Brown planthopper salivary protein gene for inducing plants to generate resistance and volatile matters and application of brown planthopper salivary protein gene

By overexpressing the salivary protein gene NlG8 of brown planthopper in rice, activate plant defense response and induce volatile release, the problem of insufficient foreign gene resources for brown planthoppers is solved, and the efficient resistance and natural enemy attraction of rice is achieved.

CN120485196APending Publication Date: 2025-08-15NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510633609.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the prior art, crops have limited exogenous gene resources for sucking mouthpieces such as brown planthoppers, and the role of insect saliva proteins in inducing plant defense responses and volatile release has not been fully studied, resulting in limited improvement in insect resistance.

Method used

The brown planthopper salivary protein gene NlG8 was identified and overexpressed. By constructing recombinant expression vectors and host bacteria in rice, the NlG8 gene was overexpressed in rice, activate plant defense responses and induce volatile release, and attract natural enemy insects.

Benefits of technology

It significantly improves the insect resistance of rice to brown planthoppers, reduces the weight gain and egg laying volume of pests, and increases the attraction to natural enemy insects, providing new insect-resistant biological resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485196A_ABST
    Figure CN120485196A_ABST
Patent Text Reader

Abstract

The invention discloses a nilaparvata lugens salivary protein gene for inducing plants to generate resistance and volatile matters and application thereof, the nilaparvata lugens salivary protein gene is NlG8, and the nucleotide sequence of the nilaparvata lugens salivary protein gene is shown as SEQ ID NO.1. According to the invention, a salivary protein gene NlG8 from Nilaparva lugens is identified, and overexpression of the gene in rice can activate plant defense reaction, induce release of plant volatile matters and attract natural enemy insects, so that the insect resistance of plants is increased through two aspects of direct defense and indirect defense. The insect saliva protein NlG8 identified in the invention has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a brown planthopper salivary protein gene for inducing plants to produce resistance and volatiles and an application thereof. Background Art

[0002] In nature, plants can respond to mechanical damage, herbivore feeding, or pathogen infection by releasing volatiles. Plants often release a large amount of volatile compounds after being fed by insects, which are called herbivore-induced plant volatiles (HIPVs).

[0003] HIPVs primarily include green leaf volatiles, terpenes, and phenylpropanoids. HIPVs provide important clues for carnivores to locate herbivorous insects. Previous studies have found that plant volatiles such as methyl salicylate, leaf alcohol, and nonanal can attract natural enemies of various pests, including the Pardosa pseudo-annulata, the water wolf spider, the stem borer wasp, the black-shouldered green stink bug, the rice leaf wasp, the middle red side wasp, and the small flower stink bug.

[0004] Vg in the saliva of the brown planthopper (Brassica lugens) can induce the release of rice volatiles, thereby attracting its natural enemy, the egg parasitoid wasp. Using traditional genetic methods to screen for resistance from diverse germplasm resources and identify insect-resistant genes is key to breeding insect-resistant varieties, but this process is often time-consuming and costly. In addition to utilizing the plant's own insect-resistant genes, insect resistance can also be achieved by introducing exogenous genes into plants. Exogenous genes are genes that are not native to the plant, such as Bacillus thuringiensis (Bt) insecticidal protein genes (such as Cry), protease inhibitor genes (such as CpTI), and lectin genes (such as GNA). However, currently, most exogenous gene resources for insect resistance are focused on lepidopteran pests, and exogenous gene resources for piercing-sucking pests such as the brown planthopper are very limited.

[0005] Insect feeding can trigger plant defense responses and induce the production of plant volatiles, but the role of single salivary proteins in this process remains largely unknown, limiting the discovery and utilization of exogenous genes. Summary of the Invention

[0006] Purpose of the invention: In response to the shortage of insect-resistant crop gene resources in the prior art, the present invention provides a brown planthopper salivary protein gene that induces plants to produce resistance and volatiles. The present invention identifies the salivary protein NlG8 from the brown planthopper (Nilaparvata lugens). Overexpressing this protein in rice produces transgenic plants that not only have increased resistance to insects but also can release plant volatiles to attract natural enemies of pests.

