Bacillus cereus and application thereof in preventing and treating plant diseases

CN120485052APending Publication Date: 2025-08-15HUNAN PLANT PROTECTION INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510642758.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-19
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

[0004]豇豆根腐病和辣椒炭疽病是重要的真菌病害,每年给全球豇豆或辣椒生产造成重大损失

Benefits of technology

[0014] The present invention discloses a strain for preventing and treating crop diseases. After plate inhibition determination, inhibiting spore germination of pathogenic bacteria and greenhouse tests, Bacillus cereus KB-6-1 has a strong antibacterial effect on a variety of pathogenic bacteria, and is particularly suitable for preventing and treating important crop diseases such as cowpea root rot and pepper anthrax, and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention belongs to the technical field of biopesticides. The invention discloses a bacillus cereus strain and an application of the bacillus cereus strain in prevention and treatment of plant diseases. The preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.32617, and the name of the preserved strain is Bacillus cereus KB-6-1. Through plate bacteriostasis determination, the bacillus cereus KB-6-1 has a very strong bacteriostasis effect on various pathogenic bacteria, is particularly suitable for preventing and treating root rot, pepper anthracnose and northern corn leaf blight, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biopesticide technology, and relates to a biocontrol bacterium for controlling plant diseases and its application. More specifically, it relates to a biocontrol bacterium, *Bacillus cereus*, which antagonizes multiple important plant diseases. Bacillus cereus ) and its application in the prevention and control of root rot and anthracnose. Background Art

[0002] Plant diseases are a key factor leading to crop yield reduction. According to the Food and Agriculture Organization of the United Nations (FAO), plant diseases cause 14% of global crop yield losses annually, with fungal diseases accounting for 42% (Roca-Couso, R., Flores-Felix, JD, Rivas, R. 2021 Mechanisms of action of microbial biocontrol agents against Botrytis cinerea Journal of Fungi, 7(12), 1045. Currently, agricultural production relies heavily on chemical fungicides to control fungal diseases. However, due to the potential harm these chemical fungicides may cause to the environment and human health, biocontrol agents are gradually becoming a more sustainable alternative for managing plant diseases in agricultural systems (Karthika, S., Varghese, S., Jisha, MS 2020 Exploring the efficacy of antagonistic rhizobacteria as native biocontrol agents against tomatoplant diseases. 3 Biotech, 10(7), 320). Therefore, developing microbial strategies with antifungal properties can be a feasible option for preventing fungal diseases before and after crop harvest (Panneerselvam, P., Senapati, A., Kumar, U., Sharma, L., Lepcha, P., Prabhukarthikeyan, SR et al. 2019 Antigonistic and plant-growth promoting novel Bacillus species from long-termorganic farming soils from Sikkim, India. 3 Biotech, 9(11), 416).

[0003] Among the various biocontrol strains reported, Bacillus spp. Bacillusspp. (e.g., Bacillus subtilis) B. subtle Bacillus amyloliquefaciens B. amyloliquefaciens and Bacillus velutipes B. velezensis These fungicides have been widely used as biofungicides, producing a variety of bioactive compounds with broad-spectrum activity against plant pathogens (Gautam, S., Chauhan, A., Sharma, R., Sehgal, R., Shirkot, CK 2019Potential of Bacillus amyloliquefaciens for biocontrol of bacterial canker oftomato incited by Clavibacter michiganensis *S. michiganensis*. *Microbial Pathogenesis*, 130, 196-203. However, further research is needed on the biocontrol mechanisms of *Bacillus*, screening for superior strains, transcriptomic and proteomic analysis, and industrial and commercial applications (Zhang, X., Li, X., Zhang, Y., Chen, Y., Tan, X., Su, P. et al. 2020 Integrated control of potato lateblight with a combination of the photosynthetic bacterium). Rhodopseudomonas marshy strain GJ-22 and fungicides. BioControl, 65, 635-645).

