Application of OsBC1L7 gene in regulation and control of drought resistance of rice

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of an OsBC1L7 gene in regulation and control of drought resistance of rice. The OsBC1L7 gene capable of weakening the drought tolerance of rice is obtained through separation, cloning and functional verification, the nucleotide sequence of the OsBC1L7 gene is as shown in SEQ ID NO. 1, and the sequence of protein coded by the OsBC1L7 gene is as shown in SEQ ID NO. 2. The rice drought response control gene OsBC1L7 is cloned, seedling stage drought stress phenotype analysis shows that the tolerance of an OsBC1L7 gene overexpression strain to drought stress is obviously weakened, and the function and application approach of the OsBC1L7 are proved.

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the isolation, cloning, and functional verification of a rice gene, OsBC1L7, that can reduce drought tolerance, and its application in genetically improving rice drought resistance. The present invention utilizes a candidate gene screening method to clone the rice drought resistance gene, OsBC1L7. Drought experiments demonstrate that overexpressing the OsBC1L7 gene can reduce rice's drought tolerance, confirming the gene's function and potential applications. Background Art

[0002] Plants are affected by many environmental factors during their growth. Drought, cold damage, and high temperatures can lead to large-scale crop yield reductions, becoming a bottleneck for agricultural development in many regions. Cultivating stress-tolerant crop varieties has always been one of the main goals of agricultural science and technology research. In order to resist or adapt to these adverse factors, plants sense changes in extracellular environmental conditions and transmit them to the cells through various pathways, inducing the expression of some response genes, producing some functional proteins and osmotic regulating substances that protect cells from stress damage such as drought, high salt, and low temperature to adapt to adverse growth environments (Xiong et al., Cell signaling during cold, drought and salt stress. Plant Cell, 14 (suppl), 2002, S165–S183). Plants respond to environmental changes through a sophisticated gene expression regulatory network. Growing evidence shows that COBRA family genes play an important role in plant response to abiotic stress. In rice, Sun et al. found that DROT1, a member of the COBRA family, was drought-resistant under both laboratory soil water stress and field drought conditions, and that DROT1's drought resistance was related to its expression level (Sun et al., Natural variation of DROT1 confers drought adaptation in upland rice. Nat Commun, 2022, 13: 4265-4281). In cotton, Fu et al. identified 39 COBRA family genes through genomic analysis and found that GhCOBL22 was significantly upregulated under PEG treatment. Using virus-induced gene silencing (VIGS) technology, they demonstrated that interfering with the expression of the GhCOBL22 gene reduced cotton's resistance to drought stress, as evidenced by decreased superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) activities, reduced proline content, and increased malondialdehyde (MDA) accumulation. Furthermore, silencing the GhCOBL22 gene also reduced the content of cellulose, hemicellulose, and lignin in cotton leaves (Fu et al., Genome-wide analysis of the cotton COBRA-like gene family and functional characterization of GhCOBL22 in relation to drought tolerance. BMC Plant Biol, 2024, 24: 1242-1455).The TaCOBL gene in wheat is upregulated under low temperature stress. Liu et al. found that TaCOBL-5B has two haplotypes (Hap5B-a and Hap5B-b), which are significantly correlated with cold resistance under four environmental conditions. Hap5B-a is a favorable haplotype acquired during wheat polyploidization and may have a positive contribution to enhancing wheat cold resistance (Liu et al., Novel function of a putative TaCOBL ortholog associated with cold response. Mol Biol Rep, 2023, 50: 4375-4384). The PtrCOBL gene family in poplar is also involved in abiotic stress response. Sajjad et al. systematically analyzed the COBL gene family in poplar and found that PtrCOBL2 and PtrCOBL3 act as key hub genes involved in the regulation of various abiotic stresses and wood development (Sajjad et al., Recent genome resequencing paraded COBRA-Like gene family roles in abiotic stress and wood formation in Poplar. Front Plant Sci, 2023, 14: 1242836-1242855). These studies collectively indicate that COBRA family genes play an important role in regulating plant resistance to stresses such as drought and low temperature by regulating the synthesis, deposition, and remodeling of cell wall components.