[0007] The present invention also provides the brown planthopper salivary protein N1G8 for inducing rice resistance, an overexpression vector, and transgenic rice OE-N1G8, and applications thereof.

[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a brown planthopper salivary protein gene for inducing plants to produce resistance and volatiles, characterized in that the gene is the brown planthopper salivary protein gene NlG8, and the nucleotide sequence of the brown planthopper salivary protein gene NlG8 is shown in SEQ ID NO.1.

[0009] The gene encoding the brown planthopper salivary protein N1G8 of the present invention has an amino acid sequence as shown in SEQ ID NO.2.

[0010] The invention relates to a recombinant expression vector of a brown planthopper salivary protein gene.

[0011] The method for constructing a recombinant expression vector of a brown planthopper salivary protein gene according to the present invention is characterized by comprising the following steps:

[0012] The gene NlG8 was connected to the plant overexpression vector pBWA(V)HU containing the UBI promoter to obtain a recombinant expression vector.

[0013] Furthermore, the present invention provides an expression cassette and a transgenic recombinant expression vector of the brown planthopper salivary protein gene.

[0014] The starting vector of the recombinant expression vector is the expression vector pBWA(V)HU.

[0015] Preferably, the recombinant expression vector pBWA(V)HU-3xflag-2-OE_NlG8 of the NlG8 gene is constructed.

[0016] The host bacteria containing the recombinant expression vector of the present invention uses Agrobacterium EHA105 as the starting strain.

[0017] The invention discloses an application of the brown planthopper salivary protein gene N1G8, the protein, the recombinant expression vector, or the host bacteria in inducing plants to produce resistance and volatiles.

[0018] Wherein, the plant is rice, the resistance includes increased resistance to brown planthoppers, and the volatiles are volatiles that attract natural enemies of brown planthoppers.

[0019] The insect resistance is to inhibit the weight gain of brown planthoppers and reduce the egg laying amount of brown planthoppers; the volatile substances include any one or more of methyl salicylate, leaf alcohol or n-nonanal.

[0020] Preferably, the invention is used for increasing insect resistance of rice by inducing the release of plant volatiles.

[0021] The insect resistance includes reducing the weight gain and egg laying of pests, and attracting natural enemies.

[0022] Among them, the brown planthopper saliva protein gene NlG8 is overexpressed in rice or transferred into an overexpression vector or host bacteria to induce rice to produce brown planthopper resistance and induce the release of rice volatiles to attract natural enemy insects of brown planthoppers.

[0023] The invention provides an application of the brown planthopper salivary protein gene N1G8, the protein, the recombinant expression vector, or the host bacteria in cultivating transgenic rice with high resistance to brown planthoppers.

[0024] The present invention can provide a transgenic rice resistant to brown planthoppers. The transgenic rice variety contains the brown planthopper salivary protein N1G8 and can be used as a biological resource for cultivating new insect-resistant and disease-resistant rice varieties.

[0025] The present invention screened and obtained a salivary protein gene from the brown planthopper (Nilaparvata lugens). By overexpressing this gene in wild-type rice, the weight gain and egg production of brown planthoppers feeding on this variety of rice were significantly reduced. Simultaneously, the transgenic rice also released plant volatiles to attract natural predators. Developing pest-resistant crop varieties is the most cost-effective method for pest control, effectively preventing and controlling pests while reducing pesticide use and lowering environmental pollution risks. The present invention discovered for the first time that the brown planthopper salivary protein N1G8 has the ability to induce plant resistance, expanding the molecular mechanism of plant-insect interaction and facilitating the application of this gene and protein in the development of insect-resistant transgenic plants.

[0026] The present invention relies on transgenic technology to directly explore the role of the brown planthopper potential salivary protein NlG8 in regulating rice defense response. Figure 2 The results showed that the transgenic rice OE-NlG8 (plants overexpressing the gene NlG8) had increased insect resistance, including decreased attractiveness to brown planthoppers, and reduced weight gain and egg production of brown planthoppers feeding on the rice. Figure 3 Results showed that the salivary protein NlG8 induced plant defense responses, including attracting the natural enemy of the brown planthopper, Lygus sinensis. Furthermore, transgenic rice OE-NlG8 also attracted Lygus sinensis by inducing the release of plant volatiles, such as methyl salicylate, leaf alcohol, and n-nonanal.

