Nucleic acid aptamer targeting IGF-1R and application of nucleic acid aptamer

Abstract

The invention belongs to the field of molecular biology and clinical medicine, and relates to an IGF-1R targeting nucleic acid aptamer and application thereof. The nucleic acid aptamer of the targeted IGF-1R comprises a nucleotide as shown in SEQ ID NO. 2. The nucleic acid aptamer of the targeted IGF-1R comprises a nucleotide as shown in SEQ ID NO. The nucleic acid aptamer disclosed by the invention can be massively synthesized in vitro, and is low in price, good in stability, high in affinity, convenient to store and easy to edit; meanwhile, the molecular weight is small, immunoreaction is not easy to occur, and the single-stranded DNA is good in chemical stability, reversible in denaturation and renaturation and easy to store for a long time and transport at room temperature.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and clinical medicine, and relates to a nucleic acid aptamer sequence targeting IGF-1R and its application in preparing a medicine or preparation for diagnosing and treating thyroid-related eye diseases. Background Art

[0002] Thyroid-associated ophthalmopathy (TAO) is an organ-specific autoimmune disease characterized by infiltrative lesions of the retro-ocular and periorbital tissues. It often presents with exophthalmos, eyelid retraction, diplopia, etc. In severe cases, it can even endanger vision and lead to blindness. According to surveys, 30%-50% of GD patients develop obvious orbital lesions, which is one of the most common extrathyroidal manifestations of thyroid disease. In the early treatment of TAO, medication is often used to restore thyroid function. Although the patient's eye symptoms sometimes improve relatively as the drug effect continues, some patients' eye symptoms continue to develop after their thyroid function returns to normal, resulting in uncertainty in the treatment effect. Current treatments for thyroid-associated ophthalmopathy mainly include drug therapy, radiotherapy, and surgical treatment. Commonly used first-line drug treatments mainly include glucocorticoids, selenium supplementation, etc. However, due to the lack of clear therapeutic targets, traditional drug treatments usually have significant side effects.

[0003] IGF-1R is a heterotetrameric protein widely expressed on the surface of various cells, involved in regulating cell proliferation and metabolism. It is a tyrosine kinase receptor composed of two subunits: IGF-1Rα, which contains the ligand-binding domain, and IGF-1Rβ, which contains the tyrosine phosphorylation domain and is primarily involved in signal transduction. IGF-1R participates in signal transduction for a range of cellular responses, including the regulation of apoptosis. Multiple studies have confirmed that the IGF-1R receptor signaling pathway plays a role in the pathogenesis of autoimmune diseases. The pathogenesis of goiter-associated eye disease is complex and is currently believed to be primarily related to immune system dysfunction. Studies have shown that IGF-1R expression on the surface of orbital fibroblasts (OF) in patients with TAO is three times higher than in normal subjects, while the level of soluble IGF-1R in the serum of TAO patients is not significantly different from that in normal subjects, suggesting that localized orbital expression of IGF-1R may play a major role in the pathogenesis of TAO.

[0004] Aptamers, also known as chemical antibodies, possess precise targeting properties and are composed of single-stranded ribonucleotides or deoxyribonucleotides. Aptamers achieve specific recognition by binding to complementary spatial structures on their targets through self-folding structures such as stem-loops, bulges, hairpins, pseudoknots, or G-quadruplexes. Their targets can include proteins, peptides, nucleic acids, amino acids, cells, and even some metal ions. Aptamers are widely used in detection and targeted drug synthesis due to their advantages, such as large-scale in vitro synthesis, low cost, good stability, high affinity, ease of storage, and ease of editing. Furthermore, aptamers are small in molecular weight and are less susceptible to immune reactions. Single-stranded DNA exhibits excellent chemical stability, reversible denaturation and renaturation, and is easily stored for long periods and transported at room temperature, making them ideal targeting molecules. Due to their well-defined targets, screened aptamers can recognize the same target expressed in different cells and tissues, making them suitable for both target detection and targeted therapy. Currently, no specific aptamers for IGF-1R exist. Summary of the Invention

[0005] The purpose of the present invention is to provide a high-affinity IGF-1R-targeting nucleic acid aptamer and its application.

[0006] To achieve the above purpose, the technical solution of the present invention is as follows:

[0007] A nucleic acid aptamer targeting IGF-1R, comprising nucleotides as shown in SEQ ID NO.1 to SEQ ID NO.3; or derivatives of nucleic acid aptamers having the same function obtained by chemically modifying, chemically labeling, or changing the bases of SEQ ID NO.1 to SEQ ID NO.3;

[0008] SEQ ID NO.1:

[0009] CAGCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGATGCGATGGAGATGT;

[0010] SEQ ID NO.2:

[0011] CAGCACCGTCAACTGAATACCAGCTGTGCCACCGGGAGACTTGGAAGTCGTACGGGTAGTGATGCGATGGAGATGT;

[0012] SEQ ID NO.3:

[0013] CAGCACCGTCAACTGAATAGCCACACCGCCGGGAGAGACGCGTACGGGACAGTTTACAGTGATGCGATGGAGATGT.

[0014] Preferably, the chemical modification or base change includes one or more of phosphorylation, methylation, amination, carboxylation, sulfhydrylation or isotopization.

[0015] Preferably, the chemical labels include one or more of biotin, avidin, fluorescent groups, radioactive substances, digoxin, enzymes, antibodies, proteins, polypeptides, polymers, nanoluminescent materials or any other therapeutic substances.

[0016] Preferably, the nucleotide sequence of the nucleic acid aptamer has a homology of more than 60% with SEQ ID NO. 1 to SEQ ID NO. 16.

[0017] Preferably, the nucleotides include ribonucleotides and peptide nucleic acids.

[0018] Preferably, the nucleic acid aptamer derivatives having the same function obtained by chemical modification, chemical labeling or base change based on SEQ ID NO.1 to SEQ ID NO.3 include:

[0019] SEQ ID NO.4 (IGF-1R-Apt4-3):

[0020] ACCGCCGGGAGAGACGCGTACGGG;

[0021] SEQ ID NO.5 (IGF-1R-Apt1-1):

[0022] GCACCGTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCACGGTGA;

[0023] SEQ ID NO.6 (IGF-1R-Apt1-2):

[0024] GTCAACTGAATCTGCACGTTAGGATCCTTTCTTCGGCTGGTTCGCCAC;

[0025] SEQ ID NO.7 (IGF-1R-Apt1-3):

[0026] TCTGCACGTTAGGATCCTTTCTTCGGCTGG;

[0027] SEQ ID NO.8 (IGF-1R-Apt1-4):

[0028] TGCACGTTAGGATCCTTTCTTCGGCT.

