Prosteria megatherium and application thereof in prevention and treatment of plant diseases

Abstract

The invention belongs to the technical field of biopesticides. The invention discloses a strain of prelisteria megatherium and application thereof in prevention and treatment of plant diseases. The preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.32618 A plate bacteriostasis assay shows that the Princisteria megaterium TSA-8e has a very strong bacteriostasis effect on various pathogenic bacteria, and a bioassay experiment verifies that the Princisteria megaterium TSA-8e is particularly suitable for preventing and treating root rot and rice blast, so that the Princisteria megaterium TSA-8e has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biological pesticide technology, and relates to a biocontrol bacterium for preventing and controlling plant diseases and its application. More specifically, it relates to a biocontrol bacterium Priesteria gigantea (P. gigantea) that antagonizes multiple important plant diseases. Priestia megatherium ) and its application in preventing and controlling root rot and rice blast. Background Art

[0002] Cowpea root rot and rice blast are important fungal diseases that cause significant losses to cowpea or rice production worldwide each year. Cowpea root rot manifests as leaf wilting, root necrosis, and vascular discoloration, ultimately leading to plant death (Long J, Wu W, Sun, S et al. . Berkeleyomyces rouxiae is a causal agent of root rot complex onfaba bean ( Vetches beans L.). Frontiers in plant science 2022; 13: 989517). Pathogens associated with cowpea root rot include Fusarium spp. et al (Kashyap AS, Manzar N, Ahamad F and others .2022 First report of root rot disease in green gram ( Radiant vine ) caused by Ectophoma multirostrata in India. Plant disease ; 106(8): 2013–2025). Magnaporthe rice Caused by severe damage to rice and many other cereal crops, the annual food loss is enough to feed 60 million people (Chen Y, Le X, Sun Y et al. .Moycp4 is required for growth,conidiogenesis, and pathogenicity in rice magnaportha . Molecular PlantPathology 2016; 18(7):1001-1011). Fusarium spp. and M. oryzaeConidia play a central role in the disease cycle. Conidia can be spread by wind, rain, or human activity. When attached to the host surface, the conidia germinate and begin to infect the host (Mendgen, K., Hahn, M. Plant infection and the establishment of fungal biotrophy. Trends in Plant Science 2002; 7(8): 352-6).

[0003] Traditionally, chemical fungicides have been used to control Fusarium spp. and M. oryzae This has led to the development of antibiotic resistance and environmental toxicity in pathogens, thus requiring sustainable alternatives such as biocides (BCAs) (Lamini S, Kusi F, Cornelius E and others . Identification of sources of resistance in cowpea lines to Macrophomina root rot disease in northern Ghana. Heliyon 2022; 8(12):e12217). For example, Bacillus amyloliquefaciens JK6 can inhibit Ralstonia solanacearum (XiongHQ, Li YT, Cai YF et al. . Isolation of Bacillus amyloliquefaciens JK6 and identification of its lipopeptides surfactin for suppressing tomato bacterial wilt. RSC Advances(100) 2015; 5: 82042–82049). Recently, microbial biocontrol agents (e.g., Bacillus spp., Mucor spp.) have shown promise in inhibiting root rot pathogens, including Fusarium spp. (Olowe OM, Nicola L, Asemoloye MD and others . Trichoderma: potential bio-resource for the management of tomatoroot rot diseases in Africa. Microbiological research 2022; 257: 126978). Therefore, it is feasible to use BCAs for biological control of cowpea root rot.

[0004] Notably, inhibition of conidia germination, a key stage in the fungal pathogenicity process, has become an important biocontrol strategy. For example, lipopeptides from Bacillus subtilis ZD01 significantly inhibited the germination of conidia by disrupting the integrity of the spores. Alternaria solani Conidia germination (Zhang D, Qiang R, Zhou Z and others .Biocontrol and action mechanism of Bacillus subtilis lipopeptides' fengycinsagainst Alternaria solani in potato as assessed by a transcriptome Analysis. Frontiers in microbiology 2022; 13: 861113), highlighting the potential of microbial metabolites to target pathogens in the early stages of infection. Summary of the Invention

[0005] The present invention provides a biocontrol bacterium with antibacterial effect, which is classified and named as Priesteria gigantea ( Priestia megatherium ), deposited in the General Microbiology Center of China Culture Collection Administration Committee of Microorganisms, deposit date: November 14, 2024, the deposited strain name is Priesteria Priestia megatherium TSA-8e, the deposit number is CGMCC No.32618, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The present invention further provides a biocontrol agent containing the biocontrol bacteria.