[0027] This study, published in the journal Nature Communications, identifies for the first time the brown planthopper (Nilaparvata lugens) salivary protein N1G8 as a plant-inducing resistance protein. This study clarifies the biological mechanism by which rice enhances insect resistance and facilitates the further application of this gene, protein, and transgenic rice (OE-N1G8) in insect-resistant transgenic plants. The study also identifies a salivary protein gene, N1G8, from the brown planthopper (Nilaparvata lugens). Overexpressing this gene in rice activates plant defense responses, induces the release of plant volatiles, and attracts natural enemies, thereby enhancing plant resistance to insects through both direct and indirect defenses. The insect salivary protein N1G8 identified in this study has broad application prospects.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0029] The present invention identifies a salivary protein gene NlG8 from the brown planthopper (Nilaparvata lugens) and proposes for the first time the use of the insect salivary protein gene NlG8 in inducing insect resistance in plants. Overexpressing the gene NlG8 in rice not only improves the insect resistance of rice but also significantly induces the release of plant volatiles and has an attractive effect on the predatory natural enemies of the brown planthopper.

[0030] The present invention has obtained OE-N1G8 transgenic rice, which has been shown to attract natural enemies. This invention not only improves the theoretical research on the interaction between brown planthopper salivary proteins and rice, but also provides a new biological resource for the cultivation of insect-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 To verify the NlG8 transgenic rice, ZH11 was used as a control.

[0032] Figure 2 The transgenic rice OE-NlG8 has increased resistance to brown planthoppers. A represents the feeding preference of brown planthoppers on ZH11 and OE-NlG8 rice varieties. B represents the weight gain of brown planthoppers on OE-NlG8. C represents the egg-laying phenotype of brown planthoppers on OE-NlG8.

[0033] Figure 3 The NlG8 protein can attract the Chinese pale-winged blind bug; A shows that the Chinese pale-winged blind bug has a tendency to move towards rice after feeding on brown planthoppers treated with dsGFP; B shows that the transgenic rice OE-NlG8 has a significant attraction effect on the Chinese pale-winged blind bug.

[0034] Figure 4 This is the detection profile of volatiles from transgenic overexpressing rice OE-NlG8.

[0035] Figure 5The attractant effect of methyl salicylate, leaf alcohol and nonanal on the natural enemy, the Chinese pale-winged stink bug. DETAILED DESCRIPTION

[0036] The present invention will be further described below with reference to the accompanying drawings and examples.

[0037] The raw materials and reagents used in the examples of the present invention are all commercially available, or commercially available raw materials of the same type can be used.

[0038] Example 1

[0039] 1. Experimental Insects

[0040] The brown planthopper (Nilaparvata lugens) was collected from rice paddies in Hangzhou, Zhejiang Province, and subcultured on Xiushui11 rice (provided by the China National Rice Research Institute) at a temperature of 27 ± 1°C, a humidity of 70% ± 10%, and a light intensity of 16 h:8 h. The Chinese pale-winged stink bug (Tytthus chinensis) was provided by Yangzhou University and reared on Xiushui11 rice under the same conditions. The rice seedlings were regularly supplemented with sufficient brown planthopper eggs laid within them for predation.

[0041] 2. Preparation of Rice Seedlings for Testing

[0042] Rice was sown in nutrient soil and grown in a greenhouse under a 16h:8h humidity system. Approximately 30 days later, the rice was used for selection experiments and volatile collection. In the transgenic rice experiments, the rice variety used was ZH11, while Xiushui11 was used for other related experiments.

[0043] 3. Extract RNA from brown planthopper (Nilaparvata lugens) and obtain cDNA of the target gene.

[0044] Thirty fifth-instar brown planthoppers (Nilaparvata lugens) were collected and total RNA was extracted using Trizol reagent according to Invitrogen's instructions. Genomic DNA was removed and reverse transcribed into cDNA using HiScript III qRT SuperMix for qPCR (with gDNA wiper) according to Novozymes' instructions. PCR amplification was performed using the corresponding upstream and downstream primers (primer sequences are shown in Table 1).

