Application of OsBC1L6 gene in regulation and control of drought resistance of rice

By cloning the OsBC1L6 gene in rice and knocking out the gene using the CRISPR/Cas9 system, the technical gap in rice drought resistance was solved, and the survival rate and drought resistance of rice were improved under drought conditions were achieved.

CN120485248APending Publication Date: 2025-08-15HUAZHONG AGRI UNIV +3
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510621308.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

There is a lack of effective means to improve drought resistance in rice in the prior art, especially the application of COBRA family genes in rice, which has not been fully studied, affecting the growth and yield of rice under drought conditions.

Method used

By isolating and cloning the OsBC1L6 gene in rice, knocking out or silencing the gene using the CRISPR/Cas9 system to regulate the drought resistance of rice. Specifically, by designing target sites and constructing CRISPR mutants, the drought resistance of rice is enhanced.

Benefits of technology

The survival rate and drought resistance of rice under drought conditions was significantly improved. The survival rate of mutants after drought rehydration was significantly higher than that of control wild type, achieving enhanced drought resistance of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005402597470000011
    Figure HDA0005402597470000011
  • Figure HDA0005402597470000012
    Figure HDA0005402597470000012
  • Figure HDA0005402597470000021
    Figure HDA0005402597470000021
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of an OsBC1L6 gene in regulation and control of drought resistance of rice. The OsBC1L6 gene capable of weakening the drought tolerance of rice is obtained through separation, cloning and functional verification, the nucleotide sequence of the OsBC1L6 gene is as shown in SEQ ID NO. 1, and the sequence of protein coded by the OsBC1L6 gene is as shown in SEQ ID NO. 2. The rice drought response control gene OsBC1L6 is cloned, CRISPR mutant phenotype identification is carried out on candidate genes, seedling stage drought stress phenotype identification shows that when a gene segment is deleted, the drought stress resistance of rice is enhanced, and the function and the application way of the OsBC1L6 are proved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the isolation, cloning, and functional verification of a rice gene, OsBC1L6, capable of reducing drought tolerance, for use in genetically improving rice drought resistance. The present invention employs a candidate gene screening method to clone the rice drought-reduction gene, OsBC1L6. CRISPR technology was used to construct an osbc1l6 mutant. Co-segregation testing demonstrated a close association between the osbc1l6 mutant and a drought-tolerant phenotype, confirming the gene's function and potential applications. Background Art

[0002] Plants are affected by many environmental factors during their growth. Drought, cold damage, and high temperatures can lead to large-scale crop yield reductions, becoming a bottleneck for agricultural development in many regions. Cultivating stress-tolerant crop varieties has always been one of the main goals of agricultural science and technology research. In order to resist or adapt to these adverse factors, plants sense changes in extracellular environmental conditions and transmit them to the cells through various pathways, inducing the expression of some response genes, producing some functional proteins and osmotic regulating substances that protect cells from stress damage such as drought, high salt, and low temperature to adapt to adverse growth environments (Xiong et al., Cell signaling during cold, drought and salt stress. Plant Cell, 14 (suppl), 2002, S165–S183). Plants respond to environmental changes through a sophisticated gene expression regulatory network. Growing evidence shows that COBRA family genes play an important role in plant response to abiotic stress. In rice, Sun et al. found that DROT1, a member of the COBRA family, was drought-resistant under both laboratory soil water stress and field drought conditions, and that DROT1's drought resistance was related to its expression level (Sun et al., Natural variation of DROT1 confers drought adaptation in upland rice. Nat Commun, 2022, 13: 4265-4281). In cotton, Fu et al. identified 39 COBRA family genes through genomic analysis and found that GhCOBL22 was significantly upregulated under PEG treatment. Using virus-induced gene silencing (VIGS) technology, they demonstrated that interfering with the expression of the GhCOBL22 gene reduced cotton's resistance to drought stress, as evidenced by decreased superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities, reduced proline content, and increased malondialdehyde (MDA) accumulation. Furthermore, silencing the GhCOBL22 gene also reduced the content of cellulose, hemicellulose, and lignin in cotton leaves (Fu et al., Genome-wide analysis of the cotton COBRA-like gene family and functional characterization of GhCOBL22 in relation to drought tolerance. BMC Plant Biol, 2024, 24: 1242-1455).The TaCOBL gene in wheat is upregulated under low temperature stress. Liu et al. found that TaCOBL-5B has two haplotypes (Hap5B-a and Hap5B-b), which are significantly correlated with cold resistance under four environmental conditions. Hap5B-a is a favorable haplotype acquired during wheat polyploidization and may have a positive contribution to enhancing wheat cold resistance (Liu et al., Novel function of a putative TaCOBL ortholog associated with cold response. Mol Biol Rep, 2023, 50: 4375-4384). The PtrCOBL gene family in poplar is also involved in abiotic stress response. Sajjad et al. systematically analyzed the COBL gene family in poplar and found that PtrCOBL2 and PtrCOBL3 act as key hub genes involved in the regulation of various abiotic stresses and wood development (Sajjad et al., Recent genome resequencing paraded COBRA-Like gene family roles in abiotic stress and wood formation in Poplar. Front Plant Sci, 2023, 14: 1242836-1242855). These studies collectively indicate that COBRA family genes play an important role in regulating plant resistance to stresses such as drought and low temperature by regulating the synthesis, deposition, and remodeling of cell wall components.