[0004] Cowpea root rot and pepper anthracnose are important fungal diseases that cause significant losses to cowpea and pepper production globally each year. Pathogens associated with cowpea root rot include... Fusarium spp. et al (Kashyap AS, Manzar N, Ahamad F and others . 2022First report of root rot disease in green gram ( Vineyard radiated caused by Ectophoma multirostrata in India. Plant disease ; 106(8):2013–2025). Anthracnose of pepper is caused by filamentous fungi. Colletotrichum gloeosporioides cause. Fusarium spp. and C. gloeosporioidesConidia play a central role in the disease cycle. Conidia can be spread by wind, rain, or human activity. When attached to the host surface, conidia germinate and begin to infect the host (Mendgen, K., Hahn, M. (2002) Plant infection and the establishment of fungal biotrophy. Trends in Plant Science, 7(8), 352-6). Currently, the control of these two diseases mainly relies on breeding and utilizing resistant varieties, supplemented by chemical fungicides. Therefore, exploring a practical alternative method, such as using microorganisms and biochemical agents to control these two diseases, is of great significance for ensuring food security. Summary of the Invention

[0005] This invention provides a biocontrol bacterium with insecticidal activity, the biocontrol bacterium being classified and named Bacillus cereus (Bacillus). Bacillus cereus The strain, deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 14, 2024, is named [Strain Name Missing]. Bacillus cereus KB-6-1, with accession number CGMCC No.32617, is located at No.3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] The present invention further provides a biocontrol agent containing the aforementioned biocontrol bacteria.

[0007] Specifically, the antibacterial effect targets important crop pathogens. Preferably, the plant pathogens are cowpea root rot fungus, pepper anthracnose fungus, and maize large leaf spot fungus.

[0008] Preferably, the biocontrol agent comprises the fermentation broth of the biocontrol bacteria, and more preferably, the concentration of the fermentation broth is 0.5 × 10⁻⁶. 9 cfu / mL -1×10 10 cfu / mL.

[0009] This invention provides the application of the aforementioned biocontrol bacteria in the prevention and control of crop diseases.

[0010] Specifically, the crop diseases are cowpea root rot and / or pepper anthracnose.

[0011] This invention provides a method for preventing and controlling crop diseases such as cowpea root rot and / or pepper anthracnose, which involves drenching the roots of plants such as cowpeas with the biocontrol agent.

[0012] Specifically, the biocontrol agent is applied to the roots of cowpeas via root irrigation. Preferably, the concentration of the biocontrol agent is 0.5 × 10⁻⁶. 8 cfu / mL -1×10 9 cfu / mL.

[0013] Specifically, the biocontrol agent is applied dropwise to the chili peppers. Preferably, the concentration of the biocontrol agent is 0.5 × 10⁻⁶. 8 cfu / mL -1×10 9 cfu / mL.

[0014] This invention discloses a strain for the prevention and control of crop diseases. Through plate inhibition assays, inhibition of pathogen spore germination assays, and greenhouse experiments, Bacillus cereus KB-6-1 has shown strong antibacterial effects against a variety of pathogens. It is particularly suitable for the prevention and control of important crop diseases such as cowpea root rot and pepper anthracnose, and has good application prospects. Attached Figure Description

[0015] Figure 1 Antagonistic effect of Bacillus cereus KB-6-1 against cowpea root rot pathogen.

[0016] Figure 2 Bacillus cereus KB-6-1 inhibition F. oxysporum Conidial germination. Detailed Implementation

[0017] The present invention will be further illustrated below with reference to embodiments, but these embodiments do not constitute a limitation thereof.