[0003] The COBRA gene family encodes a class of plant-specific glycosylphosphatidylinositol-anchored proteins with a highly conserved structure. Family members contain a signal peptide at the N-terminus and a hydrophobic region at the C-terminus for GPI anchoring modification. Some members also contain a carbohydrate binding module (CBM) for cellulose binding. GPI anchoring is one of the three main types of protein glycosylation (the other two are N-glycosylation and O-glycosylation). It forms covalent bonds with specific amino acid residues in proteins to link proteins, lipids, and sugar chains into complex glycoconjugates, enabling proteins to be localized to the outer surface of the plasma membrane.

[0004] The COBRA gene family is an important gene family unique to plants. It is involved in regulating cell wall synthesis, affecting cellulose assembly and mechanical strength, mediating cell growth such as root and pollen tube elongation, and regulating the development of flowers, leaves and seeds. It can also respond to abiotic stresses such as salt stress, drought and low temperature.

[0005] Rice is an important food crop and model plant. In today's climate, where extreme climatic conditions are frequent, breeding rice with enhanced stress tolerance is crucial. Given that the OsBC1L7 gene belongs to the COBRA family of genes, there are currently no reports on its ability to enhance drought tolerance in rice. Therefore, isolating the OsBC1L7 gene from rice and characterizing its role in enhancing rice stress tolerance will be crucial for developing new stress-tolerant rice varieties. Summary of the Invention

[0006] The object of the present invention is to provide an application of the OsBC1L7 gene in rice in regulating drought resistance of rice. The protein encoded by the OsBC1L7 gene is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide an application of the OsBC1L7 gene in rice for creating drought-sensitive rice. The protein encoded by the OsBC1L7 gene is shown in SEQ ID NO.2.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] Using a candidate gene screening method, the applicants cloned the negatively regulating rice drought resistance gene OsBC1L7, which belongs to the COBRA protein family. Overexpression of this gene reduces rice drought resistance under drought conditions. The protein encoded by this gene is shown in SEQ ID NO. 2, and one of the genes encoding this protein is shown in SEQ ID NO. 1.

[0010] The protection scope of the present invention includes:

[0011] Application of the OsBC1L7 gene in rice in regulating drought resistance of rice, wherein the protein encoded by the OsBC1L7 gene is shown in SEQ ID NO.2;

[0012] The applications described above are specifically:

[0013] Increasing the expression of the OsBC1L7 gene in rice to reduce its drought resistance;

[0014] Reduce the expression of the OsBC1L7 gene in rice to enhance drought resistance;

[0015] Knockout, inhibition, or silencing of the OsBC1L7 gene in rice can enhance drought resistance in rice;

[0016] In the above applications, preferably, the knockout is performed using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function, thereby achieving the effect of improving the drought resistance of rice.

[0017] Application of the OsBC1L7 gene in rice in creating drought-sensitive rice, specifically: introducing a substance that increases the expression level of the OsBC1L7 gene in rice into the rice;

[0018] In the above application, preferably, the substance is a nucleic acid molecule containing the OsBC1L7 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0019] The OsBC1L7 gene is shown as SEQ ID NO.1.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] The applicant disclosed for the first time that the OsBC1L7 gene of rice is related to the drought resistance of rice. This gene can be transformed into a variety of plants including rice and used to cultivate new varieties of drought-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the expression level of rice OsBC1L7 gene;

[0023] OE-OsBC1L7-1 and OE-OsBC1L7-2 are two single-copy homozygous overexpression families, and the wild-type Nipponbare (NIP) was used as a control.

[0024] Figure 2 To analyze the drought stress phenotype and survival rate of OsBC1L7 overexpressing rice seedlings in potted plants;

[0025] Figures A and B show the growth status of the wild-type NIP and OE-OsBC1L7-1 families before drought treatment and after drought rewatering; Figures C and D show the growth status of the wild-type NIP and OE-OsBC1L7-2 families before drought treatment and after drought rewatering; Figure E shows the statistical survival rate of the wild-type NIP and OE-OsBC1L7-1 families under drought stress at the seedling stage; Figure F shows the statistical survival rate of the NIP and OE-OsBC1L7-2 families under drought stress at the seedling stage. DETAILED DESCRIPTION

[0026] The following examples define the present invention and describe methods for constructing genetic material for overexpression of OsBC1L7 in rice, cloning a DNA fragment containing the complete coding region of the OsBC1L7 gene, and verifying the function of the OsBC1L7 gene. Based on the following description and these examples, those skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the invention, may make various changes and modifications to adapt the invention to various uses and conditions.

