Application of IbARF1 gene in regulation and control of sweet potato starch synthesis
By overexpressing or interfering with the IbARF1 gene in sweet potatoes, and regulating the synthesis of sweet potato starch, the problem of starch content regulation in the existing technology is solved, and effective regulation of the starch content and proportion of sweet potatoes is achieved, providing genes and methods for cultivating new sweet potato varieties with different starch content.
Patent Information
- Application Number
- CN202510641683.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-15
AI Technical Summary
The prior art is difficult to effectively regulate the synthesis of sweet potato starch, especially the total starch and amylose content, which limits the diversity and yield improvement of sweet potato varieties.
By overexpressing or interfering with the expression of the IbARF1 gene, the expression of the IbARF1 gene is regulated in sweet potatoes by using recombinant vectors and Agrobacterium-mediated methods, and the regulation of the starch content and amylose ratio of sweet potatoes is achieved.
Successfully regulating the total starch and amylose content of sweet potatoes provides genes and methods for cultivating new sweet potato varieties with different starch content, and technical means to increase or reduce starch content.
Smart Images

Figure CN120485254A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering, in particular to application of IbARF1 gene in regulating the synthesis of sweet potato starch. Background Art
[0002] Sweet potato (Ipomoea batatas (L.) Lam.) is an important food, feed, industrial raw material, and new energy crop, with irreplaceable ecological, economic, and social value worldwide. Sweet potato starch is the most important product of the sweet potato and has enormous utilization value.
[0003] Biotechnology plays an important role in increasing sweet potato starch yield. As a hexaploid crop, sweet potato has a complex genome and high heterozygosity, which severely hinders the identification of genes involved in starch synthesis and the study of the molecular mechanisms. Identifying genes involved in starch synthesis in sweet potato tubers and further studying the mechanisms regulating starch synthesis are crucial for breeding high-starch sweet potato varieties. Summary of the Invention
[0004] The purpose of the present invention is to provide an application of the IbARF1 gene in regulating sweet potato starch synthesis to solve the problems existing in the above-mentioned prior art. By interfering with the IbARF1 gene, sweet potato starch synthesis can be significantly promoted and the total starch and / or amylose content can be increased; overexpressing the IbARF1 gene can significantly reduce sweet potato starch synthesis and reduce the total starch and / or amylose content, laying the foundation for cultivating new sweet potato varieties with different starch contents.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides the use of the IbARF1 gene in any of the following:
[0007] (1) Application in regulating sweet potato starch synthesis;
[0008] (2) Application in regulating the amylose content of sweet potatoes;
[0009] (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes;
[0010] (4) Application in cultivating sweet potatoes with different starch contents;
[0011] Wherein, the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No.2.
[0012] The nucleotide sequence of the IbARF1 gene of the present invention is not limited to the sequence shown in SEQ ID No. 2, and may also have 75% or more identity with the nucleotide sequence shown in SEQ ID No. 2.
[0013] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to the nucleotide sequence of the present invention as set forth in SEQ ID No. 2. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.
[0014] The aforementioned 75% or greater identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
[0015] The present invention also provides the use of IbARF1 protein in any of the following:
[0016] (1) Application in regulating sweet potato starch synthesis;
[0017] (2) Application in regulating the amylose content of sweet potatoes;
[0018] (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes;
[0019] (4) Application in cultivating sweet potatoes with different starch contents;
[0020] Wherein, the amino acid sequence of the IbARF1 protein is shown as SEQ ID No.1.
[0021] The amino acid sequence of the IbARF1 protein of the present invention is not limited to (1) the sequence shown in SEQ ID No. 1, but can also be (2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 1 after one or more amino acid residues are substituted and / or deleted and / or added; or (3) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the above sequence (1) or (2).
[0022] The IbARF1 protein in (2) above is a protein having an amino acid sequence identity of 75% or more to the protein represented by SEQ ID No. 1 and having the same function. Identity refers to amino acid sequence identity. The identity of amino acid sequences can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, a search can be performed to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained. The 75% or greater identity is 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
[0023] The IbARF1 protein in (2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.