[0018] Example 1: Obtaining, identifying, and physicochemical properties of Bacillus cereus KB-6-1 1. Screening method for Bacillus cereus KB-6-1 Rhizosphere soil samples (2 g) were collected from healthy cowpea plants in a field infected with root rot in Haikou City, China. Microbial isolation was performed using a serial dilution method on six different culture media: LB, 0.1×LB, KB, YG, R2A, and TSA. Samples were vortexed in 18 mL of sterile physiological saline (200 rpm, 28°C, 40 min) and then diluted to 10⁻⁶. -4 -10 -7 Prepare soil suspension. 10 -5 -10 -7 Equal volumes (0.1 mL) of the diluent were spread onto 9 cm solid plates of each culture medium and incubated at 28°C. Colonies with unique morphology were screened and streaked to improve purity.

[0019] 2. Molecular identification method for Bacillus cereus KB-6-1 For molecular identification, total genomic DNA was extracted from candidate strains using the CTAB method. Bacterial molecular identification was based on 16S rRNA gene sequencing. The 16S rRNA amplification primer sequences are as follows: 27F: AGAGTTTGATCCTGGCTCAG(SEQ ID NO:1) 1378R: CGGTGTACAAGGCCCGGGAACG (SEQ ID NO: 2).

[0020] Thermal cycling conditions: initial denaturation at 95°C for 5 minutes; 33 cycles at 95°C (1 minute), 56°C (1 minute), and 72°C (1 minute); extension at 72°C for 5 minutes. PCR products were sequenced, and sequence similarity analysis was performed using BlastN and GenBank databases to determine classification.

[0021] 3. Obtaining Bacillus cereus KB-6-1 Ninety rhizosphere microorganisms were isolated from six different culture media. 16S rRNA sequencing identified 29 strains, of which only those isolated from KB medium (per L: 20 g tryptone, 1.5 g KH₂PO₄, 1.5 g MgSO₄, 10 g agar, pH 7.2–7.4) were obtained. Bacillus cereus strains.

[0022] Physicochemical characteristics of Bacillus cereus KB-6-1: When cultured on KB medium, the colonies are milky white with a rough surface and irregular edges.

[0023] The PCR product sequence was obtained as shown in SEQ ID NO: 3. Blast alignment analysis (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) showed that... Bacillus cereus The partial sequence similarity of strain K1M5's 16S ribosomal RNA gene was 99.03%. Based on both culture and microscopic characteristics, the candidate strain was identified as... Bacillus cereus The sample was numbered Bacillus cereus KB-6-1 and preserved as biological material.

[0024] Example 2: Determination of the antagonistic activity of Bacillus cereus KB-6-1 against cowpea root rot pathogen. 1. Method for determining antagonistic activity against cowpea root rot pathogen The antagonistic activity of Bacillus cereus KB-6-1 against *Bacillus cereus*, the causal agent of cowpea root rot, was evaluated using a double culture method. Hyphae (8 mm in diameter) of the target pathogen were placed on 9 cm LB agar plates. KB-6-1 was fermented in 5×YEG liquid medium (200 rpm, 30 °C, 48 h), and 40 µL of fermentation broth was spotted onto four sterile filter paper discs (5 mm in diameter). 5×YEG liquid medium served as a control. The filter paper discs were placed 2 cm from the edge of the plate at 90° intervals. The plates were incubated at 28 °C for 3–6 days, after which radial hyphal growth was measured. The inhibition rate was calculated using the following formula: Inhibition rate (%) = (AB) / A × 100 A and B represent the mycelial growth of the control group and the treatment group, respectively.

[0025] 2. Results of antagonistic activity assay against cowpea root rot pathogen The experimental results showed that Bacillus cereus KB-6-1 has antifungal activity against the root rot pathogen of cowpea. KB-6-1 has antifungal activity against... Fusarium incarnatum, Fusarium oxysporum , Fusarium falciforme The plate inhibition rates were 47.93±0.006, 42.39±0.015, and 28.56±0.021%, respectively. Figure 1 KB-6-1 F. incarnatum, F. oxysporum The inhibition rates all exceeded 40%, and for F. incarnatum The inhibitory effect is the best, for F.falciforme The inhibitory effect was not significant.

