Bidirectional burkholderia and application thereof
By providing Burkholderia ambifaria DY76 strain with nitrogen fixation, phosphorus dissolving, potassium decomposition, iron phage and IAA production characteristics, the problem of single function of Burkholderia strain in the prior art was solved, and a significant promotion effect on the growth of corn and wheat seedlings was achieved.
Patent Information
- Application Number
- CN202510618947.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-15
Smart Images

Figure CN120485034A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of growth-promoting rhizobacteria (PGPR), and in particular to a strain of Burkholderia ambifaria DY76 and applications thereof. Background Art
[0002] Burkholderia bacteria are widely present in nature, particularly in soil and plant rhizospheres. They synthesize a variety of natural products with diverse activities, rich results, and a wide range of applications. Burkholderia strains have great potential for promoting plant growth. Studies have shown that they can enhance nitrogen and phosphorus uptake by plants through biological nitrogen fixation and phosphate solubilization, while also producing plant hormones such as IAA, which promotes plant growth. Sondo et al. isolated a Burkholderia strain from the rice rhizosphere that produces siderophores and phosphate solubilization, demonstrating significant growth-promoting effects. Kaur et al. isolated the Burkholderia strain FDAARGOS_7 from rhizosphere soil, which can solubilize TCP, produce enzymes, and produce plant hormones. Chen et al. isolated the Burkholderia strain BK01 from the wheat rhizosphere, which can solubilize phosphate, produce IAA, and retain exopolysaccharides. Burkholderia strains produce a variety of antimicrobial compounds, including volatile gases, that can enhance plant stress resistance. They also play important roles in degradation, bioremediation, and biotransformation. Therefore, Burkholderia has great potential for research and development in agricultural production as well as environmental governance.
[0003] Current studies have not found any Burkholderia that can simultaneously solubilize phosphate, dissolve potassium, engulf iron, produce iron carriers, and secrete auxins. In addition, there is no research on the bidirectional Burkholderia, and its genome sequence is still unclear. Summary of the Invention
[0004] The purpose of the present invention is to address the deficiencies of existing research and provide a strain of Burkholderia ambifaria DY76 with excellent growth-promoting properties and its application in promoting the growth of corn and wheat at the seedling stage.
[0005] In order to achieve the purpose of the present invention, the following technical solutions are provided:
[0006] A strain of Burkholderia ambifaria DY76 was deposited in the General Microbiology Center of the China Culture Collection Administration, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 32095 and the deposit date is September 27, 2024.
[0007] An application of the bidirectional Burkholderia, and the application of the strain in nitrogen fixation, phosphate solubilization, potassium solubilization and iron phagocytosis.
[0008] An application of the biphasic Burkholderia strain, and an application of the strain in promoting the growth of plant seedlings.
[0009] The plant is corn or wheat.
[0010] The Burkholderia ambifaria DY76 of the present invention has the characteristics of nitrogen fixation, phosphorus solubility, potassium solubility, iron phagocytosis and IAA production, and can promote the growth of corn and wheat seedlings at the seedling stage. After culturing for 72 hours, the cell concentration of Burkholderia ambifaria DY76 was OD 600nm =1.4-1.5, dilute the fermentation liquid to soak corn and wheat seeds for 24 hours and then culture.
[0011] At a bacterial concentration of 10 5 When hydroponics was used, the chlorophyll content of corn seedlings increased by 7.44%, the nitrogen content increased by 23.44%, the root length increased by 38.04%, the seedling length increased by 22.06%, the root weight increased by 31.48%, and the total dry weight increased by 32.80%. Soil culture increased the chlorophyll content of corn seedlings by 8.77%, the nitrogen content increased by 7.45%, the root length increased by 2.49%, the seedling length increased by 21.16%, the root weight increased by 6.67%, and the total dry weight increased by 22.78%.
