A lactobacillus plantarum antagonizing clostridium perfringens and application thereof

Abstract

The application belongs to the technical field of functional microorganism screening and application, and particularly relates to a plant lactobacillus antagonistic to clostridium perfringens and application thereof. The plant lactobacillus is screened from the intestinal contents of cherry valley meat duck, and has been preserved in the China Center Type Culture Collection of Wuhan University in Wuhan, China on January 16, 2025, with a preservation number of CCTCC NO: M2025167. The strain has a significant inhibitory effect on a plurality of pathogenic bacteria, has a strong acid metabolism capacity, can effectively improve the disease resistance of livestock and poultry, improve the breeding performance of livestock and poultry, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of functional microbial screening and application technology, specifically to a plant-derived Lactobacillus antagonistic to Clostridium perfringens and its application. Background Technology

[0002] In recent years, with the advent of the era of restricted and banned antibiotic use, maintaining the intestinal health of livestock and poultry and ensuring their overall health in large-scale farming has become a huge challenge for the industry. Diseases such as diarrhea, necrotic enteritis, pseudomembranous enteritis, and septicemia in livestock and poultry often lead to a series of economic losses. How to prevent and reduce the outbreak of intestinal diseases is a key problem that needs to be addressed and overcome in the farming process.

[0003] Clostridium perfringens is considered one of the most widespread pathogenic microorganisms in nature, commonly found in the intestines of animals. It is known to cause necrotic enteritis in various farmed animals, including livestock and poultry. Therefore, prevention and control of this bacterium are extremely important. Studies have shown that Clostridium perfringens is one of the most common clostridium pathogens causing gas gangrene in clinical practice. It decomposes sugars in muscle and connective tissue, producing large amounts of gas, leading to severe tissue emphysema, which in turn affects blood supply and causes extensive tissue necrosis. In fact, infection of the intestines of livestock and poultry with Clostridium perfringens causes the α and β exotoxins produced to upregulate the inflammatory response level of the intestinal mucosa. This affects the absorption of nutrients by the intestinal mucosa and increases the consumption of resources used for immune defense, thus causing severe necrotic enteritis and other diseases. This disease leads to decreased livestock and poultry production performance, increased mortality, and higher treatment costs, resulting in economic losses of tens of dollars annually for the livestock and poultry farming industry.

[0004] The vast majority of Salmonella bacteria are pathogenic to humans and animals. Salmonella can survive for months or even years in carriers such as feces, sewage, and contaminated meat and egg products, and spread between humans and animals, and between animals themselves. Experiments have shown (Yang et al., 2017) that repeated infections with low doses of Salmonella can eventually lead to diarrhea or chronic enteritis in livestock and poultry. This also provides evidence that pathogenic bacteria can cause inflammatory bowel disease.

[0005] After decades of development in exploring prevention and treatment strategies for infections caused by different pathogens, probiotics, as a green and sustainable microecological preparation, have been proven to alleviate diseases such as irritable bowel syndrome and necrotizing enterocolitis by regulating the intestinal flora (Moayyedi et al., 2010). Lactic acid bacteria, as an important class of probiotics, have the following mechanisms of action: 1) They produce various organic acids and antimicrobial peptides through metabolism, exhibiting good inhibitory effects on pathogenic intestinal bacteria. 2) They inhibit the adhesion of pathogens to intestinal epithelial cells. 3) They regulate the expression of tight junction proteins, maintaining the integrity of the intestinal epithelial barrier. 4) They regulate non-specific immunity, controlling inflammatory responses.

[0006] However, not all bacteria have the ability to regulate the gut microbiota and intervene in related diseases; their effects vary at the species and strain levels. Lactic acid bacteria strains exhibiting antagonistic abilities against various pathogenic Clostridium perfringens and Salmonella have attracted considerable attention. Therefore, screening probiotic strains with multiple inhibitory effects on pathogenic bacteria is crucial to improving the prevention and control of intestinal diseases in livestock and poultry farming, and to contributing to the green development of livestock and poultry farming. Summary of the Invention

[0007] To address the problems in existing technologies, this invention provides a *Lactobacillus plantarum* antagonistic to *Clostridium perfringens* and its applications. This *Lactobacillus plantarum*, screened from the intestinal contents of Cherry Valley ducks, exhibits significant inhibitory effects against various pathogens, possesses strong metabolic acid-producing capacity, and can effectively improve the disease resistance and breeding performance of livestock and poultry, showing broad application prospects.