[0024] The gene encoding the IbARF1 protein in (2) above can be obtained by deleting one or more amino acid residue codons from the DNA sequence shown in SEQ ID No. 2, and / or performing one or more base pair missense mutations, and / or attaching a tag coding sequence to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 2 encodes the IbARF1 protein shown in SEQ ID No. 1.
[0025] The tag mentioned in (3) above can be a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.
[0026] The present invention also provides use of a recombinant vector comprising the IbARF1 gene in any of the following:
[0027] (1) Application in regulating sweet potato starch synthesis;
[0028] (2) Application in regulating the amylose content of sweet potatoes;
[0029] (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes;
[0030] (4) Application in cultivating sweet potatoes with different starch contents;
[0031] The recombinant vector is constructed by connecting the IbARF1 gene and the expression vector, and the nucleotide sequence of the IbARF1 gene is shown in SEQ ID No. 2.
[0032] The present invention also provides the use of a host bacterium comprising the recombinant vector in any of the following:
[0033] (1) Application in regulating sweet potato starch synthesis;
[0034] (2) Application in regulating the amylose content of sweet potatoes;
[0035] (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes;
[0036] (4) Application in cultivating sweet potatoes with different starch contents.
[0037] Preferably, the IbARF1 gene is overexpressed in sweet potato to reduce the total starch and / or amylose content in the sweet potato; and the IbARF1 gene expression is interfered with in sweet potato to increase the total starch and / or amylose content in the sweet potato.
[0038] The present invention also provides a method for increasing the total starch and / or amylose content in sweet potatoes, comprising the step of interfering with the expression of the IbARF1 gene in the sweet potatoes, wherein the nucleotide sequence of the IbARF1 gene is shown in SEQ ID No. 2. Interference methods include, but are not limited to, reducing the expression of the IbARF1 gene or reducing the content or activity of the IbARF1 protein.
[0039] The present invention also provides a method for reducing the total starch and / or amylose content in sweet potatoes, comprising the step of overexpressing the IbARF1 gene in the sweet potatoes, wherein the nucleotide sequence of the IbARF1 gene is shown in SEQ ID No. 2. Overexpression methods include, but are not limited to, increasing the expression of the IbARF1 gene or increasing the content or activity of the IbARF1 protein.
[0040] The present invention also provides a method for cultivating sweet potatoes with high total starch and / or amylose content, comprising the steps of interfering with the expression of the IbARF1 gene in the sweet potatoes to obtain sweet potatoes with high total starch and / or amylose content. The nucleotide sequence of the IbARF1 gene is shown in SEQ ID No. 2.
[0041] The present invention also provides a method for cultivating sweet potatoes with low total starch and / or amylose content, comprising the steps of overexpressing the IbARF1 gene in the sweet potatoes to obtain sweet potatoes with low total starch and / or amylose content, wherein the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No. 2.
[0042] The present invention discloses the following technical effects:
[0043] By overexpressing the IbARF1 gene in sweet potatoes, the present invention discovered that the roots of transgenic sweet potatoes overexpressing IbARF1 had lower total starch and amylose contents, while transgenic plants in which IbARF1 expression was disrupted had higher starch and amylose contents in their roots. This indicates that the IbARF1 gene can regulate not only the total starch content but also the amylose content in sweet potatoes. The present invention utilizes this gene to regulate the total starch content, amylose content, or the amylose-to-amylopectin ratio in sweet potatoes, providing a new gene and method for cultivating new sweet potato varieties with varying starch contents. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0045] Figure 1 The results of electrophoresis detection are as follows; A is the electrophoresis detection result of the sweet potato pseudo-transgenic plants transformed with Super1300-IbARF1-MYC, lane M shows the Maker band, lane W shows the band of the negative control (water); lane P shows the band of the positive control (recombinant plasmid Super1300-IbARF1-MYC); lane WT shows the band of the sweet potato chestnut-scented plant; OE1-OE9 are the bands of the plant overexpressing IbARF1; B is the electrophoresis detection result of the sweet potato pseudo-transgenic plants transformed with pFGC5941-IbARF1, lane M shows the band of the positive control (recombinant plasmid Super1300-IbARF1-MYC); lane WT shows the band of the sweet potato chestnut-scented plant; OE1-OE9 are the bands of the plant overexpressing IbARF1; Lane W shows the band of the negative control (water); Lane P shows the band of the positive control (recombinant plasmid pFGC5941-IbARF1); Lane WT shows the band of the sweet potato Lizixiang plant; Ri1-Ri7 are the bands of the plants interfering with IbARF1 expression; C is the statistical result of the IbARF1 gene expression in the sweet potato pseudo-transgenic plants transformed with Super1300-IbARF1-MYC, and D is the statistical result of the IbARF1 gene expression in the sweet potato pseudo-transgenic plants transformed with pFGC5941-IbARF1;
[0046] Figure 2 These are the test results of total starch content (A) and amylose content (B) in IbARF1 transgenic sweet potato root tubers. DETAILED DESCRIPTION
[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0048] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0049] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0050] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0051] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0052] The sweet potato variety Nongda 98 (ND98) in the following examples is recorded in the following document: He Shaozhen. In vitro screening of salt-tolerant sweet potato mutants and cloning of salt-tolerant candidate genes [D]. Doctoral dissertation of China Agricultural University, 2008. The public can obtain it from the Sweet Potato Genetics and Breeding Laboratory of China Agricultural University to repeat this experiment.