[0012] At a bacterial concentration of 10 4 When hydroponics was used, the increase in chlorophyll and nitrogen content of wheat was not significant, increasing by 1.40% and 13.6%, respectively. Its root length and seedling length increased by 47.70% and 22.35%, respectively. Its total fresh weight and total dry weight also increased, by 54.50% and 154.39%, respectively. Soil culture increased wheat chlorophyll content by 16.81%, nitrogen content by 16.27%, root length by 43.02%, seedling length by 19.28%, seedling fresh weight by 77.64%, and seedling dry weight by 41.14%. Growth indicators are shown in Table 4.
[0013] A plant seedling growth-promoting agent, comprising the Burkholderia ambifaria DY76.
[0014] The growth promoting agent contains the culture, culture concentrate or culture suspension of the strain.
[0015] The culture is prepared by culturing the strain in a beef extract peptone liquid culture medium and shaking the culture; concentrating the obtained culture to obtain a concentrate; and resuspending the obtained concentrate in sterile water to obtain a culture suspension.
[0016] A soil conditioner containing the bidirectional Burkholderia DY76.
[0017] Beneficial effects of the present invention:
[0018] The Burkholderia ambifaria DY76 strain isolated from maize rhizosphere soil has a wide growth temperature range and is easily adaptable to various soil environments. It has nitrogen fixation, phosphorus solubilization, potassium solubilization, and iron chelation properties, and can promote the growth of maize seedlings. Therefore, it can be used to promote crop growth in crop production. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The present invention provides an example of the electrophoresis detection result of the DY76 strain 16S rRNA PCR amplification product; wherein M is a 3000bp DNA marker, and 1, 2, 3, and 4 are the 16S rRNA PCR amplification products of the DY76 strain.
[0020] Figure 2 The growth curve of Burkholderia ambifaria DY76 at 37°C is provided as an example of the present invention.
[0021] Figure 3 The present invention provides an example of the DY76 nitrogen fixation, phosphorus solubilization, potassium solubilization, iron engulfment and IAA production effect diagram; wherein A is the nitrogen fixation, phosphorus solubilization, potassium solubilization and iron engulfment effect, and B is the IAA production test result.
[0022] Figure 4 The DY76 Circos genome circle map provided as an example of the present invention; wherein A is the DY76 strain chr1 chromosome gene circle; B is the DY76 strain chr2 chromosome gene circle; C is the DY76 strain chr3 chromosome gene circle.
[0023] Figure 5 The present invention provides an example of the species distribution map of the sequence aligned to the DY76 NR database, wherein A is the species distribution map of the chromosome chr1 of the DY76 strain; B is the species distribution map of the chromosome chr2 of the DY76 strain; and C is the species distribution map of the chromosome chr3 of the DY76 strain.
[0024] Figure 6The present invention is an example of the DY76 GO functional annotation classification statistical diagram provided by the example, wherein A is the DY76 strain chr1 chromosome GO functional annotation classification statistical diagram; B is the DY76 strain chr2 chromosome GO functional annotation classification statistical diagram; C is the DY76 strain chr3 chromosome GO functional annotation classification statistical diagram.
[0025] Figure 7 The present invention is an example of a DY76 KEGG annotation classification statistical diagram, wherein A is a KEGG annotation classification statistical diagram of the DY76 strain chr1 chromosome; B is a KEGG annotation classification statistical diagram of the DY76 strain chr2 chromosome; C is a KEGG annotation classification statistical diagram of the DY76 strain chr3 chromosome.
[0026] Figure 8 is a statistical diagram of the eggNOG functional gene classification of DY76 provided by an example of the present invention, wherein A is a statistical diagram of the eggNOG functional gene classification of chromosome chr1 of DY76 strain; B is a statistical diagram of the eggNOG functional gene classification of chromosome chr2 of DY76 strain; C is a statistical diagram of the eggNOG functional gene classification of chromosome chr3 of DY76 strain.
[0027] FIG9 is a DY76 CAZy database statistics provided by an example of the present invention, wherein A is the CAZy database statistics of the DY76 strain chr1 chromosome; B is the CAZy database statistics of the DY76 strain chr2 chromosome; C is the CAZy database statistics of the DY76 strain chr3 chromosome.
[0028] Figure 10 This is a graph showing the growth of hydroponic corn seedlings with exogenously added DY76, provided as an example of the present invention.