[0029] The present invention also claims a kit for detecting IGF-1R, comprising the nucleic acid aptamer targeting IGF-1R.

[0030] The present invention also claims protection for a molecular probe comprising the IGF-1R-targeting nucleic acid aptamer.

[0031] The present invention also claims protection for the use of the IGF-1R-targeting nucleic acid aptamer in diagnostic reagents, molecular imaging probes or targeting media.

[0032] The present invention also claims the use of the IGF-1R-targeting nucleic acid aptamer in the design and preparation of preparations for detecting, diagnosing and treating diseases associated with IGF-1R.

[0033] Preferably, the IGF-1R-related disease includes Graves' disease, thyroid-associated eye disease or thyroid cancer.

[0034] The present invention uses a nucleic acid aptamer library and SELEX technology to screen nucleic acid aptamers. Then, 293T cells are infected with the lentiviral particle pLVX-puro-IGF-1R, and puromycin-resistant cells are selected using puromycin. The resulting cells are plated in 96-well plates using the limiting dilution method, and monoclonal cells are screened. The screened monoclonal cell line is confirmed to have an IGF-1R overexpression effect by Western blotting, and this cell line is named 293T-IGF-1R stable cell line. With this setup, positive and negative screening targets were screened. When the confluency of the 293T-IGF-1R stable transfectant reached 90%, the high-glucose complete medium was removed. After three rounds of PCR amplification, the cells were incubated on a NAP-5 nucleic acid purification column for screening. The aptamer concentration in the solution was measured using a microplate reader at 260 nm absorbance, completing the first round of screening. After each round of screening, the screening pressure was increased by reducing the amount of aptamer library, the amount of cells used for positive screening, and the time of positive screening, while increasing the amount of cells used for negative screening and the time of negative screening, and increasing the number, intensity, and duration of post-incubation washes. After all screening rounds were completed, the products from each round were incubated with 293T-IGF-1R stable transfectant cells and their affinity was measured to determine the final screening round. Since the affinity of the aptamers obtained after the 12th round of screening did not change significantly from the previous round, this round was designated as the final screening round. The aptamers from the final screening round were sent for high-throughput sequencing.

[0035] The beneficial effects of the present invention are:

[0036] The IGF-1R aptamers screened using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method can replace traditional drug treatments and diagnostic methods for the diagnosis, detection, and treatment of IGF-1R-related diseases. These aptamers have the following advantages:

[0037] (1) It can be synthesized in large quantities in vitro, is inexpensive, has good stability, high affinity, is easy to store, and is easy to edit. At the same time, due to its small molecular weight, it is not easy to cause an immune reaction, and single-stranded DNA has good chemical stability, reversible denaturation and renaturation, and is easy to store for a long time and transport at room temperature.

[0038] (2) Human orbital fibroblasts (OFs) were used to test the affinity of the optimized shortened aptamers, which ensured the stability of the aptamers to the greatest extent and laid the foundation for the development of detection methods and products;

[0039] (3) IGF-1R aptamers have good application prospects. Appropriate modification or labeling of the aptamers can be used for the rapid detection and diagnosis of diseases in which IGF-1R participates in the pathogenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The WB verification image (A) and protein quantification image (B) of 293T-IGF-1R stably transfected cell line;

[0041] Figure 2 is the ability of sequence Apt1 to bind to target cells;

[0042] Figure 3 is the ability of sequence Apt2 to bind to target cells;

[0043] Figure 4 is the ability of sequence Apt3 to bind to target cells;

[0044] Figure 5 is the ability of sequence Apt4 to bind to target cells;

[0045] Figure 6 is the secondary structure of aptamers Apt1, Apt2, and Apt4;

[0046] Figure 7 is the affinity between the aptamer and the target cell;

[0047] Figure 8 The ability of IGF-1R-Apt2-1, IGF-1R-Apt2-2, and IGF-1R-Apt2-3 to bind to target cells;

[0048] Figure 9 The ability of IGF-1R-Apt4-1 and IGF-1R-Apt4-2 to bind to target cells;

[0049] Figure 10 is the ability of IGF-1R-Apt4-3 to bind to target cells;

[0050] Figure 11 IGF1R aptamer was co-incubated with OFs cells;

[0051] Figure 12 This is the immunofluorescence FITC / DAPI / Cy5 staining of IGF1R aptamer;

[0052] Figure 13 The effect of IGF-1R aptamer on orbital fibroblast activation;

[0053] Figure 14 The effect of IGF-1R aptamer on adipogenic differentiation of orbital fibroblasts;

[0054] Figure 15 The effect of IGF-1R aptamer on the inflammation of orbital fibroblasts. DETAILED DESCRIPTION

[0055] The present invention will be further described in detail below with reference to the examples. However, these examples are intended to illustrate the present invention and are not intended to limit the scope of the invention. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents, methods, and equipment used are conventional reagents, methods, and equipment in the art unless otherwise specified.

[0056] Example 1

[0057] Construction of 293T-IGF-1R stably transfected cells

[0058] 293T cells were infected with lentiviral particles pLVX-puro-IGF-1R, and puromycin-resistant cells were selected using puromycin. The resulting cells were plated in 96-well plates using the limiting dilution method to screen for polyclonal cells. The screened polyclonal cell line was confirmed by Western blotting to have an IGF-1R overexpression effect, and the cell line was named 293T-IGF-1R stable transfection cell line ( Figure 1 Figure 2 shows Western blotting (WB) validation of the 293T-IGF-1R stably transfected cell line (A) and protein quantification (B). The specific process is as follows:

[0059] 1.1 Construction of IGF1R overexpression vector

[0060] 1.1.1 Primer design

[0061] The designed sequence is as follows:

[0062]

[0063] The restriction enzyme cutting sites selected in this experiment were XhoⅠ and EcoRI.

[0064] 1.1.2 Template DNA preparation

[0065] A. Total RNA extraction

[0066] (1) Sample lysis: 293T cell samples were placed in a 6-well plate, and 1 mL of Trizol was added per well. After pipetting at a constant speed, the cells were allowed to stand at room temperature for 5 min and then transferred to a new 1.5 mL Eppendorf tube.

[0067] (2) Add 200 μL of chloroform to each tube, shake the Eppendorf tube by hand for 15 seconds, let it stand at room temperature for 10 minutes, and centrifuge it at 4°C, 12,000 rpm for 15 minutes.

[0068] (3) The contents of the tube were separated into three layers. 600 μL of the upper layer was aspirated using a 1 mL pipette tip and transferred to a new 1.5 mL Eppendorf tube. An equal volume of pre-cooled isopropanol was added to the upper layer of water. After mixing, the tube was allowed to stand at 4°C for 10 min. The tube was then heated at 4°C at 12000°C.