[0053] The LB solid / liquid medium, MS solid / liquid medium, and 2,4-D medium in the following examples are all described in the following literature: Zhang Huan. Transcriptome Analysis of Salt Tolerance in Sweet Potato and Cloning and Functional Verification of Stress Resistance-Related Genes IbBBX24 and IbCPK28 [D]. PhD Dissertation, China Agricultural University, 2017.
[0054] The pMD19-T vector in the following examples is a product of Takara Biotechnology (Dalian) Co., Ltd., with a catalog number of 6013. The Super1300 vector is a product of Cambia Co., Ltd.
[0055] The plant starch content test kits used in this experiment were purchased from Suzhou Keming Biotechnology Co., Ltd., and the product catalog numbers are CPL-2-G.
[0056] Example 1 Application of IbARF1 Protein in Regulating Sweet Potato Starch Synthesis
[0057] 1. Construction of plant overexpression vector
[0058] Based on the sweet potato IbARF1 protein nucleotide coding sequence (SEQ ID No. 2), primer sequences were designed to amplify the complete coding sequence (CDS). The forward and reverse primers introduced PstI and SpeI restriction sites, respectively. The primer sequences are as follows:
[0059] IbARF1-F-PstI (SEQ ID No.3): 5'-TACGAATTCGAGCTC GGTACC ATGGCTCACGTTGTGGCA-3' (the underlined part is the PstI restriction site);
[0060] IbARF1-R-SpeI (SEQ ID No. 4): 5'-CTTGCATGCCTGCAG GTCGAC CTACCTTGAAACGCTTTGCTTG-3' (the underlined part is the SpeI restriction enzyme cleavage site).
[0061] Using the artificially synthesized double-stranded DNA molecule shown in SEQ ID No. 2 as a template, after PCR amplification, the product was ligated into the pMD19-T vector to obtain a recombinant vector named pMD-IbARF1. M13-F / R sequencing was performed to ensure the correct reading frame and restriction enzyme cleavage sites of the sweet potato IbARF1 protein nucleotides.
[0062] M13-F (SEQ ID No.5): 5'-GTAAAACGACGGCCAGT-3',
[0063] M13-R (SEQ ID No. 6): 5'-CAGGAAACAGCTATGAC-3'.
[0064] The recombinant vector pMD-IbARF1 was double-digested with restriction endonucleases PstI and SpeI to recover a DNA fragment 1 of approximately 1638 bp.
[0065] The Super1300-MYC vector was double-digested with PstI and SpeI to recover the large vector fragment, which was then ligated with DNA fragment 1 to generate the recombinant vector Super1300-IbARF1-MYC, the target plasmid. The target plasmid was transformed into Escherichia coli DH5α and cultured at 37°C for 20 hours. The recombinant vector was analyzed by PCR, digested with enzymes, and verified by sequencing. Sequencing results revealed that the sequence shown in SEQ ID No. 2 was inserted between the PstI and SpeI restriction sites of the Super1300-MYC vector, confirming that the recombinant vector was constructed correctly.