[0008] In one aspect, this invention provides a Lactobacillus plantarum strain, Lactobacillus plantarum WL-81, which was deposited on January 16, 2025, at the China Center for Type Culture Collection, Wuhan University, China, with accession number CCTCC NO: M 2025167.

[0009] The 16S rDNA sequence of the *Lactobacillus plantarum* is SEQ ID NO:1.

[0010] This invention provides, in one aspect, the application of the aforementioned *Lactobacillus plantarum* in feed production.

[0011] This invention provides, in one aspect, the application of the aforementioned *Lactobacillus plantarum* in the preparation of *Clostridium perfringens* inhibitors.

[0012] The present invention also provides a probiotic preparation comprising the above-mentioned Lactobacillus plantarum.

[0013] The probiotic preparation further includes any one or more of Bacillus licheniformis, Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus coagulans, Enterococcus lactis, Clostridium butyricum, Saccharomyces cerevisiae, Enterococcus faecalis, Bifidobacterium, Enterococcus faecium, Pediococcus lactis, and Lactobacillus acidophilus.

[0014] The probiotic agent contains no less than 10 live Lactobacillus plantarum bacteria. 8 CFU / g.

[0015] This invention also provides the application of the above-mentioned probiotic preparation in feed production.

[0016] The Lactobacillus plantarum WL-81 provided by this invention has a strong acid-producing ability. Its fermentation metabolites mainly contain three organic acids, among which lactic acid has the highest content, reaching 18.40 g / L, while acetic acid and propionic acid have contents of 5.96 g / L and 6.64 g / L, respectively.

[0017] Lactobacillus plantarum WL-81 exhibits remarkable inhibitory effects against a variety of pathogens. Among them, the inhibition zone diameters of duck-derived Escherichia coli, swine-derived Escherichia coli, Salmonella pullorum, Clostridium perfringens, and Clostridium perfringens all exceed 20 mm. The inhibitory effect on Clostridium perfringens B3 is the strongest, with an inhibition zone diameter as high as 24.6 mm, achieving unexpected technical results.

[0018] Lactobacillus plantarum WL-81 has strong antioxidant capacity. Its cells and supernatant can significantly scavenge DPPH free radicals and hydroxyl free radicals (p<0.05), with degradation rates of 92.75% and 70.38%, respectively. It also has a certain scavenging effect on superoxide anion free radicals, with a degradation rate of 55.19%.

[0019] Lactobacillus plantarum WL-81 significantly reduced the impact of Clostridium perfringens on broiler chickens, improved production performance, reduced mortality, decreased intestinal damage, and maintained intestinal flora stability and overall health. Compared with the infected group, broiler chickens fed with Lactobacillus plantarum WL-81 powder showed an average daily weight gain of 12.83% (p<0.05), and a decrease in feed conversion ratio and mortality rate of 2.76% and 7.61%, respectively. They also exhibited fewer intestinal bleeding points, less intestinal damage, a decrease in Clostridium perfringens and Enterobacteriaceae counts, and a significant increase in Lactobacillus counts, demonstrating a highly significant effect.

[0020] The Lactobacillus plantarum WL-81 provided by this invention can be used alone or in combination with other probiotics and widely applied in livestock and poultry feed production. It can effectively improve the production performance of farmed animals, maintain their health, and has broad prospects. Attached Figure Description

[0021] Figure 1This is a colony morphology diagram of Lactobacillus plantarum WL-81.