[0003] The COBRA gene family encodes a class of plant-specific glycosylphosphatidylinositol-anchored proteins with a highly conserved structure. Family members contain a signal peptide at the N-terminus and a hydrophobic region at the C-terminus for GPI anchoring modification. Some members also contain a carbohydrate binding module (CBM) for cellulose binding. GPI anchoring is one of the three main types of protein glycosylation (the other two are N-glycosylation and O-glycosylation). It forms covalent bonds with specific amino acid residues in proteins to link proteins, lipids, and sugar chains into complex glycoconjugates, enabling proteins to be localized to the outer surface of the plasma membrane.

[0004] The COBRA gene family is an important gene family unique to plants. It is involved in regulating cell wall synthesis, affecting cellulose assembly and mechanical strength, mediating cell growth such as root and pollen tube elongation, and regulating the development of flowers, leaves and seeds. It can also respond to abiotic stresses such as salt stress, drought and low temperature.

[0005] Rice is an important food crop and model plant. Breeding rice with enhanced stress tolerance is crucial in today's climate, where extreme weather conditions are common. However, the OsBC1L6 gene belongs to the COBRA family of genes, and its ability to enhance drought tolerance in rice has not yet been reported. Therefore, isolating the OsBC1L6 gene from rice and characterizing its role in enhancing stress tolerance will be crucial for developing new stress-tolerant rice varieties. Summary of the Invention

[0006] The object of the present invention is to provide an application of the OsBC1L6 gene in rice in regulating drought resistance of rice. The protein encoded by the OsBC1L6 gene is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide an application of the OsBC1L6 gene in rice in creating drought-resistant rice. The protein encoded by the OsBC1L6 gene is shown in SEQ ID NO.2.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] Using a candidate gene screening method, the applicants cloned OsBC1L6, a gene that negatively regulates rice drought resistance. This gene belongs to the COBRA gene family. Loss of this gene's function enhances rice drought resistance under drought conditions. The protein encoded by this gene is shown in SEQ ID NO. 2, and one of the genes encoding this protein is shown in SEQ ID NO. 1.

[0010] The protection scope of the present invention includes:

[0011] Application of the OsBC1L6 gene in rice in regulating drought resistance of rice, wherein the protein encoded by the OsBC1L6 gene is shown in SEQ ID NO.2;

[0012] The applications described above are specifically:

[0013] Increasing the expression of the OsBC1L6 gene in rice to reduce the drought resistance of rice;

[0014] Reduce the expression of the OsBC1L6 gene in rice to enhance drought resistance;

[0015] Knockout, inhibition, or silencing of the OsBC1L6 gene in rice can enhance drought resistance in rice;

[0016] In the above applications, preferably, the knockout is performed using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function, thereby achieving the effect of improving the drought resistance of rice.