[0066] The recombinant vector Super1300-IbARF1-MYC is a recombinant expression vector obtained by replacing the fragment (small fragment) between the PstI and SpeI recognition sites of the Super1300-MYC vector with the DNA fragment with the nucleotide sequence of SEQ ID No. 2 in the sequence listing, while maintaining the other sequences of the Super1300-MYC vector unchanged. The recombinant vector Super1300-IbARF1-MYC expresses the IbARF1 protein set forth in SEQ ID No. 1.
[0067] The recombinant vector Super1300-IbARF1-MYC has an expression cassette, and the nucleotide sequence of the expression cassette includes a CaMV35S promoter, a gene encoding IbARF1 protein and a NOS terminator.
[0068] A double-stranded DNA molecule with the nucleotide sequence shown in SEQ ID No. 2 was artificially synthesized. Using this double-stranded DNA molecule as a template, the sequence from positions 1 to 159 in SEQ ID No. 2 was selected as an interference sequence. PCR amplification was performed using primers pFGC5941-IbARF1-UF and pFGC5941-IbARF1-UR to obtain DNA fragment B. The primer sequences are as follows:
[0069] pFGC5941-IbARF1-UF (SEQ ID No. 7): 5'-TTGGAGAGGACACG CTCGAG TGGCATACAGTGAGGATGGTTC-3′ (underlined is the recognition sequence of restriction endonuclease XhoI);
[0070] pFGC5941-IbARF1-UR (SEQ ID No. 8): 5'-AAGAAATTCTTACAC ATTTAAAT GGTTGAGGTGCAGTAAGAGAAGT-3′ (the underline is the recognition sequence of the restriction endonuclease Swa I).
[0071] The vector pFGC5941 was double-digested with restriction endonucleases Xho I and Swa I to recover the approximately 10 kb vector backbone 1. DNA fragment B was ligated to vector backbone 1 using a homologous recombinase to obtain the recombinant vector pFGC5941-U.
[0072] A double-stranded DNA molecule with the nucleotide sequence shown in SEQ ID No. 2 was artificially synthesized. Using this double-stranded DNA molecule as a template, positions 1-159 of SEQ ID No. 2 were selected as the interfering sequence. PCR amplification was performed using primers pFGC5941-IbARF1-DF and pFGC5941-IbARF1-DR to obtain DNA fragment C. The primer sequences are as follows:
[0073] pFGC5941-IbARF1-DF (SEQ ID No. 9): 5′-AATTTGCAGGTATTTGGATCCTGGCATACAGTGAGGATGGTTC-3′ (the underlined sequence is the recognition sequence for the restriction endonuclease Bam HI);
[0074] pFGC5941-IbARF1-DR (SEQ ID No. 10): 5′-GGTCTTAATTAACTCTCTAGAGGTTGAGGTGCAGTAAGAGAAGT-3′ (the recognition sequence for restriction endonuclease Xba I is underlined).
[0075] The recombinant vector pFGC5941-U was double-digested with restriction endonucleases Bam HI and Xba I to recover the approximately 10 kb vector backbone 2. Fragment C was ligated to the vector backbone 2 using a homologous recombinase to obtain the recombinant vector pFGC5941-IbARF1.
[0076] According to the sequencing results, pFGC5941-IbARF1 is a recombinant vector obtained by replacing the small fragment between the restriction endonuclease Xho I and SwaI recognition sequences of the vector pFGC5941 with positions 1285-1472 of SEQ ID No. 2, and replacing the small fragment between the restriction endonuclease Bam HI and XbaI recognition sequences with the reverse complementary sequence of positions 1285-1472 of SEQ ID No. 2.
[0077] 2. Transformation of plant expression vector into Agrobacterium
[0078] (1) Thaw Agrobacterium tumefaciens EHA105 competent cells on ice, add 2 μg of extracted Super1300-IbARF1-MYC and pFGC5941-IbARF1 plasmids, flick the tube wall to mix, and incubate on ice for 10 min;
[0079] (2) Quick freezing in liquid nitrogen for 5 min, 37°C water bath for 10 min, and ice bath for 5 min;
[0080] (3) Add 600 μL of liquid LB medium and incubate at 28°C, 200 rpm for 5 h;
[0081] (4) Spread 200 μL of bacterial solution on LB solid medium containing 100 μg / mL kanamycin and 100 μg / mL rifampicin;
[0082] (5) Incubate the cells in the dark at 28°C for 2 days. Take an appropriate amount of Agrobacterium and culture it in liquid LB medium for later use. This will yield Agrobacterium culture fluid containing the Super1300-IbARF1-MYC vector and the pFGC5941-IbARF1 vector. The recombinant Agrobacterium will be named EHA105 / Super1300-IbARF1 and EHA105 / pFGC5941-IbARF1.