[0029] Figure 11 This is a graph showing the growth of soil-cultured corn seedlings with exogenously added DY76, provided as an example of the present invention.
[0030] Figure 12 This is a graph showing the growth of hydroponic wheat seedlings with exogenously added DY76, provided as an example of the present invention.
[0031] Figure 13 This is a graph showing the growth of soil-cultured wheat seedlings with exogenously added DY76, provided as an example of the present invention. DETAILED DESCRIPTION
[0032] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.
[0033] In this study, a Burkholderia ambifaria strain was isolated from maize roots and its genome sequenced to investigate its growth-promoting properties and its effects on maize and wheat seedling growth. Therefore, screening Burkholderia ambifaria strains with growth-promoting properties provides a strain resource for related research.
[0034] Example 1 Isolation and Identification of Burkholderia ambifaria DY76
[0035] 1. Isolation of Burkholderia ambifaria DY76
[0036] At the experimental station treated with microbial fertilizer, 1 g of rhizosphere soil from two-leaf corn was taken and placed in a triangular flask containing 99 mL of sterile water and a small amount of glass beads. The flask was placed in a constant temperature shaker at 28°C and shaken at 180 rpm for 30 min to make the soil sample evenly dispersed in the diluent (sterile water) to make 10 -1 Dilution. Pipette 1mL 10 -1 The dilution was placed in a glass test tube containing 9 mL of sterile water and shaken to make 10 -2 Diluent. And so on, continue diluting until the dilution reaches 10 -6 This study selected 10 -3 , 10 -4 , 10 -5 Spread 0.1 mL of each of the three dilution gradients of soil dilution onto beef extract peptone medium plates and incubate at 30°C for 24 hours. After microbial colonies have grown on the plates, observe their morphology and select a few well-growing, moist, smooth, raised, and mucous single colonies of different bacteria. Streak these colonies onto beef extract peptone solid medium and incubate at 30°C for 24 hours. Repeat this method for at least three streak purification cultures, examining the purity under a microscope until a pure culture is obtained. Streak the culture onto the slope of a test tube and store in a refrigerator at 4°C until further use.
[0037] 2. Identification of Burkholderia ambifaria DY76
[0038] Single colonies obtained above were inoculated into liquid beef extract peptone medium and cultured at 37°C with shaking at 180 rpm for 24 hours. DNA was extracted from the fermentation broth using an Ezup column-based bacterial genomic DNA extraction kit. After DNA extraction, 16S rDNA was amplified by PCR. 16S rDNA amplification primers 27F (SEQ ID NO: 1) and 1492R (SEQ ID NO: 2) were used as upstream and downstream primers, and total DNA from LAD bacteria was used as a template. The reaction system consisted of 1.5 μL of total DNA from LAD bacteria; 12.5 μL of 2× TaqMasterMix; 0.5 μL of each upstream and downstream primer (10 μmol / L); and 10 μL of sterile water. Reaction conditions were: 94°C pre-denaturation for 5 minutes; 35 cycles of denaturation at 94°C for 1 minute, annealing at 60°C for 1 minute, and extension at 72°C for 90 seconds; and extension at 72°C for 10 minutes. The amplified product was detected by agarose gel electrophoresis. Weigh 0.4g agarose powder and add it to 40mL 1×TAE buffer. Heat until the agarose is completely dissolved, then add 2μL of DNA staining solution Goldview, mix well, pour it into the gel tank while hot, and insert the comb plate. Let it stand at room temperature for more than 20 minutes. After it is completely solidified, remove the comb plate vertically and place the prepared agarose gel into the electrophoresis tank filled with 1×TAE buffer. The buffer should cover the gel surface. Pipette 2μL of PCR product mixed with loading buffer and add it to the spotting hole of the agarose gel. Add DNA molecular weight standard (DNA marker) to one of the spotting holes. Turn on the power and perform electrophoresis at 5V / cm for 30 minutes. After the electrophoresis is completed, take out the agarose gel and gently place it on the UV transilluminator for imaging. The concentration and size of the amplified band are judged according to the DNA molecular weight standard (DNA marker). Figure 1 As shown, the expected specific band appeared at 1100-1500 bp, indicating successful 16S rDNA amplification. The 16S rDNA PCR product, detected by electrophoresis, was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared with GenBank, resulting in the following sequence. The results showed that strain DY76 was inferred to be Pantoea ananas through comparison with NCBI and named Burkholderia ambifaria DY76.