[0069] Centrifuge at rpm for 10 min.

[0070] (4) A white precipitate appears in the tube, which is the total RNA required for the experiment. Use a 1 mL pipette tip to aspirate the supernatant.

[0071] (5) Add 1 mL of 75% ethanol to wash the precipitate, and centrifuge at 12,000 rpm for 5 min at 4°C.

[0072] (6) Use a 1 mL pipette tip to remove the supernatant and centrifuge at 12,000 rpm for 5 min at 4°C.

[0073] (7) Carefully remove the remaining water with a 20 μL pipette tip and dry at room temperature. When the RNA is almost transparent, add 20 μL RNase-free water until it is completely dissolved. Measure the concentration of the extracted RNA using a microplate reader.

[0074] B. Reverse transcription

[0075] (1) Add 1 μL of OLigo dT (60 μM), 1 μL of random primer (250 μM) and 2.0 μg of extracted RNA to a PCR tube, add RNase-free water to 9 μL, mix thoroughly, and centrifuge microcentrifuge to allow the liquid to accumulate at the bottom of the tube.

[0076] (2) Keep warm at 65℃ for 10 min, then cool on ice for 2 min.

[0077] (3) Take out a new RNase-free PCR tube and prepare the reaction mixture as follows:

[0078] Reagents volume 2×Reaction Mix 10 μL StarScriptⅡRT Mix 1 μL Total 11μL

[0079] (4) After mixing, add to step (1), mix briefly, centrifuge, and let stand at room temperature for 2 minutes.

[0080] (5) Incubate in a constant temperature water bath at 42°C for 30 min, then inactivate the enzyme at 85°C for 5 min to obtain cDNA.

[0081] The cDNA concentration was measured using a microplate reader and adjusted to 30 ng / μL.

[0082] 1.1.3 PCR amplification

[0083] ① Take a sterile 0.5mL EP tube and prepare the reaction solution (add in the order of most to least):

[0084] Table 1 PCR reaction system

[0085] substance Addition amount <![CDATA[H2O]]> 33.3μL <![CDATA[10×Buffer(Mg 2+ )]]> 10 μL dNTP (2.5 mM each) 4 μL Template (cDNA) 0.2μL Former primer (SEQ ID NO.9) 1 μL Reverse primer (SEQ ID NO.10) 1 μL DNA polymerase 0.5μL Total 50 μL

[0086] ② Set up the PCR reaction program as follows;

[0087]

[0088] After amplification, the amplified product is obtained.

[0089] ③Recover PCR products by DNA electrophoresis

[0090] A. Prepare 1% DNA agarose gel: Weigh 0.5 g of dry agarose powder into a conical flask. Add 50 mL of 1× TAE solution and microwave until completely dissolved. Add Super GelRed, shake well, and pour into a gel preparation tank. Insert a comb.

[0091] B. Load 50 μL of PCR product, use DL2000 Marker as a control, and perform electrophoresis at 110 V for 30 min.

[0092] C. Take out the gel block and place it in a gel imaging instrument to take a picture;

[0093] D. Take a sterile 1.5mL EP tube and perform gel excision and recovery of the target gene band (using the marker as a reference, the target band is above 3000bp and below 5000bp). The recovery steps refer to the OMEGA agarose gel DNA recovery kit.

[0094] User manual operation;

[0095] E. After elution with 30 μL of ddH2O, the concentration of the gel-recovered product was measured on a multi-functional microplate reader. The OD260 value on the microplate reader was 0.154, while the OD260 value of the blank well was 0.063, resulting in a concentration of 91 μg / mL. This gel-recovered product is the target gene.

[0096] 1.1.4 Enzyme digestion of linearized plasmid

[0097] A. Select the appropriate reaction solution based on the restriction endonuclease and prepare the enzyme digestion system:

[0098] Table 2 pLVX-puro vector enzyme digestion system

[0099] substance Addition amount pLVX-puro 2 μg <![CDATA[ddH2O]]> Up to 50μL 10×Buffer 5μL XhoⅠ 1 μL EcoRⅠ 1 μL Total 50 μL

[0100] The pLVX-puro vector was purchased from Hunan Ourui Biotechnology Co., Ltd.

[0101] B. Incubate in a 37°C water bath for 1 hour;

[0102] C. Recover the digested vector and fragments: Refer to the user manual of the Omega DNA Purification and Recovery Kit to obtain linearized plasmid.

[0103] 1.1.5 Connection

[0104] A. Prepare the ligation reaction system in a PCR tube as follows:

[0105] substance Addition amount Target gene fragment: linearized plasmid 3：1 2×Seamless Master Mix 5μL <![CDATA[ddH2O]]> Up to 10μL

[0106] B. Incubate the tube in a 50°C water bath for 15 minutes, then remove the centrifuge tube and place it on ice to obtain the ligation solution.

[0107] 1.1.6 Conversion

[0108] 1.1.6.1 Prepare the following solution

[0109] A.LB liquid ampicillin resistance medium: weigh 25g LB broth medium, dissolve in 1L distilled water, autoclave, cool to below 55℃ in a clean bench, add ampicillin resistance at a final concentration of 100μg / mL (do not expose to UV after addition) and shake well.

[0110] Dispense these resistance cultures into 25 mm × 150 mm test tubes, 10 mL per tube, and store at 4°C until use.

[0111] B. LB liquid antibiotic-free medium: weigh 25g LB broth medium, dissolve in 1L distilled water, autoclave, and place in a clean

[0112] Cool to room temperature on the workbench;

[0113] C. LB agar medium: Weigh 40 g of LB agar medium and dissolve it in 1 L of distilled water. After autoclaving, place it in a clean bench and cool it to about 50°C. Add ampicillin to a final concentration of 100 μg / mL (do not expose to UV light after addition), shake well, and pour it into a disposable 60 mm × 60 mm plate while it is still hot, covering the bottom with the medium. After solidification, turn the plate upside down and store it at -4°C to obtain the target plasmid.

[0114] 1.1.6.2 Transformation Experiment Steps

[0115] A. Use a sterile pipette tip to take 50 μL of competent cell suspension into a sterile microcentrifuge tube, and add 5 μL of the conjugate obtained in Section 1.1.5 to each tube.

[0116] Receive the solution, swirl gently to mix, and place on ice for 30 minutes;

[0117] B. Preheat water bath to 42°C and heat shock for 90 seconds.

[0118] C. Quickly transfer the tube to an ice bath and cool for 2 minutes;

[0119] D. Add 700 μL of antibiotic-free LB medium to each tube, then transfer the tube to a 37°C, 200 rpm shaker and allow to recover for 45 minutes.