[0017] Preferably, the target sites of the gRNA of the OsBC1L6 gene in the system are target site 1: GGGAGCAGGTCCACGATCTCAGG and target site 2: ACCCTGAAATCTCCAGGTCCAGG.

[0018] In the above application, the drought-resistant rice edited by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO.3 or SEQ ID NO.4.

[0019] Application of the OsBC1L6 gene in rice in creating drought-resistant rice, specifically: introducing a substance that reduces the expression level of the OsBC1L6 gene in rice into the rice;

[0020] In the above application, preferably, the substance is a nucleic acid molecule containing a knockout, inhibition or silencing agent for the OsBC1L6 gene, or an expression cassette of the nucleic acid molecule, a recombinant vector, or a recombinant microorganism;

[0021] The OsBC1L6 gene is shown as SEQ ID NO.1.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] The applicant disclosed for the first time that the OsBC1L6 gene of rice is negatively correlated with the drought resistance of rice, and editing this gene can transform and improve the drought resistance of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The gene editing status of rice osbc1l6 CRISPR mutant;

[0025] osbc1l6-1 and osbc1l6-2 are two osbc1l6 CRISPR mutant homozygous Cas9-free families.

[0026] Figure 2 This is the drought stress phenotype of the rice osbc1l6 CRISPR mutant at the seedling stage;

[0027] osbc1l6-1 and osbc1l6-2 are two osbc1l6 CRISPR mutant homozygous Cas9-free families, and Zhonghua 11 (ZH11) was used as a control; Figures A and B show the growth status of the osbc1l6-1 family before drought treatment and after drought rewatering; Figures C and D show the growth status of the osbc1l6-2 family before drought treatment and after drought rewatering.

[0028] Figure 3 Statistics of the survival rate of rice osbc1l6 CRISPR mutants under drought stress at the seedling stage;

[0029] osbc1l6-1 and osbc1l6-2 are two osbc1l6 CRISPR mutant homozygous Cas9-free families, and Zhonghua 11 (ZH11) was used as a control; Figure A shows the statistical survival rate of the osbc1l6-1 family under drought stress at the seedling stage; Figure B shows the statistical survival rate of the osbc1l6-2 family under drought stress at the seedling stage. DETAILED DESCRIPTION

[0030] The following examples define the present invention and describe methods for constructing an osbc1l6 CRISPR mutant, cloning a DNA fragment containing the complete coding region of the OsBC1L6 gene, and validating the function of the OsBC1L6 gene. Based on the following description and these examples, those skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the invention, may make various changes and modifications to adapt the invention to various uses and conditions.

[0031] Example 1: Isolation and cloning of the OsBC1L6 gene

[0032] Primers OsBC1L6-F (5'-ATGGCGCTCCTGCTGCTGC-3') and OsBC1L6-R (5'-CTATGCGTAAACCATCAAGA-3') were designed based on the Rice Gene Database (http: / / www.ricedata.cn / gene / ). Using cDNA from leaves of the rice variety Nipponbare (a well-known and widely used rice variety) as a template, primers OsBC1L6-F and OsBC1L6-R were used to amplify the CDS sequence encoded by the OsBC1L6 gene as shown in SEQ ID NO. 1.

[0033] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, followed by 33 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min.

[0034] The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega), and positive clones were screened and sequenced to obtain the OsBC1L6 CDS sequence.

[0035] The applicant named the clone pGEM OsBC1L6 plasmid

[0036] Example 2: Construction of OsBC1L6 gene overexpression vector

[0037] The positive clone pGEM OsBC1L6 plasmid obtained in Example 1 was amplified using primers OsBC1L6-1301U-flag-F (5'-ACCATTTACGAACGATAGCCGGTAC ATGGCGCTCCTGCTGCTGC-3') and OsBC1L6-1301U-flag-R (5'-CATCATGATCTTTGTAATCGGATCC TGCGTAAACCATCAAGAATG-3') to a DNA fragment containing the complete coding region of the OsBC1L6 gene. The PCR reaction conditions were: 94°C pre-denaturation for 3 min; 94°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min, for 30 cycles. The obtained PCR product was ligated into the pU1301 vector digested with the restriction endonucleases Kpn I and BamH I by the Gibson Assembly method. The vector was sequenced to confirm the vector, and the OsBC1L6 gene overexpression vector suitable for genetic transformation was obtained.