[0083] 3. Genetic transformation, regeneration and identification of transgenic plants of sweet potato
[0084] 3.1 Use Agrobacterium-mediated method to introduce EHA105 / Super1300-IbARF1-MYC and EHA105 / pFGC5941-IbARF1 into the sweet potato variety Lizixiang. The specific method is as follows:
[0085] (1) The stem apical meristem of the sweet potato variety Lizixiang was peeled off and placed on MS solid medium containing 2.0 mg / L 2,4-D. The culture was carried out at 27 ± 1°C for 8 weeks to obtain embryonic callus.
[0086] (2) The embryonic callus was placed in MS liquid medium containing 2.0 mg / L 2,4-D and cultured on a shaker for 8 weeks to obtain embryonic cell clusters with a diameter of 0.7-1.3 mm;
[0087] (3) Screening the embryonic cell clusters through a 20-mesh sieve, transferring the larger cell clusters to a 30-mesh sieve, and gently grinding them to create wounds in the embryonic cell clusters. The ground larger embryonic cell clusters were shaken and cultured for 3 days;
[0088] (4) Using the Agrobacterium-mediated method, the embryonic cell clusters transformed with EHA105 / Super1300-IbARF1-MYC and EHA105 / pFGC5941-IbARF1 were placed on a co-culture medium (MS solid medium containing 30 mg / L LAS and 2.0 mg / L 2,4-D) and cultured in the dark at 28°C for 3 days;
[0089] (5) The embryonic cell mass was washed once in MS liquid medium containing 400 mg / L cefotaxime sodium (CS) and 2.0 mg / L 2,4-D, and then cultured with shaking in MS liquid medium containing 2.0 mg / L 2,4-D for 1 week;
[0090] (6) Place the embryonic cell mass on a screening medium (MS solid medium containing 100 mg / L CS, 5 mg / L hygromycin (Hyg), and 2.0 mg / L 2,4-D) and culture in the dark at 28°C for 10-12 weeks, with the medium changed every two weeks;
[0091] (7) The embryonic cell mass was placed on a somatic embryo induction medium (MS solid medium containing 100 mg / L CS and 1.0 mg / L ABA) and cultured at 28°C with alternating light and dark conditions for 2-4 weeks to obtain resistant callus tissue;
[0092] (8) The resistant callus was placed on MS solid culture medium and cultured at 28°C with alternating light and dark conditions for 4-8 weeks to obtain 9 transgenic plants to be identified (presumed transgenic plants), which were named OE1, OE2, OE3, OE5, OE4, OE6, OE7, OE9 and Ri1, Ri2, Ri3, Ri4, Ri5, Ri6 and Ri7, respectively.
[0093] (9) The genomic DNA of the leaves of the proposed transgenic plants was extracted using the CTAB method. The extracted genomic DNA was used as a template, water and wild-type plants (Lizixiang) were used as negative controls, and plasmid Super1300-IbARF1-MYC was used as a positive control. PCR amplification was performed using Super1300-F (5'-GACGCCATTTCGCCTTTTCAG-3', SEQ ID No. 11) and IbARF1-RR-SpeI (5'-CCTTGAAACGCTTTGCTTG-3', SEQ ID No. 12) as primers to obtain a PCR amplification product. If the PCR amplification product contains a band of about 1035 bp, the corresponding transgenic sweet potato plant to be identified is a transgenic sweet potato positive plant. The primers for identifying interference expression were pFGC5941-UF (5'-GAAGACGTTCCAACCACGTC-3', SEQ ID No. 13) and pFGC5941-R (5'-GGTTGAGGTGCAGTAAGAGAAGT-3', SEQ ID No. 14).