[0120] E. Take 100 μL of revived competent cells and transfer them to LB agar medium containing Amp resistance;

[0121] F. Cover the plate and leave it at room temperature until the liquid is absorbed;

[0122] G. Invert the plate and incubate at 37°C for 16 hours;

[0123] H. Obtain samples for PCR identification of positive clones.

[0124] 1.1.6 PCR identification of positive clones

[0125] A. The colony PCR reaction system is as follows:

[0126] Reagents volume Forward Primer (SEQ ID NO. 9) 0.5uL Reverse Primer (SEQ ID NO.10) 0.5uL 2×PCR mix 10uL Colony PCR template Small amount <![CDATA[ddH2O]]> Up to 20uL

[0127] PCR reaction, according to the following cycling conditions:

[0128]

[0129] B. Colony PCR template: Pick up a single colony with a white pipette tip and transfer it to a PCR tube containing 6 μL of sterile deionized water. Take 2 μL as

[0130] The remaining 4 μL was used as a PCR template and injected into ampicillin-resistant LB liquid medium and incubated at 37°C, 200 rpm, overnight.

[0131] C. Agarose gel electrophoresis: ① Dissolve 0.25 g agarose (Spanish 111935) in 25 mL 1×TAE (50×TAE brand:

[0132] ② Use Sangon B548101-0500 (1×TAE: add distilled water to 50 mL for every 1 mL of 50×TAE) electrophoresis buffer in a conical flask and heat in a microwave until completely dissolved. ② Cool the dissolved liquid to approximately 50°C and add 2.5 μL of nucleic acid dye (Super GelRed, brand: Lianke S2001). After thorough shaking, pour the gel into the gel tank, insert the supplied comb, and let it stand until solidified. ③ Remove the comb and place the gel into the electrophoresis tank (voltage-stabilized electrophoresis instrument, brand: Tanon EPS-300).

[0133] ④ Mix 5 μL of the colony PCR product with 1 μL of DNA loading buffer and add it to the comb well of the gel. Add 2 μL of DNA marker (Full Gold BM121) to the comb well behind the sample. ⑤ Turn on the electrophoresis instrument and set the conditions to 110V for 30 minutes. ⑥ After the electrophoresis is completed, observe the size of the bands under UV light. D. Plasmid testing: Take a single colony that is positive for electrophoresis and shake it for incubation. Take 800 μL of the culture medium (bacteria solution and 80% sterilized glycerol according to 5:

[0134] 2), and the remaining bacterial solution was used to extract the plasmid using a kit (Tiangen Biochemical Technology, Cat. No. DP105) and sequenced to accurately detect whether it was a positive clone.

[0135] Compare the sequences. If positive, take the corresponding bacterial culture solution to streak, pick a single colony, shake the bacteria, and extract the plasmid for subsequent experiments. The operation method is the same as above.

[0136] 1.1.7 Sequencing and Identification

[0137] After shaking overnight, the bacterial suspension that was positive for PCR was used to extract the plasmid and sent it to Qingke Bio for sequencing and comparison. After the sequence was correct and no mutations were found, lentiviral packaging was carried out.

[0138] 1.2 Lentiviral packaging experiment

[0139] 1.2.1 Lentiviral packaging

[0140] Lentiviral packaging cell transfection 293FT cells in the logarithmic growth phase were trypsinized and reseeded in 10 cm cell culture dishes at a cell density of 5 × 108 and cultured overnight in a 37°C, 5% CO2 incubator;

[0141] Before lentiviral packaging, prepare a packaging plasmid mixture: pLP1 (5 μg) + pLP2 (4 μg) + pLP / VSVG (3 μg). pLP / VSVG is a helper plasmid from Hunan Ourui Biotechnology Co., Ltd. Use pLVX-puro as a negative control plasmid and pLVX-puro-IGF1R as an experimental plasmid, respectively, and proceed with viral packaging according to the following steps. The virus packaged with pLVX-puro is designated lv-NC; the virus packaged with pLVX-puro-IGF1R is designated lv-IGF1R.

[0142] When the cell density reaches 90% to 95%, transfection can be performed. Add the packaging plasmid mixture from the previous step and 9 μg of the target plasmid (pLVX-puro or pLVX-puro-IGF1R) to an EP tube a, mix well, then add Opi-MEM to make up to 1 mL. Incubate at room temperature for 5 minutes.

[0143] A. Add 950 μL Opti-MEM + 50 μL lip2000 to another new EP tube b, mix well and incubate at room temperature for 5 minutes;

[0144] B. Mix EP tubes a and b for 20 minutes, then transfer the mixture to the culture medium containing the monolayer of cells, mix thoroughly, and discard the culture medium containing the transfection mixture after 8 hours of incubation.

[0145] C. Add 8 mL of cell culture medium containing 10% fetal bovine serum to each dish of cells and continue culturing for 48 hours;

[0146] D. Collect the supernatant of 293T cells 72 hours after transfection;

[0147] E. Centrifuge the collected supernatant at 3500 g for 10 min at 4°C and collect the supernatant;

[0148] F. Filter the supernatant through a 0.45 μm filter;

[0149] G. Collect again after 60h (repeat GI);

[0150] H. Centrifuge in a 40 mL ultracentrifuge tube at 38,000 rpm for 2 h at 4°C to obtain the lentiviral packaging plasmid.

[0151] I. Then, respin the lentiviral packaging plasmid with PBS and dissolve the precipitate at 4°C overnight to obtain lv-NC and lv-IGF1R lentiviruses.

[0152] 1.2.2 Titer detection

[0153] A. 293FT cells (Hunan Ou Rui Biotechnology Co., Ltd.) were prepared into a cell suspension of 1 × 105 cells / mL and prepared for plating;

[0154] B. 500 μL per well of a 24-well plate, i.e. 5×10 4 cells / well;

[0155] C. With 10-fold gradient (1×10 -1 , 1×10 -2 , 1×10 -3 ) plus lentiviral packaging plasmid;

[0156] D. Add 2 μL of polybrene (10 mg / mL) stock solution to 18 μL of PBS and dilute 10-fold to a concentration of 1 mg / mL. Add 2.5 μL of diluted polybrene to each well to achieve a final concentration of 5 μg / mL in the cell sample.

[0157] E. Change the culture medium after 24 hours: discard the culture medium and add 500 μL of fresh culture medium to each well;

[0158] F. 48 h after infection, cells were digested with trypsin, and genomic DNA was extracted from the samples according to the DNA extraction kit (Biomed Biotechnology, DL107-01).