[0039] SEQ ID NO: 1
[0040] AGAGTTTGATCCTGGCTCAG
[0041] SEQ ID NO:2
[0042] TACGGCTACCTTGTTACGACTT
[0043] SEQ ID NO:3
[0044] DY76 16S rDNA sequence
[0045]
[0046] The isolated and purified strain is a Burkholderia ambifaria DY76, which has been deposited in the General Microbiology Center of the China Culture Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC NO 32095 and a deposit date of September 27, 2024.
[0047] Example 2 Determination of biological properties of Burkholderia ambifaria DY76
[0048] 1. Growth Curve Determination
[0049] The DY76 strain was selected and stored in a beef extract peptone liquid medium. The culture was shaken at 37°C and 180 rpm for 24 h to make the DY76 strain active. The activated bacterial solution was inoculated with 2 wt% of the inoculum into 50 mL of beef extract peptone liquid medium and cultured at 180 rpm at 37°C. The OD value of the bacterial solution was measured every 1 h. 600 The OD value is adjusted until it becomes stable. Three parallel groups are made and the blank medium is used as the control to draw the growth curve. Figure 2 As shown in the figure, the DY76 strain entered the exponential growth phase at 6 h and reached the stationary phase at 32 h, and there was no significant difference in the bacterial growth.
[0050] 2. Determination of nitrogen fixation capacity
[0051] Select the preserved DY76 strain and incubate it in beef extract peptone liquid medium at 37°C with shaking at 180 rpm for 24 hours to activate the DY76 strain. Then, inoculate 2.5 μL of the activated strain onto Axubei solid medium and incubate it in a 37°C incubator for 4 days to observe its growth.
[0052] 3. Determination of the ability to dissolve organic phosphorus
[0053] The DY76 strain was selected and stored in a beef extract peptone liquid medium and cultured at 37°C with shaking at 180 rpm for 24 hours to make the DY76 strain active. 2.5 μL of the activated bacterial solution was inoculated into a Montana solid medium and cultured in a 37°C constant temperature incubator for 7 days to observe and record whether the strain produced a phosphate ring (see Figure 3 ).
[0054] 4. Determination of potassium-dissolving ability
[0055] The DY76 strain was selected and stored in a beef extract peptone liquid medium. The culture was shaken at 37°C and 180 rpm for 24 hours to make the DY76 strain active. 2.5 μL of the activated bacterial solution was inoculated into a phosphate bacterial culture medium and cultured in a 37°C constant temperature incubator for 7 days. The strain was observed and recorded to see whether it produced potassium (see Figure 3 ).
[0056] 5. Ferrophage Ability Determination
[0057] The DY76 strain was selected and stored in a beef extract peptone liquid medium. The culture was shaken at 37°C and 180 rpm for 24 hours to make the DY76 strain active. 2.5 μL of the activated bacterial solution was added to the CAS medium and cultured in a 37°C constant temperature incubator for 7 days. The color change of the strain was observed and recorded (see Figure 3 ).
[0058] 6. Determination of IAA Production Capacity
[0059] King liquid medium was inoculated with 1% activated DY76 and cultured in a shaker at 37°C for 7 days. 100 μl of bacterial suspension was placed in a white ceramic colorimetric plate, and an equal volume of Spot colorimetric solution was added. The plate was kept in the dark for 15 minutes. The color change was observed using a blank medium as a control (see Figure 3 ).
[0060] Depend on Figure 3 It can be seen that in 3-A, DY-76 grows well on the nitrogen-fixing medium in the upper left, indicating that it has the ability to fix nitrogen; in the CAS-producing medium in the upper right, the color of the medium around the colony changes, indicating that it has the ability to produce siderophores; a transparent circle appears in the potassium-dissolving medium in the lower left, indicating that it has the ability to dissolve potassium; in the Montana medium in the lower right, the transparent circle around the DY76 colony is larger, indicating that it has a strong ability to dissolve phosphorus.