[0007] Specifically, the antibacterial effect is directed against important crop pathogens. Preferably, the plant pathogens are cowpea root rot, rice blast, pepper anthracnose, corn leaf blight, and pepper root rot.

[0008] Preferably, the biocontrol agent comprises the fermentation broth of the biocontrol bacteria, and preferably, the concentration of the fermentation broth is 0.5×10 9 cfu / mL-1×10 10 cfu / mL.

[0009] The present invention provides application of the biocontrol bacteria in preventing and controlling crop diseases.

[0010] Specifically, the crop disease is cowpea root rot and / or rice blast.

[0011] The invention provides a method for preventing and controlling cowpea root rot, which comprises irrigating the root of plants such as cowpea with the biocontrol agent.

[0012] Specifically, the biocontrol agent is irrigated on the cowpea roots. Preferably, the biocontrol agent is used at a concentration of 0.5×10 8 cfu / mL-1×10 9 cfu / mL.

[0013] The present invention provides a method for preventing and controlling rice blast, wherein the biocontrol agent is sprayed onto rice. Preferably, the biocontrol agent is used at a concentration of 0.5×10 8 cfu / mL-1×10 9 cfu / mL.

[0014] The present invention discloses a strain for preventing and controlling crop diseases. According to plate inhibition assays, pathogen spore germination inhibition assays, and greenhouse tests, Priesteria gigantea TSA-8e has a strong antibacterial effect against a variety of pathogens. The strain is particularly suitable for preventing and controlling important crop diseases such as cowpea root rot and rice blast, and has good application prospects.

[0015] The biocontrol bacteria of the present invention are classified and named as Priesteria gigantea ( Priestia megatherium ), deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms (CGMCC), the strain name is Priesteria Priestia megatherium TSA-8e, the deposit number is CGMCC No.32618, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Antagonistic effect of Priesteria gigantea TSA-8e against cowpea root rot pathogen.

[0017] Figure 2 Prioccludin TSA-8e inhibition F. oxysporum Conidia germinate. DETAILED DESCRIPTION

[0018] The present invention is further illustrated below with reference to the following examples, but is not intended to limit the present invention.

[0019] Example 1. Acquisition, Identification, and Physicochemical Properties of Prioccludinium giganteum TSA-8e 1. Screening method for Priococcus megaterium TSA-8e Rhizosphere soil samples (2 g) were collected from healthy cowpea plants in a field affected by root rot in Haikou, China. Microbial isolation was performed using a serial dilution method on six different media: LB, 0.1× LB, KB, YG, R2A, and TSA. Samples were vortexed (200 rpm, 28°C, 40 minutes) in 18 ml of sterile saline and then diluted to 10 -4 -10 -7, prepare soil suspension. -5 -10 -7 Spread an equal amount (0.1 mL) of the dilution onto a 9 cm solid plate of each culture medium and incubate at 28°C. Screen for colonies with unique morphology and streak them to increase purity.

[0020] 2. Molecular identification of Priococcus megaterium TSA-8e For molecular identification, total genomic DNA of candidate strains was extracted using the CTAB method. Molecular identification of bacteria was based on 16S rRNA gene sequencing. The 16S rRNA amplification primer sequences are as follows: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) 1378R: CGGTGTACAAGGCCCGGGAACG (SEQ ID NO: 2).

[0021] Thermal cycling conditions included an initial denaturation at 95°C for 5 minutes, 33 cycles of 95°C (1 minute), 56°C (1 minute), and 72°C (1 minute), and an extension at 72°C for 5 minutes. PCR products were sequenced and analyzed for sequence similarity with the GenBank database using BlastN to confirm their taxonomy.

[0022] 3. Acquisition of Prioccludinium giganteum TSA-8e A total of 90 rhizospheric microorganisms were isolated from six different culture media, and 29 strains were identified by 16S rRNA sequencing, of which 29 strains were isolated only from TSA and KB culture media. Priestia megatherium strains.

[0023] Physical and chemical characteristics of P. megaterium TSA-8e: When cultured on KB medium (per L: 20 g tryptone, 1.5 g KH2PO4, 1.5 g MgSO4, 10 g agar, pH=7.2-7.4), it appears as round, milky yellow colonies with a smooth and moist surface.

[0024] The sequence of the PCR product obtained by molecular identification is shown in SEQ ID NO: 3, and the sequence was compared with the Priestia megatherium strain KLK21 16Sribosomal RNA gene, partial sequence sequence similarity is 98.43%. Combined with the culture characteristics and microscopic characteristics, the candidate strain was identified as Priestia megatherium , numbered P. gigantea TSA-8e, and deposited as a biological material.