[0038] Example 3: Construction of osbc1l6 CRISPR mutant

[0039] The gene sequence of the OsBC1L6 gene was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). Two target sites were selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The vector construction of CRISPR mutant strains can be referred to the relevant literature (He Yubing et al. Programmed self-elimination of the CRISPR / Cas9 construct greatly accelerates the isolation of edited and transgene-free rice plants. Mol. Plant. 2018, 05.005.). Due to space limitations, this specification will not be further described. The target sites selected from the CRISPR-P v2.0 website are as follows:

[0040] Target site 1: GGGAGCAGGTCCACGATCTCAGG, target site 2: ACCCTGAAATCTCCAGGTCCAGG.

[0041] The constructed CRISPR vector OsBC1L6-CRISPR was introduced into the rice variety "Zhonghua 11" via Agrobacterium-mediated genetic transformation (specific steps are described below). Transgenic plants were obtained through pre-culture, infection, co-cultivation, selection of hygromycin-resistant calli, differentiation, rooting, seedling training, and transplanting. This Agrobacterium-mediated genetic transformation method (system) for rice (Zhonghua 11) was modified from the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994) (see transformation steps below).

[0042] The specific genetic transformation steps of this embodiment are as follows:

[0043] (1) Electroporation: The final CRISPR target vector OsBC1L6-CRISPR was electroporated into the Agrobacterium tumefaciens EHA105 strain at 1800 V, and plated on LA medium with corresponding resistance selection. Positive clones were screened for the following transformation callus.

[0044] (2) Callus induction: Shell the middle part of mature rice seeds, then treat them with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) to sterilize the seeds for 15 minutes; wash the seeds with sterilized water 4-5 times; place the sterilized seeds on the induction medium; and culture the inoculated callus induction medium in the dark for 4 weeks at a temperature of 25±1°C.

[0045] (3) Callus subculture: Select bright yellow, compact and relatively dry embryogenic calli and culture them on subculture medium in the dark at 25±1℃ for 2 weeks.

[0046] (4) Pre-culture: Select compact and relatively dry embryogenic calli and culture them on pre-culture medium in the dark at 25±1°C for 2 weeks.

[0047] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain, carrying the CRISPR vector OsBC1L6-CRISPR of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at 28°C; the Agrobacterium was transferred to a suspension culture medium and cultured on a shaker at 28°C for 2-3 hours.

[0048] (6) Agrobacterium infection: transfer the pre-cultured callus into a sterilized bottle; adjust the Agrobacterium suspension to OD 600 0.8-1.0; soak the callus in the Agrobacterium suspension for 30 minutes; transfer the callus to a sterilized filter paper and dry it; then place it on the co-culture medium and culture it for 3 days at a culture temperature of 19-20°C.

[0049] (7) Callus washing and selective culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterilized filter paper and blot dry; transfer the callus to selective culture medium for selection 2-3 times, each time for 2 weeks (the carbenicillin concentration for the first screening is 400 ppm, the second and subsequent screenings are 250 ppm, and the hygromycin concentration is 250 ppm).

[0050] (8) Differentiation: Transfer the resistant calli to the pre-differentiation culture medium and culture in the dark for 5-7 weeks; transfer the pre-differentiation culture calli to the differentiation medium and culture under light at 26°C.

[0051] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to rooting medium and culture them under light at 26°C for 2-3 weeks.

[0052] (10) Transplantation: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems into the greenhouse while keeping them moist for the first few days.

[0053] Based on the above gene editing target sites, primers were designed to detect the editing status of the OsBC1L6 gene in the mutants. The OsBC1L6 gene was specifically amplified by PCR using primers (osbc1l6-CR-F: 5'-CCTTCCTGGTTCACAGGACT-3' and osbc1l6-CR-R: 5'-CCTGAACTACTTTGCACGGC-3'). The amplified PCR products were sequenced and tested for the presence of Cas9. The sequencing results showed that in the osbc1l6-1 CRISPR homozygous Cas9-free mutant family, the OsBC1L6 gene deleted 4 bases at target site 1, which contained the sequence shown in SEQ ID NO.3; in the osbc1l6-2 CRISPR homozygous Cas9-free mutant family, the OsBC1L6 gene deleted 4 bases at target site 2, which contained the sequence shown in SEQ ID NO.4, that is, the OsBC1L6 gene in the two mutant families was mutated ( Figure 1 ).

