Efficient sweet potato transgenic method based on visual marker and reagent combination

Abstract

The invention relates to the technical field of biology, in particular to an efficient sweet potato transgenic method based on a visual marker and a reagent combination. According to the method, an RUBY visual marking system is combined with an optimized infection solution formula, an optimized hydroponic solution formula and a visual plant hydroponic device, and the sweet potato adventitious roots are rapidly induced by adopting a CID method under the non-tissue culture condition. According to the method, naked eye recognition of the transgenic adventitious roots can be realized without chemical treatment or special equipment. The induction time of the sweet potato adventitious roots is remarkably shortened, and the induction efficiency and the detection convenience of the sweet potato transgenic adventitious roots are improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a high-efficiency sweet potato transgenic method based on visual markers and a reagent combination. Background Art

[0002] Sweet potato (Ipomoea batatas L.), the world's sixth-largest staple food crop, is rich in starch, dietary fiber, carotenoids, anthocyanins, vitamins, and various beneficial fatty acids, making it a vital contributor to human diets and regional food security. However, as an allohexaploid crop, sweet potato has a complex genetic background, characterized by high male sterility, self-incompatibility, and a scarcity of germplasm resources. Furthermore, global extreme climate conditions exacerbate disease burdens, severely restricting conventional breeding efforts and posing a significant threat to the sustainable development of the sweet potato industry and food security. Therefore, establishing an efficient and stable sweet potato genetic transformation system is crucial for discovering superior gene functions and promoting transgenic breeding.

[0003] Currently, sweet potato genetic transformation primarily utilizes biolistic methods, electroporation, and Agrobacterium-mediated transformation. Agrobacterium-mediated transformation is the most commonly used method. This involves infecting sweet potato explants (stem segments, leaves) with Agrobacterium tumefaciens containing a plant expression vector and inducing callus formation during the transformation period. This introduces foreign genes into the sweet potato genome, and tissue culture is then used to induce the callus to regenerate plants. However, this method suffers from issues such as strong genotype dependence, demanding culture conditions, and low transformation efficiency. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to overcome the technical defects of the existing sweet potato genetic transformation, such as low transformation efficiency, long induction cycle, and dependence on tissue culture conditions and detection equipment, and to provide an efficient sweet potato transgenic method and reagent combination based on visual markers.

[0005] The present invention provides a reagent combination for inducing and culturing transgenic sweet potato adventitious roots, comprising an infection solution and a hydroponic solution, wherein:

[0006] The infection solution is 1 / 4 MS liquid medium with a pH of 5-6, containing 0.1%-0.5% (w / v) sucrose, 20-200 μM acetosyringone, and 0.01%-0.03% Silwet L-77 (v / v);

[0007] The hydroponic solution is a Hoagland nutrient solution with a pH of 5-6 and containing 0.5-1 mg / L NAA, 0.1-0.2 mg / L 6-BA, and 0.1%-0.5% (w / v) sucrose. The concentration of the Hoagland nutrient solution is 25%, 50%, or 100%.

[0008] Compared with existing technologies, the reagent combination provided by this invention promotes Vir gene expression in Agrobacterium by optimizing the acetosyringone (20-200 μM) in the infection solution, synergistically enhances cell membrane permeability with Silwet L-77 (0.01-0.03%), and regulates cell dedifferentiation by combining the hormone ratio of NAA (0.5-1 mg / L) and 6-BA (0.1-0.2 mg / L) in the hydroponic solution. This increases the efficiency of transgenic adventitious root induction to 96.3% and the transformation efficiency to 93.5%. The induction period is shortened to 10-14 days.

[0009] In some embodiments, the infection solution is 1 / 4 MS liquid medium with a pH of 5.6, comprising 0.1% (w / v) sucrose, 150 μM acetosyringone, and 0.02% Silwet L-77 (v / v);

[0010] The hydroponic solution is a 50% Hoagland nutrient solution with a pH of 5.8-6 and containing 0.5 mg / L NAA, 0.1 mg / L 6-BA, and 0.1% (w / v) sucrose.

[0011] Experimental verification shows that, under the above-mentioned concentrations and components, the reagent combination provided by the present invention has the strongest compatibility among the components, synergistically enhancing their effectiveness and complementing each other to achieve the induction and cultivation of transgenic adventitious roots of sweet potatoes, which can maximize the efficiency of transgenic growth and thus obtain more accurate technical effects.