[0025] Example 2: Determination of the antagonistic activity of Priesteria gigantea TSA-8e against cowpea root rot pathogens 1. Determination of antagonistic activity against cowpea root rot pathogens The antagonistic activity of Priesterol TSA-8e against cowpea root rot pathogens was evaluated using a dual culture method. Mycelial plugs (8 mm in diameter) of the target pathogen were placed on 9 cm solid LB plates. TSA-8e was fermented in 5× YEG liquid medium (200 rpm, 30°C, 48 hours) at a bacterial concentration of 0.5 × 10 9 cfu / mL-1×10 10 cfu / mL. 40 µL of the fermentation broth was spotted onto four sterile filter paper discs (5 mm diameter). 5× YEG liquid medium was used as a control. The filter paper discs were placed 2 cm from the edge of the plate and spaced 90° apart. The plates were incubated at 28°C for 3–6 days, after which radial mycelial growth was measured. The inhibition rate was calculated using the formula: Inhibition rate (%) = (AB) / A×100 Among them, A and B represent the mycelial growth of the control group and the treatment group, respectively.

[0026] 2. Results of antagonistic activity test against cowpea root rot pathogen The test results showed that Priesteria gigantea TSA-8e has antifungal activity against cowpea root rot pathogens. Fusarium oxysporum 、 Fusarium incarnate 、 Fusarium falcate The plate inhibition rates were 63.21±0.022, 55.16±0.001 and 50.93±0.029% ( Figure 1 The inhibition rate of TSA-8e against the three pathogenic Fusarium species was over 50%. F. oxysporum The inhibitory effect is the best.

[0027] Example 3: Determination of the inhibitory effect of Priesterol TSA-8e on spore germination of cowpea root rot pathogen 1. Determination of spore germination inhibition effect The sterile fermentation broth of Priesterol TSA-8e was prepared by centrifugation (8000 rpm, 10 min) and sterile filtration (0.22 μm). Cowpea root rot pathogens were obtained by culturing in 5×YEG liquid medium (28°C, 72 h). F. oxysporum and F. incarnatum The conidia were filtered through Miracloth membrane (CALBIOCHEM) and the concentration was adjusted to 5 × 10 4Conidia / mL. A conidial suspension treated with sterile fermentation broth (10% v / v final concentration) was incubated at 28°C for 5 hours. Count ≥ 50 conidia per replicate, and determine germination rate using a microscope.

[0028] 2. Results of the spore germination inhibition test Conidia germination is a key stage in the pathogenesis of Fusarium. To investigate the antifungal mechanism of TSA-8e, the effect of TSA-8e sterile fermentation broth on conidia germination of cowpea root rot pathogen was evaluated. F. oxysporum The germination rate of conidia was 69.9%, and after treatment with TSA-8e sterile fermentation broth, the germination rate was 34.4%. F. oxysporum The conidia germination rate decreased by 50.9% ( Figure 2 ). Similarly, in the control group, F. incarnatum The germination rate of conidia was 62.8%, while after treatment with TSA-8e sterile fermentation broth, the germination rate was 34.7%. These results indicate that TSA-8e sterile fermentation broth can inhibit the germination of conidia of cowpea root rot pathogens, thereby significantly disrupting the early infection process of Fusarium.

[0029] Example 4: Determination of the broad-spectrum antibacterial effect of Priococcus giganteus TSA-8e 1. Determination of broad-spectrum antibacterial effect The antifungal activity of Priococcus giganteus TSA-8e against eight important crop pathogens was tested. These pathogens include: Colletotrichum gloeosporioides (Pepper Anthracnose), Sclerotium rolfsii (Pepper Sclerotium rot), Fusarium solani (Pepper root rot), Magnaporthe rice (rice blast), Turkish sedge (corn leaf spot), Helminthosporium maydis (corn leaf spot), Sclerotinia sclerotiorum (Sclerotinia sclerotiorum) and Phytophthora capsicum (Pepper blight). Antagonistic activity was assessed using the filter paper disc assay (see Example 2 for the method), and inhibition rates were quantified as described above.

[0030] 2. Results of broad-spectrum antibacterial effect test Among the tested strains, P. giganteum TSA-8e had high inhibitory activity against a variety of pathogens (Table 1). C. gloeosporioides 、 M. oryzae 、 E. turcicum and F. solani The inhibition rates of M. oryzae The inhibition rate of TSA-8e reached 75.91%. S. rolfsii and P. capsiciThe inhibition rate of is slightly lower, but also higher than 40%. H. maydis and S. sclerotiorum These results suggest that P. giganteus TSA-8e may be a promising candidate biocontrol strain for controlling a variety of plant diseases.