[0159] G. Design two pairs of qPCR primers for qPCR assays to measure the expression levels of the following factors in each sample. The primer information is as follows (ACTB is the internal reference, WPRE is the target gene):

[0160] Table 3 qPCR primers

[0161]

[0162] The reaction program on the qPCR instrument was set as 95°C for 30 s pre-denaturation, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s;

[0163] H. Calculate the Ct value of each sample according to the standard to obtain the titer of each virus group. The results show: lv-IGF1R

[0164] The titer is 3.28*10 9 ;lv-NC is 7.84*10 8 .

[0165] 1.3 Construction of polyclonal stable transfectants

[0166] 1.3.1 Cell recovery

[0167] A. Remove the 293T cell cryopreservation tube from the liquid nitrogen tank and quickly place it in a water bath filled with 37°C warm water. Shake continuously to thaw as quickly as possible. B. After disinfecting with 75% alcohol, move it to a biosafety cabinet, aspirate the cell suspension into a 6cm culture dish, and add 3mL of culture medium.

[0168] The medium was placed in an incubator (5% CO2, 37°C);

[0169] C. Replace the culture medium the next day and continue culturing.

[0170] 1.3.2 Cell passaging

[0171] A. Discard the old culture medium and add 2 mL of sterile PBS solution. Gently shake to wash the cell growth surface, then discard the PBS solution. B. Add 500 μL of trypsin digestion solution and digest for 1-2 minutes until the cells are completely digested.

[0172] C. Add 500 μL of culture medium to terminate digestion. Transfer the cell suspension to a 1.5 mL centrifuge tube and centrifuge at 1500 rpm for 3 minutes.

[0173] D. Aspirate the supernatant, resuspend the cells in 1 mL of culture medium, transfer 200 μL of the cell suspension to a new culture dish, add 4 mL of culture medium, and continue culturing in an incubator.

[0174] 1.3.3 Cell Count

[0175] A. Digest the cells in the logarithmic phase with trypsin (without EDTA), centrifuge at 1500 rpm for 3 min, remove the supernatant, and suspend in culture medium.

[0176] Float and make a cell suspension;

[0177] B. Wash and dry the hemocytometer, draw up 7.5 μL of cell suspension with a pipette, and slowly add the cell suspension along the side of the coverslip to count the cells.

[0178] 1.3.4 Cryopreservation of cell lines

[0179] A. Take cells in the logarithmic phase, digest them with trypsin, centrifuge at 1500 rpm for 3 minutes, remove the supernatant, and use freezing solution to make 1×

[0180] 10 6 ~1×10 7 / mL. Add 1mL of cell suspension to a 1.5mL cryovial and seal. Mark the outer tube with cell information. Place in a 4°C refrigerator for 1 hour, a -20°C refrigerator for 2 hours, and then transfer to liquid nitrogen for long-term storage.

[0181] B. After one week of cryopreservation, sample a sample of cells for resuscitation and culture. Observe the efficiency of cell recovery and assess the quality of the cryopreservation. Failed cryopreserved cells should be refreezed.

[0182] 1.3.5 Cell infection

[0183] A. Digest the cells in the logarithmic growth phase with 0.25% trypsin, centrifuge at 1500 rpm for 3 min at room temperature, discard the supernatant, and use 1 mL of culture medium.

[0184] Suspend cells to make a cell suspension;

[0185] B. Adjust the cell density and seed in 6-well plates (1.2×10 6 100 cells), add 2.5 mL of culture medium, and culture the cells in a CO2 incubator (37°C, 5% CO2, 95% relative humidity, pH 7.2-7.4). After the cells adhere, aspirate the culture medium and carefully add 1 mL of Opti-MEM medium. Add the amount of virus calculated by the following formula (virus volume = cell MOI × cell plate number / virus titer, MOI for 239T cells is 1). The virus should be either lv-NC or lv-IGF1R. Gently mix and culture at 37°C in a 5% CO2 incubator. Continue selection with puromycin 48 hours after infection and expand the culture.

[0186] C. When the cell number approaches the expected number, replace the culture medium with complete medium without puromycin and continue culturing for 48 hours;

[0187] D. Remove the culture plate, remove the culture medium, and add 100 μL complete culture medium and 5×10 3 cells per well of a 6-well plate

[0188] 2.5 mL of complete culture medium and 1.2 × 10 6 cells and continue to culture;

[0189] E. When the cell density is about 70%, remove the culture plate, remove the culture medium, add an appropriate amount of complete culture medium to each well according to the size of the culture plate, and culture in an incubator for 24 hours.

[0190] 293T cells (293T+lv-IGF1R).

[0191] F. Collect cells (①293T; ②293T+lv-NC; ③293T+lv-IGF1R) for downstream Western bolt experimental verification.

[0192] 1.4 Western blot verification

[0193] 1.4.1 Total cell protein extraction

[0194] A. Place the three groups of cell samples on ice and use a scraper to scrape the cells off the culture dish (Note: Repeat scraping to ensure that there are no residual cells on the culture dish).

[0195] cells);

[0196] B. Transfer the scraped cells to an EP tube and centrifuge at 4°C, 500g, for 5 minutes;

[0197] C. Aspirate the supernatant, wash once with 1 mL of PBS, and centrifuge at 500 g for 5 min at 4°C.

[0198] D. Discard PBS and add an appropriate amount of 2× SDS Lysis Buffer based on the number of cells;

[0199] E. After sufficient lysis, centrifuge at 12,000 rpm at 4°C for 5 minutes, collect the supernatant, and perform protein quantification.

[0200] 1.4.2 Protein quantification (BCA method)

[0201] A. Add 2-5 μL of sample to each well of the plate. Add 2, 4, 6, 8, 10, and 12 μL of standard (1 mg / mL BSA) to the plate at a time. Add 200 μL of BCA working solution (Biyuntian, P0010S) to each well and incubate at 37°C for 30 minutes to ensure the sample readings are correct.

[0202] Within the standard curve, the middle of the standard curve is the best. If it deviates from the standard curve range, it needs to be re-measured;

[0203] B. Cool to room temperature, measure A562 with a microplate reader, calculate the protein concentration according to the standard curve, and divide the protein samples of the same group according to the quantitative results.

[0204] Dilute the sample to the same concentration, add 4× Loading buffer and cook in boiling water for 3-5 minutes;

[0205] C. Invert the EP tube to mix the moisture on the tube cap with the lysate obtained in 1.4.1. Then centrifuge at 12,000 rpm at 4°C for 1 min and store at -20°C until use.