[0022] Figure 2 Gram staining image of Lactobacillus plantarum WL-81;

[0023] Figure 3 Chromatographic diagram of organic acid detection in Lactobacillus plantarum WL-81;

[0024] Figure 4 Image showing Lactobacillus plantarum WL-81 adhering to Caco-2 cells. Detailed Implementation

[0025] The present invention will be further described below with reference to specific embodiments. For the specific methods or materials used in the embodiments, those skilled in the art can make conventional substitutions based on the technical concept of the present invention and existing technologies, and are not limited to the specific descriptions in the embodiments of the present invention.

[0026] The method for preparing the MRS culture medium in this embodiment of the invention is as follows: 20.0g glucose, 10.0g peptone, 10.0g yeast extract, 5.0g sodium acetate, 1.0ml Tween 80, 2.0g dipotassium hydrogen phosphate, 2.0g triammonium citrate, 0.2g magnesium sulfate, 0.05g manganese sulfate, 1000ml distilled water, pH 6.2±0.2, sterilized at 121℃ for 15min, and 15g agar added to the solid culture medium.

[0027] Example 1: Isolation and Screening of Strains

[0028] 1.1 Sample Collection

[0029] Cecal contents were collected from healthy Cherry Valley ducks at a breeding farm in Pingdu City, Qingdao, Shandong Province, placed in sterile sampling bags, and stored under cold storage.

[0030] 1.2 Separation and Screening

[0031] Take 25g of cecal contents and place them in a sterile Erlenmeyer flask. Add 225ml of sterile physiological saline and shake to prepare a suspension. Dilute the suspension stepwise to the appropriate concentration in a 10-fold gradient. Select the last three concentrations of dilution for plating. Use a sterile pipette tip to pick up 100μL of each concentration of dilution and spread each concentration onto two MRS agar plates containing 0.05% calcium carbonate. Incubate at 37°C for 48 hours.

[0032] Utilizing the principle that lactic acid bacteria dissolve calcium salts after producing acid, we observed the formation of smooth colonies with clear zones on plates. After initial screening and culture, we obtained 8 colonies, which were named R1, R2, R3... to R8. We then picked some of them for streak purification.

[0033] Evaluation of bacterial growth performance: The faster the proliferation rate of lactic acid bacteria, the shorter the time it takes for metabolic acid production to lower the pH of the culture medium. Strains R1, R2, R3… to R8 were inoculated into liquid MRS medium and cultured at 37°C. The pH of the medium was measured every 4 hours. Sterile liquid MRS medium was used as a blank control group. The experimental results are shown in Table 1.

[0034] Table 1. Growth of bacterial cells in liquid culture

[0035]

[0036]

[0037] As shown in Table 1, among the eight strains obtained by screening in this invention, strain R5 performed the best. In the liquid expansion stage, it could reduce the pH of the culture medium to 3.9 in 24 hours, indicating that strain R5 has the advantages of rapid proliferation and significant acid production.

[0038] The applicant named strain R5 WL-81 and conducted further identification and performance evaluation.

[0039] Example 2 Identification of strain WL-81

[0040] 2.1 Colony morphology and microscopic characteristics

[0041] Streak strain WL-81 on solid MRS medium and incubate for 45-48 hours. The colony morphology of this strain is as follows: Figure 1 As shown, the colonies are about 2-4 mm in diameter, appearing as opaque colonies, pale yellow or milky yellow in color, with a smooth surface and no wrinkles at the edges.

[0042] Gram staining results of strain WL-81 are as follows: Figure 2 As shown, this strain is Gram-positive and has two pairs of short rod-shaped growths.

[0043] 2.2 Physiological and Biochemical Characteristics

[0044] The WL-81 strain was cultured on solid MRS medium for 45-48 hours. Single colonies were selected and cultured according to the instructions of the Biomerieux API bacterial reagent strips. After 24 hours of incubation, statistical data were collected, and the physiological and biochemical characteristics of the strain were analyzed. The results are shown in Table 2.

[0045] Table 2 Physiological and biochemical characteristics of strain WL-81

[0046]

[0047]

[0048] Note: +: positive reaction; -: negative reaction; W: weak positive reaction.

[0049] 2.3 Molecular Identification of 16S rDNA

[0050] The genome of strain WL-81 was extracted using a kit. Using this genome as a template, the 16S rDNA sequence was amplified using PCR. The amplified PCR products were detected by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing.

