant, wash the precipitate once with 80% ethanol, centrifuge at 4°C, 14,000 rpm for 15 minutes, discard the supernatant, centrifuge again at 4°C, 14,000 rpm for 5 minutes, carefully aspirate the supernatant, open the lid and let it stand to dry the residual alcohol.

[0113] (8) Add 7 μl of DEPC water to each tube to dissolve the RNA.

[0114] (9) All RNA from the experimental and control groups and 1 μg RNA from the input group were used to detect the enrichment of circHIF-1α (11,12) by RT-qPCR.

[0115] Example 3. IIP can reverse the promoting effect of circHIF-1α (11,12) on glycolysis in breast cancer

[0116] We conducted energy metabolism experiments, namely lactate production and glucose absorption experiments, to confirm that circHIF-1α(11,12) overexpression significantly promoted lactate production and glucose absorption in breast cancer cells. However, when IIP was added simultaneously, the lactate production and glucose absorption of cells were no longer affected compared with the negative control group CTLP. This demonstrates that IIP can reverse the promoting effect of circHIF-1α(11,12) on the glycolysis capacity of breast cancer ( Figure 3 ). The experimental method is the same as methods 1 and 2 in implementation case 1.

[0117] Example 4. IIP can reverse the promoting effect of circHIF-1α (11,12) on breast cancer progression

[0118] We used cell proliferation assays and Transwell chamber experiments to confirm that overexpression of circHIF-1α(11,12) significantly promoted the proliferation and migration of breast cancer cells. However, when IIP was added simultaneously, this promoting effect was significantly reversed compared with the negative control group CTLP. This demonstrates that IIP can reverse the promoting effect of circHIF-1α(11,12) on breast cancer progression. Figure 4 ). The experimental method is the same as methods 3 and 4 in implementation case 1.

[0119] Nucleotide sequence information of circHIF-1α(11,12):

[0120] CCTAATAGTCCCAGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTAGAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGAC TTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGCAGA CTCAAATACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTAC TAGTGCCACATCATCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAAG(SEQ ID NO:4)

[0121] It should be noted that the above embodiments are only intended to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the embodiments given, those skilled in the art may modify or replace the technical solutions of the present invention as needed without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A cell-penetrating inhibitory peptide, characterized in that: The cell-penetrating inhibitory peptide comprises a polypeptide having a cell-penetrating function and a polypeptide targeting circHIF-1α (11, 12); wherein the polypeptide having a cell-penetrating function is a transactivating transcription protein TAT, whose amino acid sequence is YGRKKRRQRRR (SEQ ID NO: 1); The amino acid sequence of the polypeptide targeting circHIF-1α (11, 12) is TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 2).

2. The cell-penetrating inhibitory peptide according to claim 1, wherein The amino acid sequence of the cell-penetrating inhibitory peptide is YGRKKRRQRRR-TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 3).

3. The cell-penetrating inhibitory peptide according to claim 1 or 2, wherein Biotin and a fluorescent marker are provided at both ends of the cell-penetrating inhibitory peptide, and further, the fluorescent marker is FITC.

4. Use of the cell-penetrating inhibitory peptide according to any one of claims 1 to 3 in the preparation of a circHIF-1α (11,12) inhibitor.

5. A circHIF-1α(11,12) inhibitor, characterized in that The active ingredient of the circHIF-1α (11,12) inhibitor comprises at least the cell-penetrating inhibitory peptide according to any one of claims 1 to 3.

6. Use of the cell-penetrating inhibitory peptide according to any one of claims 1 to 3 or the circHIF-1α (11, 12) inhibitor according to claim 5 in the preparation of anti-tumor drugs.

7. The use according to claim 6, characterized in that The tumor is a tumor closely related to the expression of circHIF-1α(11,12), and further is a tumor that highly expresses circHIF-1α(11,12); further, the tumor is breast cancer.

8. An anti-tumor drug, characterized in that: The active ingredient of the anti-tumor drug comprises the cell-penetrating inhibitory peptide according to any one of claims 1 to 3 or the circHIF-1α (11, 12) inhibitor according to claim 5.

9. The antitumor drug according to claim 8, wherein The drug further comprises at least one other inactive pharmaceutical ingredient.

10. The antitumor drug according to claim 8, characterized in that: The subjects of drug administration are humans and non-human mammals.

Images