[0061] Example 3 Whole genome analysis of Burkholderia ambifaria DY76
[0062] 1. Whole-genome sequencing of Burkholderia ambifaria DY76
[0063] Total DNA from Burkholderia ambifaria DY76 was extracted using a bacterial genomic DNA extraction kit. DNA sample concentration, purity, and degradation were assessed using 1% agarose gel electrophoresis and a NanoDrop 2000. Sequencing was commissioned by Shanghai Paisono Biotechnology Co., Ltd. Sequencing data were assembled to generate the complete sequence.
[0064] 2. DY76 genome circle map
[0065] The genome of strain DY76 is 10,996,730 bp in size and contains three circular chromosomes. The GC content of chr1 is 67.00%. 3086 coding sequences, 62 tRNAs, and 12 rRNAs (4 each of 5S, 16S, and 23S rRNAs) are predicted. The genome circle map is shown in Figure 2. Figure 4 (a) The GC content of Chr2 is 66.81%, 2400 coding sequences, 6 tRNAs, and 3 rRNAs (1 each for 5S, 16S, and 23S rRNAs) are predicted, and the genome circle diagram is shown in Figure 4 (b) The GC content of Chr3 is 66.02%, 1089 coding sequences, 2 tRNAs, and 3 rRNAs (1 each for 5S, 16S, and 23S rRNAs) are predicted, and the genome circle diagram is shown in Figure 4 (c) The results showed that 270 genes were involved in amino acid transport and metabolism, 249 genes were involved in transcription, 216 genes were involved in cell wall / membrane / envelope biogenesis, 211 genes were involved in energy production and conversion, and 206 genes were involved in inorganic ion transport and metabolism, indicating that some of these genes are related to promoting plant growth.
[0066] 3. DY76 General Database Annotations
[0067] The species information obtained according to the NR database annotation is as follows Figure 5 As shown, DY76 and Burkholderia have the highest similarity in gene annotation. The genome sequence was compared with the GO database to obtain the distribution of functional genes of the strains. Figure 6 As shown in Figure 2, the largest number of genes is molecular function, followed by biological process and cellular component, involving a total of 71 secondary function entries. Functional annotations were obtained on 47 genes in the KEGG database, such as Figure 7As shown, a total of 1071 (528, 382 and 161) genes were annotated to signal transduction and cellular processes, 749 (519, 161, 69) genes were annotated to genetic information processing, 558 (282, 170, 106) genes were annotated to carbohydrate metabolism, 518 (261, 155, 102) genes were annotated to amino acid metabolism, and 392 (238, 105, 49) genes were annotated to metabolism. The annotation results of the eggNOG database are shown in Figure 8, among which 1196 (544, 474, 178) annotated genes have unknown functions. Among the annotated genes, 599 (270, 236, 93) belong to amino acid transport and metabolism; 702 (249, 321, 132) belong to transcription; 421 (216, 148, 57) belong to cell wall / membrane / envelope biosynthesis; 507 (211, 193, 103) belong to energy production and conversion; 450 (206, 179, 65) belong to inorganic ion transport and metabolism; 381 (170, 141, 70) belong to carbohydrate transport and metabolism.
[0068] 4. DY76 Metabolic System Analysis
[0069] The DY76 genome was aligned with the Carbohydrate Active Enzyme Database (CAZy), and the results are shown in Figure 9 , which includes 81 (43, 24, 14) glycosyltransferases (GTs); 58 (23, 19, 16) glycoside hydrolases (GHs); 36 (18, 9, 9) carbohydrate esterases (CEs); 26 (10, 11, 5) auxiliary active enzymes (AAs); 12 (7, 4, 1) carbohydrate binding modules (CBMs); and 3 (3, 0, 0) polysaccharide lyases (PLs).