[0206] 1.4.3 Sample loading and electrophoresis

[0207] A. Rinse the glass plate and let it dry;

[0208] B. Place the dried glass plate into the tool as required;

[0209] C. Prepare stacking gel and separation gel of different concentrations according to the molecular weight of the target protein. The specific system is as follows:

[0210] Table 4 Concentration of different gel concentrations

[0211]

[0212]

[0213] Table 5 Concentrating gel system

[0214]

[0215] Selection of separation gel concentration: Determine the gel concentration based on the size of the target protein:

[0216] Table 6 Separation gels of different concentrations

[0217]

[0218] D. Prepare SDS-PAGE: Prepare separation gel first. Add 5 mL of separation gel to the glass plate, then add 1 mL of anhydrous ethanol. After 30 minutes, when the separation gel is fully solidified, discard the anhydrous ethanol in the glass plate, absorb the remaining anhydrous ethanol with filter paper, and add 1.5 mL of concentrated

[0219] Shrink the glue and then insert the comb teeth;

[0220] E. Sample loading: Wait for the gel to solidify, place it in the electrophoresis tank, add enough electrophoresis fluid and start loading the sample;

[0221] F. Electrophoresis: Stacking gel—constant voltage 60V, 30 minutes; Separating gel—constant voltage 120V, electrophoresis until the loading dye is approximately 5 cm from the bottom.

[0222] 1.4.4 Immunoblotting (wet transfer)

[0223] A. After electrophoresis, use a transfer electrophoresis device, ice bath, 350mA constant current conditions for 120min to transfer the protein to PVDF

[0224] On the membrane: Moisten the PVDF membrane with methanol and fully immerse it in transfer buffer. Pour 500-800mL of electrotransfer buffer (Shenggong B040131) into the medical tray. Take the glass plate out of the electrophoresis device and gently pry the two glass plates apart with a spatula. Gently cut off the bottom of the gel with a spatula and gently lift the gel and place it on the filter paper. The order of placement from negative to positive is as follows: filter paper

[0225] Paper - glue (-) - PVDF membrane (+) - filter paper, and then placed in the transfer electrophoresis device;

[0226] B. Add 1L of electrotransfer buffer and transfer the membrane at a constant current of 350mA for about 1-2 hours.

[0227] C. Immune response:

[0228] a. Blocking: Pour 40-50 mL of blocking solution (TBST solution containing 5% skim milk) into the culture dish, place the transferred PVDF membrane face up into the culture dish to prevent protein from falling off, and completely immerse the PVDF membrane in the blocking solution. Block at room temperature for 1-2 hours.

[0229] (Adjust the blocking time according to the room temperature).

[0230] b. Primary Antibody Incubation: Place the blocked PVDF membrane in a hybridization zone of appropriate size and add antibodies (IGF1R antibody (anti-IGF1R, Huamei Biotechnology, CSB-PA067618) and GAPDH antibody (anti-GAPDH, Affinity, AF7021)) diluted in 5% skim milk. Remove any bubbles and incubate overnight at 4°C.

[0231] c. Wash the membrane: Transfer the PVDF membrane to a culture dish, add 40-50 mL of TBST solution, and gently shake on a decolorizing shaker for 10 minutes. Repeat the wash three times.

[0232] d. Secondary antibody (Anti-rabbit IgG (H+L), brand CST, 14708) incubation: refer to the primary antibody dilution and incubation method, at room temperature

[0233] Incubate the PVDF membrane for 2 h;

[0234] e. Wash the membrane: Wash the membrane 3 times with TBST, 10 min each time;

[0235] D. Chemiluminescence, development, and fixing:

[0236] a. Mix solution A and solution B (ultrasensitive ECL chemiluminescence kit, brand New Saimei, P10100) in a 1:1 ratio to make a total

[0237] The volume is 1 mL of mixed solution;

[0238] b. Place the membrane in a chemiluminescence imaging system, add the pre-mixed AB mixture, and apply evenly;

[0239] c. Expose the image using the chemiluminescence imaging system for 30 / 60 seconds, observe the results, and save the image.

[0240] E. The results are as follows: 293T cells were infected with IGF1R and stably expressed IGF1R protein after puromycin selection, indicating that the polyclonal stable transfectant was successfully constructed.

[0241] Example 2

[0242] SELEX technology for screening nucleic acid aptamers

[0243] The sequence of the aptamer library used in the design and synthesis is CAGCACCGTCAACTGAAT(N40)GTGATGCGATGGAGATGT, where N40 represents a random nucleotide sequence of 40 A, T, C, or G. The number of this sequence is 10 10 -10 12 The screening method used is SELEX technology, and the specific steps are as follows:

[0244] 1.1. The 293T-IGF1R stably transfected cells from Example 1 were set as the positive screening target, and the 293T cells were set as the negative screening target. To minimize the loss of high-affinity aptamers during the initial screening process, only the positive screening target was included in the screening rounds 1-2, and the negative screening target was introduced starting from the third round. 1 OD of the initial library was dissolved in enzyme-free sterile water. The dissolved initial library was denatured at 95°C for 10 minutes and immediately placed on ice for 10 minutes.

[0245] 1.2. The cell confluence of the 293T-IGF1R stably transfected cells in Example 1 was observed under a microscope. After the cell confluence reached 90%, the high-glucose complete medium was removed and the cells were washed twice with 2 mL of PBS. 100 μL of binding buffer (4.5 g / L glucose, 5 nM MgCl2, 1 mg / mL BSA, and 1 mg / mL yeast tRNA dissolved in DPBS) was added and incubated with the nucleic acid aptamer library for 2 h. The incubation conditions were incubation on a 3D shaker at 4°C.

[0246] 1.3. After incubation, centrifuge at 2000 rpm for 3 minutes, remove the supernatant, and wash once with wash buffer (4.5 g / L glucose and 5 nM MgCl2 dissolved in DPBS). After centrifugation, resuspend in 100 μL of enzyme-free sterile water, denature at 95°C for 10 minutes, and immediately place on ice for 10 minutes. Collect the supernatant after centrifugation and designate it as Template 1.

[0247] 1.4. Take 100 μL of Template 1 for PCR amplification. Add 2×Mix buffer, FAM forward primer, and Biotin-backward primer to make a 200 μL system. Amplification conditions are 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, 10 cycles, and 72°C for 2 min. The amplification system is shown in the table below. The forward primer sequence is: 5'-CAGCACCGTCAACTGAAT-3' (SEQ ID NO. 15), and the back primer is 5'-ACATCTCCATCGCATCAC-3' (SEQ ID NO. 16). The product obtained after amplification is named Template 2. This amplification is named PCR1.

[0248] Table 7 PCR1 amplification system

[0249]

[0250] The amplified product was subjected to a secondary PCR amplification. A 60 μL amplification system was prepared using the product from the previous PCR amplification as the template. 1.1× Mix buffer, a FAM forward primer, and a Biotin-backward primer were added. The amplification system is shown in the table below. The forward primer sequence is: 5'-CAGCACCGTCAACTGAAT-3' (SEQ ID NO. 15), and the back primer is 5'-ACATCTCCATCGCATCAC-3' (SEQ ID NO. 16). This amplification was designated PCR2.