[0051] Experimental primer sequences: 27F: AGAGTTTGATCCTGGCTCA; 1492R: GGTTACCTT GTTA CGACTT.

[0052] The results showed that the 16S rDNA sequence of strain WL-81 was SEQ ID NO:1, with a length of 1462 bp. The specific sequence is as follows:

[0053]

[0054] By performing a BLAST comparison of SEQ ID NO:1 in the NCBI database, it was found that it had a similarity of 99.89% with Lactobacillus plantarum. Therefore, strain WL-81 was preliminarily identified as Lactobacillus plantarum.

[0055] 2.4 MALDI-TOF-MS protein spectroscopy identification

[0056] A small amount of newly activated WL-81 single colony was picked and coated onto a target plate in the form of a thin film; 1 μL of lysis buffer from the mass spectrometry sample pretreatment kit was added, and the sample was allowed to air dry at room temperature; 1 μL of matrix solution from the mass spectrometry sample pretreatment kit was added to cover the sample, and the sample was allowed to air dry at room temperature; the sample target was then placed in a mass spectrometer for identification. The identification results showed that strain WL-81 was *Lactobacillus plantarum*.

[0057] In summary, the applicant used two molecular biology methods—16S rRNA sequencing and MALDI-TOF-MS proteometry—to identify strain WL-81, and the identification results were consistent. Based on the colony morphology and microscopic characteristics of strain WL-81, the applicant identified the strain as *Lactobacillus plantarum* and named it *Lactobacillus plantarum* WL-81.

[0058] The applicant deposited the aforementioned Lactobacillus plantarum WL-81 at the China Center for Type Culture Collection, Wuhan University, Wuhan, China on January 16, 2025, with accession number CCTCC NO: M2025167.

[0059] Example 3 Evaluation of the acid-producing capacity of Lactobacillus plantarum WL-81

[0060] 3.1 Preparation of test bacterial suspension

[0061] Lactobacillus plantarum WL-81 was inoculated into MRS medium and cultured at 37°C for 48 h. After centrifugation at 10000 r / min for 5 minutes, the supernatant was collected and passed through a 0.22 μm filter for later use.

[0062] Comparison with commercially available Lactobacillus plantarum samples: Inoculated into MRS medium, cultured at 37°C for 48 h, centrifuged at 10000 r / min for 5 min, collected the supernatant and passed through a 0.22 μm filter for later use.

[0063] 3.2 Analysis of the acid-producing capacity of Lactobacillus plantarum WL-81

[0064] Organic acids in the supernatant were quantitatively analyzed by high-performance liquid chromatography (HPLC) using a UV detector. The measurement conditions were: wavelength 210 nm; mobile phase: 0.1% phosphoric acid aqueous solution. A blank control group was prepared by filtering blank MRS medium through a 0.22 μm filter before loading. Results are shown in Table 3. Figure 3 .

[0065] Table 3. Analysis of acid production during fermentation of Lactobacillus plantarum WL-81

[0066]

[0067] Depend on Figure 3 As shown in Table 3, the *Lactobacillus plantarum* WL-81 provided by this invention has a strong acid-producing capacity. The fermentation metabolites of this strain mainly contain three organic acids, among which lactic acid has the highest content, reaching 18.40 g / L, while acetic acid and propionic acid have contents of 5.96 g / L and 6.64 g / L, respectively.

[0068] Example 4 Evaluation of the antibacterial ability of Lactobacillus plantarum WL-81

[0069] 4.1 Preparation of test bacterial suspension

[0070] Colonies of Lactobacillus plantarum WL-81 were picked and inoculated into MRS medium and cultured at 37°C for 48 hours to obtain bacterial culture.