[0094] The results of electrophoresis detection amplification are shown in Figure 1 . Figure 1 Middle A shows that lanes OE1, OE2, OE3, OE4, OE5, OE6, OE7, OE8, and OE9 are bands of the transgenic sweet potato plants transformed with Super1300-IbARF1-MYC, and a target band of 1035 bp was amplified in all lanes and the positive control; Figure 1 Middle B shows that lanes Ri1, Ri2, Ri3, Ri4, Ri5, Ri6, and Ri7 show bands of the transgenic sweet potato plants transformed with pFGC5941-IbARF1, which show a bright band at around 367 bp, the size of which is consistent with the positive control, indicating that the IbARF1 gene has been integrated into the genome of the sweet potato Lizixiang plant.
[0095] 3.2 Detection of RNA levels using qRT-PCR
[0096] RNA was extracted from positive sweet potato plants and reverse transcribed to obtain cDNA for qRT-PCR, using the wild-type sweet potato Lizixiang as a control and the sweet potato IbActin gene as an internal reference. The primers used are as follows:
[0097] IbActin-F (SEQ ID No. 15): 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′;
[0098] IbActin-R (SEQ ID No. 16): 5′-GGAAAATTAGAAGCACTTCCTGTGAAC-3′.
[0099] IbARF1-F (SEQ ID No. 17): 5′-GGTTGGATCAGCAGCTTCCTTCATT-3′;
[0100] IbARF1-R (SEQ ID No. 18): 5′-TGTCTCAGGTTCAGCCCGAAGAA-3′.
[0101] See the results Figure 1 Middle C, the results showed that the expression levels of IbARF1 in the transgenic sweet potato plants (OE1-OE9) transformed with Super1300-IbARF1-MYC were higher than those in the wild-type plants, among which OE1, OE2, OE3 and OE9 showed significant differences, indicating that the IbARF1 gene was successfully overexpressed in sweet potato. Figure 1 Middle D shows that the expression levels of IbARF1 in the transgenic sweet potato plants (Ri1-Ri7) transformed with pFGC5941-IbARF1 were all lower than those in the wild-type plants, among which Ri1, Ri2, Ri3, Ri6 and Ri7 showed significant differences, indicating that the expression of the sweet potato IbARF1 gene was successfully interfered with.
[0102] The above results indicate that these regenerated plants are transgenic positive plants. The transgenic positive sweet potato plants were propagated by asexual reproduction, and the plants propagated from one transgenic seedling were used as a line for further candidate experiments.
[0103] 4. Determination and observation of starch content in tubers of transgenic plants
[0104] Determination of starch content in root tubers of IbARF1 transgenic sweet potatoes The sweet potatoes tested included wild-type Lizixiang (WT), and transgenic sweet potato lines OE1, OE2, Ri2, and Ri3.
[0105] 4.1 Determination of total starch content in IbARF1 transgenic sweet potato roots
[0106] The starch content in the tubers of sweet potato plants was measured using a starch content test kit (Suzhou Keming Biotechnology Co., Ltd., DF-2-Y). Transgenic plants OE1, OE2, Ri2, and Ri3, which had been isolated in the field for 120 days, were selected. Fresh tubers of sweet potato plants were compared with those of wild-type plants. The results are shown in Figure 2. Figure 2 As shown in A, the starch content of sweet potato tubers with IbARF1 gene interference increased by 11.64-18.85% compared with the wild type, and the starch content of sweet potato tubers with IbARF1 gene overexpression decreased by 10.16-14.07% compared with the wild type.
[0107] 4.2 Determination of Amylose in IbARF1 Transgenic Sweet Potato Roots
[0108] The amylose content test kit (ZDF-2-Y, Suzhou Keming Biotechnology Co., Ltd.) was used to test the amylose content of the transgenic plants OE1, OE2, Ri2 and Ri3 grown in the field for 120 days. Figure 2 As shown in B, the amylose content in the sweet potato tubers with IbARF1 gene interference increased by 1.3-2.11% compared with the wild-type plants, while the amylose content in the sweet potato tubers with IbARF1 gene overexpression decreased by 0.62-3.61% compared with the wild-type plants.
[0109] IbARF1 protein sequence (SEQ ID No. 1):
[0110] .