[0026] Example 3: Determination of the inhibitory effect of Bacillus cereus KB-6-1 on spore germination of cowpea root rot pathogen. 1. Method for determining the inhibitory effect on spore germination Aseptic fermentation broth of Bacillus cereus KB-6-1 was prepared by centrifugation (8000 rpm, 10 min) and aseptic filtration (0.22 μm). The broth was then cultured in 5×YEG liquid medium (28°C, 72 h) to obtain the cowpea root rot pathogen. Fusarium oxysporum and Fusarium incarnate The conidia were filtered through a Miracloth membrane (CALBIOCHEM) and the concentration was adjusted to 5 × 10⁻⁶. 4 1 conidia / mL. The conidial suspension treated with sterile fermentation broth (10% v / v final concentration) was incubated at 28°C for 5 hours. Each replicate was counted for ≥50 conidia, and the germination rate was determined by microscopy.

[0027] 2. Results of assay for inhibition of spore germination Conidia germination is a key stage in Fusarium pathogenicity. To investigate the antifungal mechanism of KB-6-1, the effect of KB-6-1 sterile fermentation broth on conidia germination of *Fusarium oxysporum* root rot was evaluated. In the control group, F. oxysporum The germination rate of conidia was 69.9%, while after treatment with KB-6-1 aseptic fermentation broth, the germination rate was 40.5%. The KB-6-1 aseptic fermentation broth... F. oxysporum The inhibition rate of conidial germination was 42.1% ( Figure 2 Similarly, in the control group, F. incarnatum The germination rate of conidia was 62.8%, while the germination rate after treatment with KB-6-1 aseptic fermentation broth was 37.6%. These results indicate that KB-6-1 aseptic fermentation broth can inhibit the germination of conidia of cowpea root rot fungus, thereby significantly disrupting the early infection process of Fusarium.

[0028] Example 4: Determination of the broad-spectrum antibacterial activity of Bacillus cereus KB-6-1 1. Method for determining broad-spectrum antibacterial activity The inhibitory effect of Bacillus cereus KB-6-1 on eight important crop pathogens was tested. These pathogens include: Colletotrichum gloeosporioides (Anthracnose in chili peppers) Sclerotium rolfsii (White mold disease of peppers) Fusarium solani (Pepper root rot) Magnaporthe rice (rice blast), Exerohyl Turkish (Maize leaf spot disease) Helminthosporium maydis (Small leaf spot disease in corn) Sclerotinia sclerotia (Sclerotinia sclerotinia) and Phytophthora capsicum (Pepper blight). Antagonistic activity was evaluated using the filter paper disc method (see Example 2 for the method), and the inhibition rate was quantified using the method described above.

[0029] 2. Results of broad-spectrum antibacterial activity assay Among the tested strains, Bacillus cereus KB-6-1 exhibited high inhibitory activity against a variety of pathogens (Table 1). Specifically, it showed high inhibitory activity against [various pathogens]. C. gloeosporioides and E. turcicum The inhibition rates were all above 50%, with inhibition rates of 55.90% and 64.17% against these two pathogens, respectively. KB-6-1... S. rolfsii and M. oryzae The inhibition rate was slightly lower, but still higher than 40%. For H. maydis , S. sclerotiorum and F. solani The inhibition rate was less than 30%, indicating insignificant inhibitory effect. These results suggest that Bacillus cereus KB-6-1 is a promising candidate biocontrol strain for controlling anthracnose in peppers and large leaf spot in maize.