[0070] The DY76 encoded protein was aligned with the polysaccharide utilization site database, and a total of 15 polysaccharide binding sites were obtained, including 5 polysaccharide binding sites such as bovatus_RS14860 in chr1; 5 polysaccharide binding sites such as CWS31_RS06505 in chr2; and 5 polysaccharide binding sites such as epsA in chr3.
[0071] The secondary metabolite gene clusters in DY76 were predicted, among which Region1 in chr1 had a 100% similarity with ornibactinC8, ornibactinC4, and ornibactinC6 NRPs; Region1 in chr2 had a 100% similarity with pyrrolnitrin Other; and Region4 in chr3 had a 94% similarity with occidiofungin A NRP+Polyketide.
[0072] Example 4: Burkholderia ambifaria DY76 promotes the growth of corn seedlings
[0073] 1. Pretreatment of Corn Seeds with DY76 Strain
[0074] Corn seed pretreatment: Place the corn seeds in a 55°C water bath for 5 minutes. After heat shock, sterilize the seeds with 70% alcohol for 1 minute, then with 4% sodium hypochlorite solution for 7 minutes. Finally, rinse with sterile water 7-8 times. Place the corn seeds in a petri dish and soak for 24 hours.
[0075] Pretreatment of DY76 strain: The preserved DY76 strain was placed in beef extract peptone liquid medium and cultured at 37°C with shaking at 180 rpm for 24 h to make the DY76 strain active. 1 mL of bacterial solution was placed in a 1.5 mL centrifuge tube and centrifuged at 5000 rpm for 3 min. The supernatant was removed and the precipitate was thoroughly dispersed and mixed with 1 mL of ddH2O to make the bacterial suspension OD 600 ≈1.5. The DY76 bacterial suspension was diluted in series to obtain dilutions of 10 3 , 10 4 , 10 5 , 10 6 DY76 bacterial suspension.
[0076] 2. Promoting effect of exogenous addition of DY76 on corn seedlings
[0077] Corn seeds were hydroponically cultured with the resulting bacterial suspension, with water serving as a blank control. Corn seeds were then soaked in various concentrations of the DY76 suspension and water for 24 hours. A portion of the corn seedlings with good growth were transplanted into hydroponic devices containing the diluted DY76 suspension, with five seedlings per device. The remaining portion was transplanted into soil-based devices and watered with the DY76 suspension. The seedlings were incubated in a light incubator for 14 days (16 hours at 26°C under 15,000 Lux light intensity, followed by 8 hours in the dark at 18°C). Growth indicators were then measured. Water was used as a control, and each experiment was conducted in triplicate.
[0078] After exogenous addition of DY76, each concentration was better than the control, and the concentration of 10 5 The growth of hydroponic corn seedlings was significantly higher than that of the control group. Figure 10 As shown in Table 1, the chlorophyll content increased by 7.44%, the nitrogen content increased by 23.44%, the root length increased by 38.04%, the seedling length increased by 22.06%, the root weight increased by 31.48%, and the total dry weight increased by 32.80%. The growth indicators are shown in Table 1.
[0079] After exogenous addition of DY76, each concentration was better than the control, and the concentration of 10 5 The growth of soil-cultured corn seedlings was significantly higher than that of the control group. Figure 11 As shown in Table 2, the chlorophyll content increased by 8.77%, the nitrogen content increased by 7.45%, the root length increased by 2.49%, the seedling length increased by 21.16%, the root weight increased by 6.67%, and the total dry weight increased by 22.78%. The growth indicators are shown in Table 2.
[0080] Table 1 Growth of hydroponic corn seedlings with exogenous DY76
[0081]
[0082] Table 2 Growth of soil-cultured corn seedlings with exogenous DY76 addition
[0083]
[0084] Example 5: Burkholderia ambifaria DY76 promotes wheat growth
[0085] 1. Pretreatment of Wheat Seeds with DY76 Strain
[0086] Wheat seed pretreatment: Place the wheat seeds in a 55°C water bath for 5 minutes. After heat shock, sterilize the seeds with 70% alcohol for 1 minute, then with 4% sodium hypochlorite solution for 7 minutes. Finally, rinse with sterile water 7-8 times. Place the wheat seeds in a petri dish and soak for 24 hours.