[0054] Example 4: Identification of drought stress phenotypes of osbc1l6 CRISPR mutants at the seedling stage

[0055] The homozygous mutant (osbc1l6) (including osbc1l6-1 and osbc1l6-2) with the identified genotype in Example 3 and the control wild-type (i.e., non-transgenic, the same below) rice variety Zhonghua 11 (ZH11) were germinated and then directly seeded into small drums. Half of the drum was planted with the mutant material, and the other half was planted with the control wild-type rice variety Zhonghua 11, with 12 plants in each drum. The soil used in the experiment was a mixture of southern Chinese paddy soil and coarse sand in a volume ratio of 2:3. An equal volume of uniform sandy soil was added to each drum, and the water seeped out to ensure consistent soil compaction. The experiment was repeated three times. Healthy rice plants at the four-leaf stage were deprived of water and drought-stressed for 7 days, then rehydrated for 7 days. Pictures were taken and the survival rate of the plants was investigated.

[0056] The results showed that compared with the ZH11 control, the CRISPR homozygous mutant plants showed a drought-resistant phenotype ( Figure 2 After drought rewatering, the average survival rates of the osbc1l6-1 mutant and the control ZH11 in the small barrels were 61.1% and 27.8%, respectively. The average survival rates of the osbc1l6-2 mutant and the control ZH11 were 77.8% and 36.1%, respectively. The statistical results showed that the survival rate of the osbc1l6 mutant after drought rewatering was significantly higher than that of the wild-type ZH11 ( Figure 3 ).

[0057] Calculation of average survival rate

[0058] Twelve transgenic seedlings (osbc1l6 mutant) and 12 control seedlings (ZH11) were planted in each bucket in half, and the experiment was repeated 5 times according to a randomized block design.

[0059] The survival rate of each replicate = the number of surviving transgenic seedlings or control seedlings / total number × 100%

[0060] The survival rates of three replicates of the same family were calculated and analyzed for significant differences. The results are shown in the figure below. Figure 3 shown.

Claims

1. Rice OsBC1L6 Application of genes in regulating rice drought resistance, the OsBC1L6 The protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The regulation is to increase the OsBC1L6 The expression level of the gene can be used to reduce the drought resistance of rice.

3. The use according to claim 1, characterized in that: The regulation is to reduce the OsBC1L6 The expression of genes can be used to enhance the drought resistance of rice.

4. The use according to claim 1, characterized in that: The regulation is to knock out, inhibit or silence the rice OsBC1L6 Genes to enhance drought resistance in rice.

5. The use according to claim 4, characterized in that: The knockout uses the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function, thereby achieving the effect of improving the drought resistance of rice.

6. The use according to claim 5, characterized in that: The target sites of gRNA in the system are target site 1: GGGAGCAGGTCCACGATCTCAGG and target site 2: ACCCTGAAATCTCCAGGTCCAGG.

7. The use according to claim 6, wherein the rice with enhanced drought resistance after editing by the CRISPR / Cas9 system comprises the polynucleotide shown in SEQ ID NO. 3 or SEQ ID NO.

4.

8. Rice OsBC1L6 The application of genes in creating drought-resistant rice is specifically to reduce the OsBC1L6 The gene expression amount of the substance is introduced into rice, and the OsBC1L6 The protein encoded by the gene is shown in SEQ ID NO.

2.

9. The use according to claim 8, wherein the substance contains a substance that can knock out, inhibit or silence OsBC1L6 The nucleic acid molecule of the gene, or the expression frame of the nucleic acid molecule, the recombinant vector, and the recombinant microorganism.

10. The use according to claim 1 or 8, wherein OsBC1L6 The gene is shown as SEQ ID NO.1.