[0027] Example 1: Isolation and cloning of the OsBC1L7 gene

[0028] Primers OsBC1L7-F (5'-ATGGCGGTGCTCGGCTCCCT-3') and OsBC1L7-R (5'-CTACGCCATGAGGAAGAACA-3') were designed based on the Rice Gene Database (http: / / www.ricedata.cn / gene / ). Using cDNA from leaves of the rice variety Nipponbare (a well-known and widely used rice variety) as a template, primers OsBC1L7-F and OsBC1L7-R were used to amplify the CDS sequence encoded by the OsBC1L7 gene as shown in SEQ ID NO. 1.

[0029] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, followed by 33 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min.

[0030] The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega), and positive clones were screened and sequenced to obtain the OsBC1L7 CDS sequence.

[0031] The applicant named this clone as pGEM OsBC1L7 plasmid.

[0032] Example 2: Construction of OsBC1L7 gene overexpression vector

[0033] The positive clone pGEM OsBC1L7 plasmid obtained in Example 1 was amplified using primers OsBC1L7-1301U-flag-F (5'-ACCATTTACGAACGATAGCCGGTAC ATGGCGGTGCTCGGCTCCCT-3') and OsBC1L7-1301U-flag-R (5'-CATCATGATCTTTGTAATCGGATCC CGCCATGAGGAAGAACACCA-3') to a DNA fragment containing the complete coding region of the OsBC1L7 gene. The PCR reaction conditions were: 94°C pre-denaturation for 3 min; 94°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min, for 30 cycles. The obtained PCR product was ligated into the pU1301 vector digested with the restriction endonucleases Kpn I and BamH I by the Gibson Assembly method. The vector was sequenced to confirm the vector, and finally, an OsBC1L7 gene overexpression vector suitable for genetic transformation was obtained.

[0034] Example 3: Genetic transformation of overexpression vector and positive detection of transgenic plants

[0035] 1. Rice genetic transformation:

[0036] The overexpression vector constructed in Example 2 was introduced into the rice variety "Nipponbare" via Agrobacterium-mediated genetic transformation of rice (specific steps are described below). Transgenic plants were obtained through pre-culture, infection, co-cultivation, selection of hygromycin-resistant calli, differentiation, rooting, seedling training, and transplanting. This Agrobacterium-mediated genetic transformation of rice (system) was modified from the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994) (see transformation steps below).

[0037] (1) Electrotransformation: The final target vector was electrotransformed into the Agrobacterium EHA105 strain using a voltage of 1800 V, and the culture medium was spread on LA medium with corresponding resistance selection. Positive clones were screened and used for the following transformation callus.

[0038] (2) Callus induction: Mature rice seeds (Nipponbare) were shelled and then treated with 70% ethanol for 1 minute and 0.15% mercuric chloride (HgCl2) for 15 minutes for surface disinfection; the seeds were washed 4-5 times with sterile water; the sterilized seeds were placed on an induction medium; and the inoculated callus induction medium was cultured in the dark at 25±1°C for 4 weeks.

[0039] (3) Callus subculture: Select bright yellow, compact and relatively dry embryogenic calli and culture them on subculture medium in the dark at 25±1℃ for 2 weeks.

[0040] (4) Pre-culture: Select compact and relatively dry embryogenic calli and culture them on pre-culture medium in the dark at 25±1°C for 2 weeks.

[0041] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the target vector of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28°C; the Agrobacterium was transferred to a suspension culture medium and cultured on a shaker at 28°C for 2-3 hours.

[0042] (6) Agrobacterium infection: transfer the pre-cultured callus into a sterilized bottle; adjust the Agrobacterium suspension to OD 6000.8-1.0; soak the callus in the Agrobacterium suspension for 30 minutes; transfer the callus to a sterilized filter paper and dry it; then place it on the co-culture medium and culture it for 3 days at a culture temperature of 19-20°C.

[0043] (7) Callus washing and selective culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterilized filter paper and blot dry; transfer the callus to selective culture medium for selection 2-3 times, each time for 2 weeks (the carbenicillin concentration for the first screening is 400 ppm, the second and subsequent screenings are 250 ppm, and the hygromycin concentration is 250 ppm).

[0044] (8) Differentiation: Transfer the resistant calli to the pre-differentiation culture medium and culture in the dark for 5-7 weeks; transfer the pre-differentiation culture calli to the differentiation medium and culture under light at 26°C.

[0045] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to rooting medium and culture them under light at 26°C for 2-3 weeks.

[0046] (10) Transplantation: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems into the greenhouse while keeping them moist for the first few days.