[0071] 4.2 Preparation of pathogenic bacterial suspension

[0072] Seven strains of bacteria, including *E. coli* ATCC 25922, *Staphylococcus aureus* ATCC 6538, duck-derived *E. coli* 2568, swine-derived *E. coli* 2721, *Salmonella pullorum* BY8384, chicken-derived *Salmonella*, and swine-derived *Salmonella*, were inoculated into nutrient broth medium and incubated overnight at 37°C and 220 rpm. *Clostridium perfringens* BNCC 125404 (chicken-derived), *Clostridium perfringens* B3 (swine-derived), *Clostridium perfringens* ATCC13124, *Clostridium perfringens* CICC25011, and *Clostridium difficile* CICC22951, were inoculated into commercially available enhanced clostridium medium and incubated anaerobically at 37°C overnight. *Riemerella anatipestifer* R2 was inoculated into TSB (with 4% serum added) medium and incubated overnight at 37°C and 220 rpm. Pasteurella multocida BNCC270568 was plated on Columbia blood agar plates, and after the colonies had grown, it was rinsed with sterile water and resuspended for later use.

[0073] Before the antibacterial experiment, each strain of the pre-cultured pathogen was diluted 100 times with sterile water to prepare a working suspension of the pathogen.

[0074] 4.3 Evaluation of antibacterial ability

[0075] Preparation of plates containing pathogens: Pour about 18-20 mL of sterile nutrient agar medium into each plate, spread the medium evenly, and place it on a horizontal platform to solidify for later use; take 100 μL of the working suspension of pathogens and disperse it on the surface of the medium, and spread it evenly with glass beads; use a punch to make holes in the plate, pick out the excess medium, heat it briefly in an alcohol lamp flame, and then seal the plate.

[0076] Sample loading: 100 μL of *Lactobacillus plantarum* WL-81 bacterial suspension was added to the sample wells. After standing until the liquid in the wells dried, the wells were incubated at 37°C for 24 h, and the diameter of the inhibition zone was measured. Sterile MRS medium was used as a blank control. The experimental results are shown in Table 4.

[0077] Table 4. Antibacterial effect of Lactobacillus plantarum WL-81 against pathogens.

[0078]

[0079]

[0080] As shown in Table 4, the *Lactobacillus plantarum* WL-81 screened in this invention exhibits significant inhibitory effects against a variety of pathogens. Among them, the inhibition zone diameters of *Escherichia coli* from ducks, *Escherichia coli* from pigs, *Salmonella pullorum*, *Clostridium perfringens* from chickens, *Clostridium perfringens* from pigs, and *Clostridium perfringens* all exceed 20 mm. The inhibitory effect on *Clostridium perfringens* B3 from pigs is the strongest, with an inhibition zone diameter as high as 24.6 mm, achieving unexpected technical results.

[0081] Example 5: Determination of the in vitro antioxidant capacity of Lactobacillus plantarum WL-81

[0082] 5.1 Preparation of test samples

[0083] Lactobacillus plantarum WL-81 was inoculated into MRS medium and cultured at 37°C for 48 h. The supernatant was separated from the bacterial cells by centrifugation at 10000 r / min for 5 minutes. The supernatant was collected as the experimental supernatant group. The bacterial cells were collected, washed twice with sterile water, and a bacterial suspension was prepared as the experimental bacterial cell group.

[0084] 5.2 Determination of DPPH free radical scavenging ability

[0085] Take 1 mL of sample and 1 mL of DPPH free radical solution (0.2 mmol / L, dissolved in anhydrous ethanol), mix thoroughly, react in the dark for 30 min, and measure the absorbance at 517 nm, denoted as A. 样品 The control group was treated with 1 mL of anhydrous ethanol instead of the DPPH radical solution, and the absorbance was recorded as A. 对照The blank group was prepared by replacing the sample solution with 1 mL of anhydrous ethanol, and the absorbance was recorded as A. 空白 DPPH free radical scavenging rate % = [1 - (A 样品 -A 对照 ) / A 空白 ×100%.