[0030] Table 1. Broad-spectrum antibacterial rate of Bacillus cereus KB-6-1 (%)

[0031] Example 5: Application of Bacillus cereus KB-6-1 in the control of cowpea root rot and pepper anthracnose. 1. Test Methods When the cowpeas have grown to the stage of two leaves and one bud, root irrigation inoculation is used. Prepare according to the method in Example 3. F. oxysporum Conidial suspension, adjusted to a concentration of 1×10⁻⁶ 7 Conidia per mL. Prepare KB-6-1 fermentation broth (see Example 2 for preparation method). Inoculate the stem base with a pipette, using 1 mL of conidial suspension per plant. The control treatment consisted of 0.9 mL conidial suspension + 0.1 mL culture medium, and the KB-6-1 treatment consisted of 0.9 mL conidial suspension + 0.1 mL KB-6-1 fermentation broth. Observe and record disease incidence on day 10 after inoculation. Efficacy was evaluated according to the disease index grading standard (Table 2) and the following formula: Disease index = Σ(number of diseased plants at each level × disease level value) / (total number of plants × highest disease level value) × 100; Control effect (%) = (control disease index - treatment disease index) / control disease index × 100.

[0032] Table 2 Grading Standards for Cowpea Root Rot

[0033] Anthracnose infection experiments were conducted on pepper leaves. Peppers were planted at the five- to six-leaf stage for later use. A suspension of anthracnose spores was prepared by cutting mycelial blocks and adding them to complete culture medium (CM). The mixture was incubated at 28°C for 3 days. The conidial suspension was filtered through two layers of Miracloth (CALBIOCHEM) and resuspended in sterile distilled water to a concentration of 1 × 10⁻⁶ ppm. 4 Concentration of conidia. Preparation of TSA-8e fermentation broth (see Example 2 for preparation method). 20 μL of fermentation broth containing 10% KB-6-1 (concentration 0.5 × 10⁻⁶) was added. 8 cfu / mL -1×10 9 A conidial suspension (cfu / mL) was inoculated onto pepper leaves. The inoculated plants were cultured in the dark at 28°C and 90% humidity for 2-4 days.

[0034] 2. Test Results The results of a pot experiment on the control of cowpea root rot showed that the disease index of the control group was 63.2, the disease index of the Bacillus cereus KB-6-1 treatment group was 28.9, and the control effect of TSA-8e on cowpea root rot was 54.2%.

[0035] Pepper leaves inoculated with conidia of the pepper anthracnose fungus developed typical water-soaked lesions. The control treatment had a lesion area of ​​85.6 mm. 2 Conidia treated with Bacillus cereus KB-6-1 fermentation broth failed to cause similar disease symptoms, with lesion area of ​​22.7 mm. 2 The value was significantly smaller than that of the control.

[0036] Therefore, Bacillus cereus KB-6-1 shows promising application potential in the control of cowpea root rot and pepper anthracnose.

Claims

1. A strain of Bacillus cereus, characterized in that It is Bacillus cereus ( Bacillus cereus ), the accession number is CGMCC No.32617.

2. Use of the Bacillus cereus according to claim 1 in preventing and controlling plant diseases or in preparing a medicament for preventing and controlling plant diseases, characterized in that: The plant diseases to be controlled are pathogenic fungal diseases, and preferably, the pathogenic fungi are cowpea root rot pathogen, pepper anthracnose pathogen, and corn leaf blight pathogen.

3. The use according to claim 2, characterized in that The plant diseases are cowpea root rot and pepper anthracnose.

4. A biocontrol agent, characterized in that The biocontrol agent contains the Bacillus cereus according to claim 1 as an active ingredient.

5. The biocontrol agent according to claim 4, wherein It exists in the form of bacterial liquid.

6. The biocontrol agent according to claim 5, wherein The concentration of Bacillus cereus in the bacterial solution was 0.5×10 9 cfu / mL-1×10 10 cfu / mL.

7. A method for preventing and treating root rot, characterized in that: The biocontrol agent according to any one of claims 4 to 6 is irrigated into the roots of cowpea.

8. The method according to claim 6, wherein The concentration of biocontrol agent was 0.5×10 8 cfu / mL-1×10 9 cfu / mL.

9. A method for preventing and treating pepper anthracnose, characterized in that: The biocontrol agent according to any one of claims 4 to 6 is dripped onto pepper leaves.

10. The method according to claim 8, wherein The concentration of biocontrol agent was 0.5×10 8 cfu / mL-1×10 9 cfu / mL.