[0047] 2. Positive detection of transgenic plants

[0048] To detect the expression of the target gene in overexpressing transgenic plants, the applicants used real-time PCR to analyze the expression of the transgenic T0 and T1 generations. The total RNA used in the experiment was seedling RNA, and the product was reverse transcribed and analyzed using real-time fluorescence quantitative PCR to detect the transcription level of OsBC1L7.

[0049] The PCR parameters were pre-denaturation at 95°C for 10 seconds, denaturation at 95°C for 5 seconds, and annealing and extension at 60°C for 30 seconds, for 40 cycles. The primer sequences used for real-time PCR were:

[0050] OsBC1L7-QF: GCGATGTTCTATGGGCTGAAGOsBC1L7-QR: GCCGTTGAAGTAGACCTTCCT.

[0051] The expression of the target gene was detected in the T0 and T1 generations of transgenic plants, and the expression results of OsBC1L7 in the T1 generation of overexpressed transgenic rice were shown in Figure 2. Figure 1Real-time PCR results showed that among the transgenic rice materials, the expression levels in the OE-OsBC1L7-1 family and the OE-OsBC1L7-1 individual plants were significantly increased compared with the wild-type NIP, indicating that the overexpression effect was very good.

[0052] Example 4: Identification of Drought Stress Phenotypes in Rice OsBC1L7 Overexpressing Materials at Seedling Stage

[0053] The identified overexpression materials prepared in Example 3 (including OE-OsBC1L7-1 and OE-OsBC1L7-2) and the control wild-type (i.e., non-transgenic, the same below) rice variety Nipponbare (NIP) were germinated and then directly seeded into small drums. Half of the drums were planted with the overexpression materials, and the other half were planted with the control wild-type rice variety Nipponbare, with 12 plants each. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand in a volume ratio of 2:3. Each drum was filled with an equal amount of uniform sand and an equal volume of water. The water seeped out on its own to ensure consistent soil compaction. The experiment was repeated three times. Healthy rice plants in the 4-leaf stage were deprived of water and drought-stressed for 7 days, then rehydrated for 7 days. Pictures were taken and the survival rate of the plants was investigated.

[0054] The results showed that compared with the NIP control, OsBC1L7 overexpressing plants showed a drought-sensitive phenotype ( Figure 1 After drought rewatering, the average survival rates of the OE-OsBC1L7-1 overexpression line and the control NIP in the small barrel were 0.0% and 50.0%, respectively. The average survival rates of the OE-OsBC1L7-2 overexpression line and the control NIP were 5.6% and 100.0%, respectively. The statistical results showed that the survival rate of the OsBC1L7 overexpression line after drought rewatering was significantly lower than that of the control wild-type NIP ( Figure 2 ).

[0055] Calculation of average survival rate

[0056] Each barrel was divided into two halves and planted with 12 transgenic seedlings (OsBC1L7 overexpressing family) and 12 control seedlings (NIP). The experiment was repeated 5 times according to a randomized block design.

[0057] The survival rate of each replicate = the number of surviving transgenic seedlings or control seedlings / total number × 100%

[0058] The survival rates of three replicates of the same family were calculated and analyzed for significant differences. The results are shown in the figure below. Figure 2 shown.

Claims

1. Rice OsBC1L7 Application of genes in regulating rice drought resistance, the OsBC1L7 The protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, wherein the regulation is to increase the OsBC1L7 The expression level of the gene can be used to reduce the drought resistance of rice.

3. The use according to claim 1, wherein the regulation is to reduce OsBC1L7 The expression of genes can be used to enhance the drought resistance of rice.

4. The use according to claim 1, wherein the regulation is to knock out, inhibit or silence OsBC1L7 Genes to enhance drought resistance in rice.

5. The use according to claim 4, wherein the knockout is performed using the CRISPR / Cas9 system.

6. Rice OsBC1L7 Application of the gene in preparing drought-sensitive transgenic rice, the OsBC1L7 The protein encoded by the gene is shown in SEQ ID NO.

2.

7. The application according to claim 7, wherein the application process comprises increasing the OsBC1L7 Gene expression levels of substances are introduced into rice.

8. The use according to claim 7, wherein the substance contains OsBC1L7 The nucleic acid molecule of the gene, or its expression cassette, recombinant vector, recombinant microorganism.

9. The use according to claim 8, wherein OsBC1L7 The gene is shown as SEQ ID NO.1.

Images