[0086] 5.3 Hydroxyl radical scavenging capacity determination

[0087] Take 1 mL of 0.02 mol / L PBS (pH = 7.4) in a test tube, add 1 mL of 2.5 mmol / L o-phenanthroline and 1 mL of deionized water, mix thoroughly, then add 1 mL of 2.5 mmol / L FeSO4 solution and mix well (mix immediately after adding FeSO4 to each tube). Then add 1 mL of sample solution and 1 mL of 20 mmol / L H2O2 solution, incubate at 37°C for 1.5 h, and immediately place on ice. Measure the absorbance at 536 nm and record it as A. 样品 Using deionized water instead of the sample solution, the absorbance was measured at 536 nm and denoted as A. 损伤 Deionized water was used to replace both the sample and the H2O2 solution, and the absorbance was measured at 536 nm, denoted as A. 未损伤 .

[0088] Hydroxyl radical scavenging rate % = [(A 样品 -A 损伤 ) / (A 未损伤 -A 损伤 )]×100%.

[0089] 5.4 Determination of Superoxide Anion Radical Scavenging Capacity

[0090] Take 1 mL of sample and add 0.5 mL of 300 μmol / L NBT, 0.3 mL of 468 μmol / L NADH, and 0.5 mL of 60 μmol / L phenazine methyl sulfate (PMS) sequentially. Mix thoroughly and incubate at 25°C for 5 min. Measure the absorbance at 560 nm and record it as A. 样品 The blank tube was replaced with 50 mmol / L Tris-HCl buffer solution (pH = 8.0) instead of the sample solution, and the absorbance was measured at 560 nm, denoted as A. 空白 All the above reagents were prepared using Tris-HCl buffer solution.

[0091] Superoxide anion radical scavenging rate (%) = (1-A) 样品 / A 空白 )×100%.

[0092] The results are shown in Table 5.

[0093] Table 5. Determination of in vitro antioxidant capacity of Lactobacillus plantarum WL-81

[0094]

[0095] As shown in Table 5, the Lactobacillus plantarum WL-81 provided by this invention has a strong antioxidant capacity. Its cells and supernatant can significantly scavenge DPPH free radicals and hydroxyl free radicals (p<0.05), with degradation rates of 92.75% and 70.38%, respectively. It also has a certain scavenging effect on superoxide anion free radicals, with a degradation rate of 55.19%.

[0096] Example 6 Evaluation of the adhesion ability of Lactobacillus plantarum WL-81 cells

[0097] 6.1 Preparation of test bacterial cells

[0098] Lactobacillus plantarum WL-81 was activated for 3 generations in MRS medium, centrifuged at 10000 r / min for 5 min, and the cells were collected. After washing twice with sterile phosphate buffer (PBS, pH 7.2), the cells were resuspended in sterile PBS.

[0099] 6.2 Culture of Caco-2 cells

[0100] Caco-2 cells were cultured in DMEM medium supplemented with 20% heat-inactivated (30 min, 56 °C) fetal bovine serum and 1% penicillin-streptomycin. The Caco-2 cells were incubated at 37 °C in a CO2 incubator with the medium changed every 1 day.

[0101] 6.3 Adhesion Test

[0102] In 6-well plates, Caco-2 cells were cultured in a CO2 incubator until they formed a monolayer, followed by an adhesion assay. The cells were washed twice with sterile PBS, and 1 mL of *Lactobacillus plantarum* WL-81 bacterial suspension was added. The plates were incubated at 37°C for 2 hours. The bacterial suspension was then removed, and the cells were washed four times with sterile PBS to remove any unadhered cells. 500 μL of trypsin was added for digestion for 3 minutes, followed by 1.5 mL of cell culture stop solution. The digestion was repeated by pipetting, and the plates were serially diluted before plate counting.

[0103] Adhesion capacity = Total number of bacteria adhering in each culture well / Total number of cells in each culture well.

[0104] Table 6. Adhesion of Lactobacillus plantarum WL-81 to Caco-2 cells.

[0105]

[0106] Table 6 shows that *Lactobacillus plantarum* WL-81 has a certain ability to adhere to cells. Combined with microscopic observation results, as follows... Figure 4As shown, Lactobacillus plantarum WL-81 cells adhere to the surface of Caco-2 cells, which helps the cells colonize the intestine and exert a probiotic effect.