[0045] Table 1 Primer sequences

[0046] name sequence NlG8-F ATGATTCTGATCAATCTATTGCTCTTC NlG8-R TCACTCAAATTTGATATCAGAATGTCTC

[0047] The PCR reaction system was as follows: 12.5 μL 2×PhantaMaster Mix; 2 μL (10 μM) primers; 1 μL cDNA template; and sterile water to make up to 25 μL.

[0048] The reaction program was as follows: pre-denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 60 s; extension at 72°C for 10 min; and storage at 4°C.

[0049] The PCR amplification product was subjected to agarose gel electrophoresis, recovered, and sequenced to confirm its accuracy. The resulting sequence is the nucleotide sequence of the N1G8 gene. The nucleotide sequence of the N1G8 gene is shown in SEQ ID NO. 1. The amino acid sequence of the protein encoded by the N1G8 gene is shown in SEQ ID NO. 2.

[0050] Example 2

[0051] Construction of recombinant expression vector pBWA(V)HU-3xflag-2-OE-NlG8 and transgenic plants OE-NlG8

[0052] The gene amplification primers shown in Table 2 were used to amplify the fragment using the brown planthopper cDNA obtained in Example 1 as a template. The PCR amplification product was subjected to agarose gel electrophoresis and recovered.

[0053] Table 2 Primer sequences

[0054] name sequence D5441_0S1(+) GGTGTTACTTCTGTTGCAACatggattacaaagaccacgacggagac D5441_0S1(-) GAGGTGAATAtttatcatcatcatctttataatcaatgtcgtggtctttgt

[0055] The pBWA(V)HU empty vector plasmid was digested with BsaI and Eco31I, and the target fragment and the vector were ligated using the homologous recombinase (Cat. No. C112) from Novozymes.

[0056] The reaction system was as follows: 4 μL 5×CEⅡ Buffer; 2 μL ExnaseⅡ; 1 μL of the PCR product recovered above; 4 μL of the empty vector digested with the above enzymes; and sterile water to 10 μL. The reaction was performed at 37°C for 30 min. The ligation product was transformed into Escherichia coli DH5α, and transformants were screened on Kan-resistant medium. Positive clones were selected, and plasmids were extracted and identified by colony PCR. The identified positive clones were sequenced, and the NlG8 gene overexpression vector, pBWA(V)HU-3xflag-2-OE-NlG8, was obtained. The sequence is shown in SEQ ID NO. 3.

[0057] The constructed expression plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd., and transgenic plants were obtained using the rice variety ZH11 through Agrobacterium-mediated genetic transformation to prepare the transgenic rice OE-NlG8 overexpressing the NlG8 gene.

[0058] 4. Extract transgenic rice DNA to verify positive transgenic rice.

[0059] Rice leaves of rice varieties ZH11 or OE-NlG8 were ground into powder and DNA was extracted and purified using UE MultisourceGenomic DNA Minprep Kit (Uyi Landi Biotechnology Co., Ltd.). The DNA was used as a template for PCR verification of positive plants. The primers used for PCR are shown in Table 2. Figure 1 The PCR results showed that the target band was amplified in OE-NlG8 rice, proving that the transgenic rice OE-NlG8 with overexpression of NlG8 gene was successfully constructed.

[0060] Table 2 Primer sequences

[0061]

[0062]

[0063] Example 3

[0064] dsRNA synthesis and microinjection

[0065] The nucleotide sequence of the NlG8 gene was obtained according to Example 1, and the dsRNA region was predicted and designed. The T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of the upstream and downstream specific primers of the selected fragment to serve as primers for synthesizing the dsRNA template. A pair of interfering primers, dsNlG8-F and dsNlG8-R, was designed. Double-stranded dsRNA (dsNlG8) was synthesized using the T7 RNAi Transcription Kit (Novozymes, Nanjing, China) and purified. dsGFP was synthesized using the enhanced green fluorescent protein (GFP) gene as a negative control. The primers used for dsRNA template amplification are listed in Table 3.

[0066] After the third-instar nymphs of brown planthoppers were anesthetized with CO2, 20 nL of dsGFP or dsNlG8 (3000 ng / μL) was injected into the intersegmental membrane between the mid-leg and hind-leg of the abdomen of brown planthoppers using a Nanoliter-2010 microinjector.