[0031] Table 1 Inhibition rate of broad-spectrum antibacterial activity of Priococcus giganteus TSA-8e (%)

[0032] Example 5: Application of Prioctobacter giganteus TSA-8e in preventing and controlling cowpea root rot and rice blast 1. Test method When the cowpea grows to two leaves and one heart, the root inoculation method is used. F. oxysporum Conidia suspension was adjusted to a concentration of 1 × 10 7 Conidia / mL. Prepare TSA-8e fermentation broth (see Example 2 for preparation). Use a pipette to inoculate the stem base, with 1 mL of conidia suspension per plant. The control treatment received 0.9 mL of conidia suspension plus 0.1 mL of culture medium, while the TSA-8e treatment received 0.9 mL of conidia suspension plus 0.1 mL of TSA-8e fermentation broth. Observe and record disease progression on the 10th day after inoculation. Efficacy was evaluated according to the disease index grading standard (Table 2) and the following formula. Disease index = Σ (number of diseased plants at each level × disease level) / (total number of plants × highest disease level) × 100; control efficacy (%) = (control disease index - treatment group disease index) / control disease index × 100.

[0033] Table 2 Cowpea root rot grading standards

[0034] A pot experiment was conducted to determine the inhibitory effect of Priococcus giganteus TSA-8e against the rice blast pathogen. Rice plants were grown and inoculated at 14 days of growth. A spore suspension of fermentation broth was prepared, and mycelial blocks were transferred to Straw Decoction and Corn (SDC) agar medium. The suspension was incubated at 28°C in the dark for 7 days, followed by continuous illumination under black light for 2 days. The mycelium was rubbed with a sterile glass rod, and conidia were harvested in sterile distilled water at a spore concentration of 5 × 10 4 Spores / mL. Prepare TSA-8e fermentation broth (see Example 2 for preparation method). In the spray inoculation test, a 10% TSA-8e fermentation broth (using a concentration of 0.5×10 8 cfu / mL-1×10 9A 5 mL suspension of Magnaporthe grisea conidia containing 0.2% gelatin (100 cfu / mL) and 2% granules of 0.1% granules of 0.5% granules of 0.1% granules of 0.2% granules of 0.1 ...

[0035] 2. Test results The results of a potted experiment on preventing and controlling cowpea root rot showed that the disease index of the control group was 60.2, while that of the group treated with Priocallis gigantea TSA-8e was 28.1, indicating that TSA-8e had a 53.3% efficacy in preventing and controlling cowpea root rot. After inoculation with rice, the number of lesions in the group treated with Priocallis gigantea TSA-8e fermentation liquid was significantly lower than that in the control group, which had 118.80 lesions per 5 cm. 2 The number of lesions in the TSA-8e treatment was 55.8 per 5 cm 2 The control efficacy of TSA-8e against rice blast was 53.0%. Therefore, Priesterol TSA-8e has good application prospects in the prevention and control of cowpea root rot and rice blast.

Claims

1. A biocontrol bacterium with antibacterial effect, characterized in that: The biocontrol bacteria are classified and named as Priesteria gigantea ( Priestia megaterium ), the accession number is CGMCC No.32618.

2. Use of the biocontrol bacteria according to claim 1 in preventing and controlling plant diseases or in preparing medicaments for preventing and controlling plant diseases, characterized in that: The plant castration prevention and control is caused by pathogenic fungal diseases. Preferably, the pathogenic fungi are cowpea root rot fungi, rice blast fungi, pepper anthracnose fungi, corn leaf blight fungi, and pepper root rot fungi.

3. The use according to claim 2, characterized in that The plant disease is cowpea root rot or rice blast.

4. A biocontrol agent, characterized in that The biocontrol agent contains the biocontrol bacteria according to claim 1 as an active ingredient.

5. The biocontrol agent according to claim 4, wherein The concentration of the biocontrol bacteria solution is 0.5×10 9 cfu / mL-1×10 10 cfu / mL.

6. A method for preventing and treating root rot, characterized in that: The biocontrol agent according to claim 4 or 5 is irrigated into the roots of cowpea.

7. The method according to claim 6, wherein The concentration of biocontrol agent was 0.5×10 8 cfu / mL-1×10 9 cfu / mL.

8. A method for preventing and controlling rice blast fungus, characterized in that: The biocontrol agent according to claim 4 or 5 is sprayed onto rice.

9. The method according to claim 8, wherein The concentration of biocontrol agent was 0.5×10 8 cfu / mL-1×10 9 cfu / mL.

Images