[0107] Example 7: Preparation of freeze-dried Lactobacillus plantarum WL-81 bacterial powder

[0108] 7.1 Preparation of freeze-dried bacterial powder

[0109] Bacterial suspension collection: The Lactobacillus plantarum WL-81 bacterial suspension cultured in Example 3 was dispensed into sample bottles and refrigerated at 4°C to keep the bacterial suspension fresh;

[0110] Centrifugation of bacterial cells: Set the centrifugation conditions to 8000 rpm for 10 min. After centrifugation, discard the supernatant and collect Lactobacillus plantarum WL-81 cells for later use.

[0111] Freeze-drying: In this embodiment, peptone and glucose were selected as carriers and mixed with the collected Lactobacillus plantarum WL-81 cells at a ratio of 3:1. The mixture was then placed in a vacuum freeze dryer for freeze-drying. After freeze-drying, Lactobacillus plantarum WL-81 bacterial powder was obtained.

[0112] Bacterial count determination of Lactobacillus plantarum WL-81 bacterial powder: Weigh 1g of Lactobacillus plantarum WL-81 bacterial powder, add 9mL of sterile water, shake to mix, and dilute stepwise with sterile water in 10-fold increments. The bacterial count was determined using the MRS agar pour method. The calculated viable count was 1.00 × 10⁻⁶. 11 CFU / g.

[0113] 7.2 Stability determination of freeze-dried bacterial powder

[0114] The freeze-dried Lactobacillus plantarum WL-81 bacterial powder was divided into 5 equal portions, sealed in aluminum foil bags, and stored in a medical refrigerator (4-8℃). Samples were taken every 3 months to determine the bacterial count and test the stability of the bacterial powder.

[0115] The results showed that the freeze-dried Lactobacillus plantarum WL-81 bacterial powder prepared by vacuum freeze-drying maintained a stable bacterial count overall during storage at 4-8℃, excluding counting errors, and the survival rate was still as high as 98.5% after 12 months of storage.

[0116] Example 8: Effect of Lactobacillus plantarum WL-81 on the growth of broiler chickens infected with Clostridium perfringens

[0117] 8.1 Experimental Design

[0118] Two hundred and fifty-two one-day-old male AA broiler chicks were purchased from a hatchery for the experiment. They were randomly divided into three treatment groups, with six replicates per group and 14 chicks per replicate. The three treatment groups were a control group, an infection group, and a *Lactobacillus plantarum* group. Throughout the experiment, the control and infection groups were fed a corn-soybean meal basal diet, while the *Lactobacillus plantarum* group received a 1×10⁻⁶ mcg supplement to their basal diet. 9 CFU / kg Lactobacillus plantarum WL-81 bacterial powder.

[0119] Broilers in both the infected group and the *Lactobacillus plantarum* group were orally administered *Clostridium perfringens* CVCC2030 bacterial suspension (1×10⁻⁶) continuously from day 14 to 20. 8 The chickens were inoculated with 1 mL of sterile broth culture medium (CFU / mL) daily. Control group broilers were orally administered 1 mL of sterile broth culture medium daily. The experiment lasted 21 days.

[0120] 8.2 Growth Performance Statistics

[0121] Weigh the broiler chickens at 1, 14 and 21 days of age, record feed intake and mortality, and calculate the data from 14 to 21 days of age.

[0122] Table 7 Effects of Lactobacillus plantarum WL-81 on growth performance of broiler chickens aged 14-21 days

[0123]

[0124]

[0125] Table 7 shows that, compared with the control group, the growth of broiler chickens was affected to some extent after infection with Clostridium perfringens. Compared with the infected group, the average daily weight gain of broiler chickens fed with Lactobacillus plantarum WL-81 powder increased by 12.83% (p<0.05), while the feed conversion ratio and mortality rate decreased by 2.76% and 7.61%, respectively. This indicates that the Lactobacillus plantarum WL-81 provided by this invention can significantly reduce the impact of Clostridium perfringens on broiler chickens, reduce broiler chicken mortality, and improve production performance.