[0087] Pretreatment of DY76 strain: The preserved DY76 strain was placed in beef extract peptone liquid medium and cultured at 37°C with shaking at 180 rpm for 24 h to make the DY76 strain active. 1 mL of bacterial solution was placed in a 1.5 mL centrifuge tube and centrifuged at 5000 rpm for 3 min. The supernatant was removed and the precipitate was thoroughly dispersed and mixed with 1 mL of ddH2O to make the bacterial suspension OD 600 ≈1.5. The DY76 bacterial suspension was diluted in series to obtain dilutions of 10 3 , 10 4 , 10 5 , 10 6 DY76 bacterial suspension.
[0088] 2. Promoting effect of exogenous addition of DY76 on wheat seedlings
[0089] Wheat seeds were hydroponically cultured with the bacterial suspensions obtained above at varying concentrations. Water served as a blank control. Wheat seeds were then soaked in various concentrations of the DY76 suspension and water for 24 hours. A portion of the corn seedlings with good growth were transplanted into hydroponic devices containing the diluted DY76 suspension, with 10 seedlings per device. The remaining portion was transplanted into soil culture devices and watered with the DY76 suspension. The seedlings were incubated in a light incubator for 14 days (16 hours at 26°C under 15,000 Lux light intensity, followed by 8 hours in the dark at 18°C). Growth indicators were then measured. Water served as a control. Three replicates were set up for each experiment.
[0090] After exogenous addition of DY76, each concentration was better than the control, and the concentration of 10 4 The growth of hydroponic wheat seedlings was significantly higher than that of the control group. Figure 12 As shown in Table 3, the increase in chlorophyll content and nitrogen content was not obvious, increasing by 1.40% and 13.6% respectively. The root length and seedling length increased by 47.70% and 22.35% respectively. The total fresh weight and total dry weight increased by 54.50% and 154.39% respectively. The growth indicators are shown in Table 3.
[0091] Table 3 Growth of hydroponic wheat seedlings with exogenous DY76
[0092]
[0093] After exogenous addition of DY76, each concentration was better than the control, and the concentration of 10 4 The growth of soil-cultured wheat seedlings was significantly higher than that of the control group. Figure 13 As shown in Table 4, the chlorophyll content increased by 16.81%, the nitrogen content increased by 16.27%, the root length increased by 43.02%, the seedling length increased by 19.28%, the seedling fresh weight increased by 77.64%, and the seedling dry weight increased by 41.14%. The growth indicators are shown in Table 4.
[0094] Table 4 Growth of soil-cultured wheat seedlings with exogenous DY76 addition
[0095]
Claims
1. A bispecific Burkholderia strain characterized by: The strain is Burkholderia ambifaria DY76, which is deposited in the General Microbiology Center of the China Culture Collection Administration, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 32095 and the deposit date is September 27, 2024.
2. A use of the biphasic Burkholderia according to claim 1, characterized in that: The strain is used in nitrogen fixation, phosphorus dissolution, potassium dissolution and iron phagocytosis.
3. A use of the bidirectional Burkholderia according to claim 1, characterized in that: The invention relates to an application of the strain in promoting the growth of plant seedlings.
4. The use of the bidirectional Burkholderia according to claim 3, characterized in that: The plant is corn or wheat.
5. A plant seedling growth promoter, characterized in that: The growth promoter contains the Burkholderia ambifaria DY76 according to claim 1.
6. The plant seedling growth promoting agent according to claim 5, characterized in that The growth promoter contains the culture, culture concentrate or culture suspension of the strain according to claim 1.
7. The plant seedling growth promoting agent according to claim 6, characterized in that The culture is prepared by culturing the strain in a beef extract peptone liquid culture medium and shaking the culture; concentrating the obtained culture to obtain a concentrate; and resuspending the obtained concentrate in sterile water to obtain a culture suspension.
8. A soil conditioner, characterized in that The soil conditioner contains the bidirectional Burkholderia DY76 according to claim 1.