[0067] Table 3 Primer sequences

[0068] name sequence dsNlG8-F TAATACGACTCACTATAGGGGACAGAGACCTCGAACAACAG dsNlG8-R TAATACGACTCACTATAGGGCACCAACTCCAATGCTGTAATG dsGFP-F TAATACGACTCACTATAGGGGATGCCACCTACGGCAAGCTGA dsGFP-R TAATACGACTCACTATAGGGTGTTCTGCTGGTAGTGGTCGGCGA

[0069] Example 4

[0070] Evaluation of resistance of OE-NlG8 transgenic rice to brown planthopper

[0071] 1. Determination of the feeding preference of brown planthoppers for ZH11 and OE-NlG8

[0072] One ZH11 and one OE-NlG8 plant were planted in a rice cup at the same time. One month later, 10 fifth-instar brown planthoppers were inoculated. The number of brown planthoppers on each seedling was observed at 3, 6, 9, 12, 24, 36, 48, and 72 hours. This experiment was repeated five times. The statistical results showed that when ZH11 and OE-NlG8 were present at the same time, brown planthoppers preferred to feed on ZH11 ( Figure 2 A).

[0073] 2. Determination of brown planthopper weight gain and egg production

[0074] One newly emerged female adult and one newly emerged male adult were placed in a cup of rice seedlings (ZH11 or OE-NlG8) that had been grown for one month. The weight changes of the female brown planthopper adults were counted 48 hours before and after. This experiment was repeated 17 times. Two newly emerged female adults and two newly emerged male adults were placed in a cup of rice seedlings that had been grown for one month. After 7 days, the rice stems were dissected and the number of brown planthopper eggs was counted. This experiment was repeated 12 times. The results showed that compared with those raised on ZH11, the weight gain and egg production of brown planthopper adults on OE-NlG8 were significantly reduced ( Figure 2 B and C).

[0075] The above experiments show that transgenic rice OE-NlG8, that is, rice overexpressing the gene NlG8, has increased insect resistance, including reduced attractiveness to brown planthoppers, and reduced weight gain and egg production of brown planthoppers feeding on this rice.

[0076] Example 5

[0077] Selective experiment on the Chinese pale-winged stink bug

[0078] 1. Experiment on the selectivity of Lygus sinensis to rice after feeding on brown planthoppers with different treatments

[0079] The brown planthoppers treated with dsGFP or dsNlG8 in Example 3 were transferred to Xiushui 11 seedlings for rearing. After 3 days, all brown planthopper nymphs were aspirated out. The two rice seedlings were fixed to the two ends of a T-shaped tube, and 15 Chinese pale-winged stink bugs were placed in the middle of the T-shaped tube. The number of Chinese pale-winged stink bugs in the two cups of rice seedlings was counted after 0.5, 1, 2, and 3 hours. The results are shown in FIG. Figure 3 As shown, this experiment had 12 biological replicates. Figure 3The results of A showed that after 1 hour, there was no significant difference in the attractiveness of the two types of rice to the Chinese pale-winged blind bug. At 2 and 3 hours, the Chinese pale-winged blind bug significantly tended to the rice that had been fed by the brown planthopper injected with dsGFP. After dsNlG8 treatment, the expression level of NlG8 decreased, reducing the release of plant volatiles, indicating that NlG8 can cause the release of plant volatiles that attract natural enemies, providing evidence for the application of NlG8 transgenic plants.

[0080] 2. Selective experiment of Lygus sinensis on ZH11 and OE-NlG8 rice

[0081] Wild-type ZH11 and OE-NlG8 were used in the experiment one month after planting, and the experimental method was the same as above. Figure 3 As shown in B, OE-NlG8 has a significant attraction effect on Chinese pale-winged stink bug.

[0082] 3. Collection and Analysis of Plant Volatiles

[0083] Volatiles from ZH11 and OE-NlG8 plants were collected using a dynamic headspace sampling system. The aerial parts of healthy, one-month-old rice plants were placed whole in a sampling bag, without soil, and sealed with tinfoil. The adsorption column was packed with Tenax-TA 60 / 80. After 8 hours of cyclic sampling, the sample was eluted with 300 μL of n-hexane, and ethyl decanoate was added as an internal standard.