[0126] 8.3 Intestinal Injury Score

[0127] At 21 days of age, seven chickens were randomly selected from each treatment and euthanized by venipuncture. The abdominal cavity was opened, and the pathological changes in the jejunum and ileum were observed visually. The severity of intestinal damage was assessed using a five-level scale (0-3 points): 0 (no obvious damage); 0.5 (severe congestion of the serosa and mesentery of the small intestine); 1 (thin and brittle intestinal wall with red petechiae); 2 (gas in the intestinal lumen, pinpoint necrosis or ulceration on the intestinal wall); and 3 (gas filling the intestinal lumen, patchy necrosis or ulceration on the intestinal wall).

[0128] Table 8. Effects of *Lactobacillus plantarum* WL-81 on the intestinal tract of 21-day-old broiler chickens infected with *Clostridium perfringens*.

[0129]

[0130] Table 8 shows the intestinal injury score, indicating that the control group broiler chickens had virtually no significant intestinal damage. In the infected group, most broiler chickens showed mucosal shedding and petechiae in the duodenum and jejunum, and some also exhibited intestinal bloating. Broiler chickens fed with *Lactobacillus plantarum* WL-81 powder had fewer petechiae and less intestinal damage than the infected group. This demonstrates that *Lactobacillus plantarum* WL-81 can significantly reduce intestinal damage in broiler chickens infected with *Clostridium perfringens*.

[0131] 8.4 Intestinal Microbiome Assay

[0132] The qRT-PCR method (Du et al., 2015) was used to count Clostridium perfringens, Enterobacteriaceae, and Lactobacillus in intestinal chyme. Total DNA was extracted from the chyme as a template, and the primer sequences were as follows:

[0133] Clostridium perfringens F(5'-3'):AAAGATGGCATCATCATTCAAC;

[0134] R(5'-3'):TACCGTCATTATCTTCCCCAAA;

[0135] Enterobacteriaceae F(5'-3'):GTTAATACCTTTGCTCATTGA;

[0136] R(5'-3'):ACCAGGGTATCTAATCCTGT;

[0137] Lactobacillus group F (5'-3'): AGCAGTAGGGAATCTTCCA;

[0138] R(5'-3'):CACCGCTACACATGGAG.

[0139] The results showed that, compared with the control group, the number of *Clostridium perfringens* and *Enterobacter* in the intestines of broiler chickens infected with *Clostridium perfringens* was significantly increased (p<0.05), while the number of *Lactobacillus* was significantly decreased. Compared with the infected group, the number of *Clostridium perfringens* and *Enterobacter* in the intestines of broiler chickens fed *Lactobacillus plantarum* WL-81 powder was significantly decreased, while the number of *Lactobacillus* was significantly increased. This indicates that *Lactobacillus plantarum* WL-81 helps maintain the balance of intestinal flora in broiler chickens, ensuring their health, and has a significant effect.

Claims

1. A type of Lactobacillus plantarum, characterized in that, The preservation number of the Lactobacillus plantarum is CCTCC NO: M 2025167.

2. The application of Lactobacillus plantarum as described in claim 1 in the preparation of feed.

3. The use of *Lactobacillus plantarum* as described in claim 1 in the preparation of *Clostridium perfringens* inhibitor.

4. A probiotic preparation, characterized in that, The probiotic preparation comprises Lactobacillus plantarum as described in claim 1.

5. The probiotic preparation as described in claim 4, characterized in that, The probiotic preparation further includes any one or more of Bacillus licheniformis, Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus coagulans, Enterococcus lactis, Clostridium butyricum, Saccharomyces cerevisiae, Enterococcus faecalis, Bifidobacterium, Enterococcus faecium, Pediococcus lactis, and Lactobacillus acidophilus.

6. The probiotic preparation as described in claim 4 or 5, characterized in that, The probiotic preparation contains no less than 10 live Lactobacillus plantarum bacteria. 9 CFU / g.

7. The use of the probiotic preparation according to claim 4 or 5 in the preparation of feed.

8. The use of the probiotic preparation according to claim 4 or 5 in the preparation of Clostridium perfringens inhibitors.

Images