[0111] IbARF1 gene sequence (SEQ ID No. 2):
[0112] ATGGCTCACGTTGTGGCAAATCAGTTTAATAAAGGAGCTTATCCAGCTTCTCCACATGATCCTTTGTACAAGGAACTCTGGCATGCTTGTGCTGGACCACTTGTGACACTTCCAAGGGAAGGAGAAAGGGTTTATTATTTTCCACAAGGTCATATGGAACAGCTTGAAGCATCCACCCATCAGGGGTTGGATCAGCAGCTTCCTTCATTTAACTTACCAGCTAAGATTCTGTGCAAAGTTATGAATGTTTTTCTTCGGGCTGAACCTGAGACAGATGAGGTGTATGCTCAAGTAACTCTGCTTCCTGAACCAGAGCACAGTGAGGTCACAAGCCCTGATCCTCCTCTCCCTGAACCAGAACAATGTAATGTCCATTCATTTTGCAAGACACTCACTGCATCTGATACAAGCACCCATGGTGGATTCTCTGTTCTTCGGCGGCATGCAGATGAGTGTTTGCCCCCACTGGATATGTCACAACAGCCACCGTGGCAGGAATTGGTTTCTACGGATCTTCATGGCAATGAATGGCATTTTCGCCACATTTTCCGAGGTCAACCTAAGCGCCACTTGCTCACAACAGGGTGGAGTGTTTTTGTTAGTGCGAAGAAATTGGTTGCTGGAGATGCTTTCATCTTCCTCAGGGGGGAAAA。
[0113] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Use of the IbARF1 gene in any of the following: (1) Application in regulating sweet potato starch synthesis; (2) Application in regulating the amylose content of sweet potatoes; (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes; (4) Application in cultivating sweet potatoes with different starch contents; in, The nucleotide sequence of the IbARF1 gene is shown in SEQ ID No.
2.
2. Use of IbARF1 protein in any of the following: (1) Application in regulating sweet potato starch synthesis; (2) Application in regulating the amylose content of sweet potatoes; (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes; (4) Application in cultivating sweet potatoes with different starch contents; in, The amino acid sequence of the IbARF1 protein is shown in SEQ ID No.
1.
3. Use of a recombinant vector comprising the IbARF1 gene in any of the following: (1) Application in regulating sweet potato starch synthesis; (2) Application in regulating the amylose content of sweet potatoes; (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes; (4) Application in cultivating sweet potatoes with different starch contents; in, The recombinant vector is constructed by connecting the IbARF1 gene and the expression vector. The nucleotide sequence of the IbARF1 gene is shown in SEQ ID No.
2.
4. Use of a host bacterium comprising the recombinant vector according to claim 3 in any of the following: (1) Application in regulating sweet potato starch synthesis; (2) Application in regulating the amylose content of sweet potatoes; (3) Application in regulating the ratio of amylose to amylopectin in sweet potatoes; (4) Application in cultivating sweet potatoes with different starch contents.
5. The use according to any one of claims 1 to 4, characterized in that The IbARF1 gene is overexpressed in the sweet potato to reduce the content of total starch and / or amylose in the sweet potato; and the expression of the IbARF1 gene is interfered with in the sweet potato to increase the content of total starch and / or amylose in the sweet potato.
6. A method for increasing the total starch and / or amylose content in sweet potatoes, characterized in that: The method comprises the step of interfering with the expression of the IbARF1 gene in sweet potato, wherein the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No.
2.
7. A method for reducing the total starch and / or amylose content in sweet potatoes, characterized in that: The method comprises the step of overexpressing the IbARF1 gene in sweet potato, wherein the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No.
2.
8. A method for cultivating sweet potatoes with high total starch and / or amylose content, characterized in that: The method comprises the steps of interfering with the expression of IbARF1 gene in sweet potato to obtain sweet potato with high total starch and / or amylose content, wherein the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No.
2.
9. A method for cultivating sweet potatoes with low total starch and / or amylose content, characterized in that: The method comprises the steps of overexpressing the IbARF1 gene in sweet potatoes to obtain sweet potatoes with low total starch and / or amylose content, wherein the nucleotide sequence of the IbARF1 gene is shown as SEQ ID No. 2.