[0084] The plant volatiles were analyzed and identified by GC-MS. The program was set as follows: temperature program 40℃ (hold for 1 min), 5℃ / min to 190℃ (hold for 5 min), and 10℃ / min to 250℃ (hold for 5 min). The injection port temperature was 250℃, the mode was splitless, and the carrier gas was helium. After the analysis, the collected volatiles were identified by comparing with the NIST 17.0 library of the National Institute of Science and Technology software. The results showed that overexpression of NlG8 (OE-NlG8) increased the content of methyl salicylate, leaf alcohol ((Z)-3-Hexen-1-ol) and nonanal (Nonanal) released by rice ( Figure 4 ).

[0085] 4. Olfactory behavioral responses of the Chinese pale-winged stink bug to different plant volatiles

[0086] Filters treated with 10 mg / L methyl salicylate / leaf alcohol / nonanal or n-hexane (control) were placed at both ends of a T-tube. Ten Chinese pale-winged stink bugs were then placed in the middle of the T-tube. After 2 hours, the number of Chinese pale-winged stink bugs on both sides of the T-tube was counted. This experiment was repeated 8 times. The results showed that methyl salicylate, leaf alcohol, and nonanal all had a significant attraction effect on the natural enemy Chinese pale-winged stink bug ( Figure 5 ).

[0087] The above experiments show that transgenic rice OE-NlG8, which overexpresses the receptor of the gene NlG8, significantly induces the release of rice volatiles and has an attractive effect on the predatory natural enemies of brown planthoppers.

[0088] In addition, the present invention interferes with the brown planthopper's own NlG8 through dsNIG8, which also significantly reduces the brown planthopper's weight and egg laying, further proving the application of the brown planthopper salivary protein gene NlG8 in regulating the growth and development of the brown planthopper, thereby indirectly regulating the insect resistance of rice.

Claims

1. A brown planthopper salivary protein gene that induces plant resistance and volatiles, characterized in that: The gene is the brown planthopper salivary protein gene N1G8, and the nucleotide sequence of the brown planthopper salivary protein gene N1G8 is shown in SEQ ID NO.

1.

2. A gene-encoded brown planthopper salivary protein N1G8 according to claim 1, characterized in that: The amino acid sequence of the brown planthopper salivary protein N1G8 is shown in SEQ ID NO.

2.

3. A recombinant expression vector containing the brown planthopper salivary protein gene according to claim 1.

4. A method for constructing a recombinant expression vector of the brown planthopper salivary protein gene according to claim 3, characterized in that: The steps include: The gene NlG8 was connected to the plant overexpression vector pBWA(V)HU containing the UBI promoter to obtain a recombinant expression vector.

5. A host bacteria containing the recombinant expression vector according to claim 3, characterized in that: The host bacteria is Agrobacterium EHA105 as the starting strain.

6. Use of the brown planthopper salivary protein gene N1G8 according to claim 1, or the protein according to claim 2, or the recombinant expression vector according to claim 3, or the host bacteria according to claim 5 in inducing plant resistance and volatiles.

7. The use according to claim 6, characterized in that The plant is preferably rice, the resistance comprises increased resistance to brown planthoppers, and the volatiles are volatiles that attract natural enemies of brown planthoppers.

8. The use according to claim 7, characterized in that The insect resistance is to inhibit the weight growth of brown planthoppers and reduce the egg laying amount of brown planthoppers; the volatile substances include any one or more of methyl salicylate, leaf alcohol or n-nonanal.

9. The use according to claim 6, characterized in that The invention relates to an application of overexpressing the brown planthopper salivary protein gene NlG8 in rice or introducing an overexpression vector or host bacteria to induce rice to produce brown planthopper resistance and induce the release of rice volatiles to attract natural enemy insects of brown planthopper.

10. Use of the brown planthopper saliva protein gene N1G8 according to claim 1, or the protein according to claim 2, or the recombinant expression vector according to claim 3, or the host bacteria according to claim 5 in cultivating transgenic rice with high resistance to brown planthoppers.