[0251] Table 8 PCR2 amplification system

[0252]

[0253]

[0254] Amplification conditions were 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, and 72°C for 2 min. The number of cycles was set to 10, 12, 14, 16, 18, and 20. After PCR amplification, the optimal number of cycles was determined by agarose gel electrophoresis. Template 2 was used for PCR amplification. 2000 μL of the amplification system was prepared, along with 1.1× Mix buffer, a FAM forward primer, and a Biotin-backward primer. The forward primer sequence was 5'-CAGCACCGTCAACTGAAT-3' (SEQ ID NO. 15), and the back primer was 5'-ACATCTCCATCGCATCAC-3' (SEQ ID NO. 16). Amplification conditions were 95°C for 5 min, 95°C for 30 s, 55.6°C for 30 s, 72°C for 20 s, and 72°C for 2 min. The number of cycles was set to the optimal number determined for PCR 2. The amplification system is shown in the table below. This PCR was designated PCR 3. The product obtained by PCR3 was recovered.

[0255] Table 9 PCR3 amplification system

[0256]

[0257] 1.5. Take 50 μL of streptavidin-agarose beads, wash them twice with PBS, and incubate them with the recovered PCR3 amplification product at a ratio of 50 μL / 1 mL for 1 hour. Centrifuge to remove the supernatant and recover the streptavidin-agarose beads.

[0258] 1.6. Take a NAP-5 nucleic acid purification column. To efficiently wash the streptavidin-agarose beads, first remove the salting-out column. Then, wash the column three times with 1 mL of PBS buffer. Resuspend the streptavidin-agarose beads in 1 mL of PBS buffer and transfer them to the NAP-5 nucleic acid purification column. Add 10 mL of PBS buffer to wash the beads.

[0259] 1.7. Turn off the switch at the bottom of the NAP-5 nucleic acid purification column, add 500 μL of 0.2 M NaOH solution, incubate for 5 minutes, and collect the incubated solution.

[0260] 1.8. Transfer the collected post-incubation solution to a new NAP-5 nucleic acid purification column. After the liquid in the column has naturally flowed out, add 1 mL of enzyme-free sterile water and collect the enzyme-free sterile water that naturally flows out of the column.

[0261] 1.9. Incubate the collected enzyme-free sterile water with 100 μL of sodium acetate and 2750 μL of anhydrous ethanol at -20°C for 30 minutes. Centrifuge at 15,000 rpm for 15 minutes. Remove the supernatant and air dry.

[0262] 1.10. Add 50 μL of enzyme-free sterile water to dissolve the dried precipitate and measure the concentration of the aptamer in the solution using a microplate reader at an absorbance of 260 nm.

[0263] 1.11. The above steps 1.2-1.10 are named as one round of screening. After each round of screening, the screening pressure is increased by reducing the amount of nucleic acid aptamer library, reducing the amount of positive screening cells and the time of positive screening, increasing the amount of negative screening cells and the time of negative screening, and increasing the number, intensity and time of post-incubation washing. See the table below for details:

[0264] Table 10 Screening process

[0265]

[0266]

[0267] 1.12. Screening was performed for a total of 12 rounds. After all screening rounds were completed, the products obtained from each round of screening were incubated with 293T-IGF-1R stable cells to test for increased affinity: equal amounts of 293T-IGF-1R stable cells were incubated with equal amounts of products from each round of screening for 30 minutes. After incubation, the cells were washed twice with wash buffer, centrifuged at 2000 rpm for 3 minutes, and the supernatant was removed. The cells were resuspended in 100 μL PBS and the affinity of the aptamers to the positive screening cells was measured by flow cytometry (operation as described above). This determined the screening endpoint round. The results showed that the affinity of the aptamers to the positive targets continued to increase with increasing screening rounds, and the increase and the number of rounds were both better than those of the negative control, indicating that aptamers with affinity for the positive targets were enriched. Since the affinity of the aptamers obtained after the 12th round of screening did not change significantly from the previous round, the 12th round of screening was determined as the endpoint screening round. During this process, changes in screening conditions during the first 11 rounds and inconsistencies in the amplified templates obtained after screening led to inconsistent sequencing results for each round. Furthermore, due to the long screening time, multiple experimental variables affected the results at different points in the screening process, resulting in a certain degree of randomness in the results of the entire SELEX screening process.

[0268] 1.13. The nucleic acid aptamers at the end of the screening round were sent for high-throughput sequencing. The following nucleic acid aptamers targeting IGF-1R were obtained:

[0269] Table 11 Nucleic acid aptamers targeting IGF-1R

[0270]

[0271] Example 3

[0272] Aptamer affinity detection (equilibrium dissociation constant determination)

[0273] 2.1, according to the high-throughput sequencing results, the number of nucleic acid aptamers was sorted, and the nucleic acid aptamers (Apt1-Apt4) in the synthesis table 11 were synthesized. Because the binding ability of nucleic acid aptamers depends on their complex spatial structure, and the complex spatial structure is closely related to the secondary structure of nucleic acid aptamers. Therefore, in this process, the secondary structure of nucleic acid aptamers also needs to be analyzed, and nucleic acid aptamers that can form complex secondary structures such as stem-loops are usually retained. Through a large amount of high-throughput sequencing and countless verification experiments, it is found that some secondary structures of aptamers are bound to the target molecule through hydrogen bonds, hydrophobic interactions, pseudobase pair stacking effects and shape matching, forming a complex with stronger affinity. However, the form is complex and the form of action is various, and its selection has greater difficulty. Therefore, the result of the selection needs to rely on years of experience and subjective judgment.

[0274] 2.2. Take the stably transfected cell lines, remove the culture medium and wash the cells with PBS buffer, and add 1 ml of trypsin to digest the cells. The collected cells were divided into 8 groups and incubated with 0, 50, 100, 150, 200, 250, 500, and 750 nM FAM fluorescent-labeled Apt1-Apt4 (synthetic nucleic acid aptamer with FAM fluorescent group) respectively. Add binding buffer to the incubation system to be 100 μL, mix the cells in the system, and incubate at 4 ° C in the dark for 30 minutes. After incubation, centrifuge at 2000 rpm for 3 minutes. After removing the supernatant, wash the cells once with 200 μL washing buffer, and then resuspend the cells with 150 μL PBS. Use flow cytometry to detect the fluorescence intensity of the cells in each group. Repeat the measurement of each group of cells and take the average value as the fluorescence intensity in each group. Use Y=Vmax*X / (Kd+X) to simulate the fluorescence intensity curve and calculate the size of the equilibrium dissociation constant (Kd). The results are as follows. Figure 2-Figure 5 As shown, sequences Apt1, Apt2, and Apt4 have strong binding abilities to target cells, with an equilibrium dissociation constant of 243.5±15.8nM for Apt1, 470.6±89.2 for Apt2, and 221.0±31.0 for Apt4. Sequence Apt3 has weak binding ability to target cells, with an equilibrium dissociation constant of 6632.3±4332.7. The results show that Apt4 has the best effect, followed by Apt1, Apt2 has an average effect, and Apt3 has a very poor effect, ultimately eliminating Apt3.

[0275] Example 4

[0276] Aptamer truncation optimization

[0277] Cell line source: Human OFs primary cells, isolated in the laboratory.

[0278] Aptamer truncation: The IGF-1R aptamers Apt1, Apt2, and Apt4 obtained by the previous screening were simulated using NUPACK software for secondary structure simulation, such as Figure 6 The optimized truncation sites were found, and the optimized truncation sequences were designed according to the optimized truncation sites, and were named as follows: IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, IGF-1R-Apt1-4, IGF-1R-Apt2-1, IGF-1R-Apt2-2, IGF-1R-Apt2-3, IGF-1R-Apt4-1, IGF-1R-Apt4-2, IGF-1R-Apt4-3 (see Table 12).

[0279] Affinity verification of truncated aptamers: To verify the affinity of the truncated aptamers with the target cells (human OFs), the synthesized IGF-1R-Apt1-1~4 truncated aptamers were incubated with OFs cells respectively, and the equilibrium dissociation constant of the aptamers was measured to measure the affinity of the optimized truncated aptamers with the target cells. The results are as follows: Figure 7 As shown, IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, and IGF-1R-Apt1-4 all have good affinity with target cells.

[0280] And as Figure 8 As shown, IGF-1R-Apt2-1, IGF-1R-Apt2-2, and IGF-1R-Apt2-3 all had weak ability to bind to target cells.

[0281] like Figure 9 As shown, the binding ability of IGF-1R-Apt4-1 and IGF-1R-Apt4-2 to target cells was also weak.

[0282] like Figure 10 As shown, IGF-1R-Apt4-3 has the strongest binding ability to target cells.

[0283] Table 12: Shortened optimized IGF-1R aptamers

[0284]

[0285] Example 5

[0286] Aptamer-specific binding assay

[0287] Take 1 dish of human OFs primary cells, remove the culture medium and wash the cells with 2m PBS buffer, add 1ml of trypsin to digest the cells. The collected cells were divided into experimental group and control group (cells were incubated with binding buffer). In order to verify the specific binding of the aptamer to the target cells (human OFs). The five aptamers with good affinity were incubated with OFs cells respectively. The results showed that IGF-1R-Apt4-3, IGF-1R-Apt1-1, IGF-1R-Apt1-2, IGF-1R-Apt1-3, and IGF-1R-Apt1-4 had binding specificity (such as Figure 11-12 As shown, due to space limitations, Figure 11-12 Only the results of IGF-1R-Apt4-3 are provided; the other results are similar.) This demonstrates that the nucleic acid aptamer of the present invention has great application value in the differential diagnosis of human OFs and in the development of targeted drugs.

[0288] Example 6

[0289] Establish the relationship between IGF-1R expression and clinical manifestations in patients with thyroid-associated eye disease

[0290] Primary orbital fibroblasts were isolated from orbital fat samples collected from patients with moderate to severe quiescent thyroid-associated eye disease. The primary cell extraction process was as follows:

[0291] Under sterile conditions, orbital connective tissue and extraocular muscles were obtained from patients with moderate to severe quiescent thyroid-related eye disease. After removing fat tissue and larger blood vessels, the tissue blocks were rinsed three times with D-PBS buffer and cut into 1 mm pieces with ophthalmic scissors. 3 Use a pipette to evenly distribute the cut pieces to the bottom of the flask at 5 mm intervals. Place the pieces in a 37°C, 5% CO2 incubator and let them rest for 6 hours. After 6 hours, when the pieces are slightly dry and cling to the bottom of the flask, digest and passage them with 0.25% trypsin and 0.02% EDTA. After passage, continue culturing in RPMII-640 medium supplemented with 10% calf serum.

[0292] The above-mentioned cultured orbital fibroblasts (OFs) were treated with TGF-β1 and then given IGF-1R aptamer (Apt-IGF-1R) to observe the effect of IGF-1R aptamer on OFs fibroblast activation. The results showed that compared with the thyroid eye disease cell model (OFs group) and the IGF-1R aptamer control group (OFs+Apt-control group), IGF-1R aptamer could significantly inhibit OFs fibroblast activation ( Figure 13); OFs were induced to form adipocytes in adipogenic differentiation medium, and IGF-1R aptamers were given during the induction process to detect the effects of IGF-1R aptamers on OFs adipogenic differentiation and inflammation. The results showed that compared with the thyroid eye disease cell model (OFs group) and the IGF-1R aptamer control group (OFs+Apt-control group), IGF-1R aptamers could significantly inhibit OFs adipogenic differentiation and the expression of related inflammatory factors IL17A and IL23A ( Figure 14 and Figure 15 ).

[0293] It can be seen from the above examples that the nucleic acid aptamer targeting IGF-1R provided by the present invention has high affinity and specificity. The IGF-1R nucleic acid aptamer can be used to detect orbital fibroblast activation and adipogenic differentiation and inflammatory indicators to assess the severity of the patient's disease, providing auxiliary quantitative indicators for the formulation of patient treatment strategies and prognosis evaluation.

[0294] It should be noted that when numerical ranges are mentioned in the present invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints may be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes preferred embodiments. Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they understand the basic inventive concepts. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0295] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A nucleic acid aptamer targeting IGF-1R, characterized in that: comprising the nucleotide sequence shown in SEQ ID NO.2; SEQ ID NO.2: CAGCACCGTCAACTGAATACCAGCTGTGCCACCGGGAGACTTGGAAGTCGTACGGGTAGTGATGCGATGGAGATGT.

2. A kit for detecting IGF-1R, characterized in that: The method comprises the IGF-1R-targeting nucleic acid aptamer according to claim 1.

3. A molecular probe, characterized in that The method comprises the IGF-1R-targeting nucleic acid aptamer according to claim 1.

4. Use of the IGF-1R-targeting nucleic acid aptamer according to claim 1 in the preparation of a diagnostic reagent, a molecular imaging probe or a targeting medium.

5. Use of the IGF-1R-targeting nucleic acid aptamer according to claim 1 in preparing a preparation for detecting or diagnosing diseases associated with IGF-1R.

6. The use according to claim 5, characterized in that IGF-1R-associated diseases include Graves' disease, thyroid-associated eye disease, or thyroid cancer.

Images