[0012] The present invention provides a method for inducing and culturing transgenic sweet potato adventitious roots, comprising the following steps:

[0013] Step 1: construct an expression vector containing the target gene, transform the competent Agrobacterium, screen and identify it, and obtain transgenic Agrobacterium rhizogenes containing the target gene;

[0014] Step 2: Take the transgenic Agrobacterium rhizogenes described in step 1, and resuspend the bacteria in the infection solution in the reagent combination to obtain an infection solution;

[0015] Step 3, injecting the infectious bacterial solution described in step 2 into the internodes of the stem segments of the sweet potato seedlings from which adventitious roots have been removed, and co-culturing the injected sweet potato seedlings with the infectious bacterial solution;

[0016] Step 4: taking the sweet potato seedlings co-cultivated in step 3, and culturing them with the hydroponic solution in the reagent combination to obtain transgenic sweet potato adventitious roots.

[0017] In some embodiments, in step 1,

[0018] The target gene includes the RUBY gene, and the competent Agrobacterium includes at least one of Agrobacterium MSU440, Agrobacterium C58C1 and Agrobacterium K599.

[0019] This invention combines the RUBY visual marker with hydroponics for the first time in sweet potato cultivation. It innovatively proposes a CID (cut-inject-dip) method mediated by Agrobacterium rhizogenes, constructing and optimizing a sweet potato genetic transformation system. This system introduces a RUBY-marked vector into sweet potatoes using CID without tissue culture. This method enables visual identification of transgenic adventitious roots without the need for chemical treatment or specialized equipment, significantly improving transformation efficiency and detection speed. This invention provides innovative technical support for sweet potato gene function research and transgenic breeding, and has significant scientific significance and application value.

[0020] In some specific embodiments, the competent Agrobacterium is at least one of Agrobacterium K599

[0021] In some embodiments, in step 2, the OD of the infected bacterial solution is 600 The value is 0.4~1.0.

[0022] In some embodiments, the OD of the infection solution is 600 The value is 0.8.

[0023] In some embodiments, in step 3, the method for preparing sweet potato seedlings with adventitious roots removed comprises: taking seedlings germinated from tuberous roots of sweet potato, removing leaves and petioles at 3 to 5 stem nodes at the base of the seedlings using a sterile knife, removing adventitious roots on the plants and exposing the root base, and obtaining sweet potato seedlings with adventitious roots removed;

[0024] The sweet potato varieties include at least one of Fushu 18, Gaoxi 14 and Haida 7798.

[0025] In some specific embodiments, the sweet potato variety is Haida 7798.

[0026] In some embodiments, in step 3,

[0027] The injection depth is 1-2 mm, the injection angle is 45 degrees upward from the horizontal, and the co-culture time is 1-3 h;

[0028] After the co-cultivation, the method further comprises washing the sweet potato seedlings with sterile water containing 200 mg / L cephalosporin for 5 to 15 minutes, and then washing the stem segments with distilled water for 2 to 5 times.

[0029] In some specific embodiments, the co-cultivation time is 2 hours, and after the co-cultivation, the sweet potato seedlings are rinsed with sterile water containing 200 mg / L cephalosporin for 10 minutes, and then the stem segments are rinsed twice with distilled water.

[0030] In some embodiments, in step 4, the culturing includes dark culturing and photoperiod culturing, the sweet potato seedlings are dark cultured for 1 to 3 days and then photoperiod cultured for 7 to 21 days, and during the photoperiod culture, the hydroponic solution is replaced every 7 days;

[0031] The temperature of the photoperiodic culture is 25-28° C., the light intensity is 200 μmol m-2 s-1, and the light duration is 10-14 hours per day.

[0032] In some specific embodiments, the dark culture time is 2 days, the photoperiodic culture time is 14 days, the photoperiodic culture temperature is 28° C., and the light exposure time is 10 hours per day.

[0033] In some embodiments, in step 4, the culture device comprises:

[0034] The hydroponic box is made of a light-transmitting material and has a rectangular box structure with an open top. The hydroponic solution is loaded in the hydroponic box;

[0035] A partition plate is fixedly arranged inside the hydroponic box and is arranged near the bottom of the hydroponic box. The partition plate is evenly provided with a plurality of fixing holes, and the fixing holes are used to fix the stem segments of the sweet potato seedlings. The roots of the sweet potato seedlings are immersed in the hydroponic solution for cultivation;

[0036] A ventilation and moisturizing cover is made of a light-transmitting material and is fixedly mounted on the top opening of the hydroponic box. The top is provided with a plurality of ventilation holes and an LED light is installed on the ventilation and moisturizing cover.

[0037] An aeration device is used for releasing microbubbles to increase the dissolved oxygen content of the hydroponic solution in the hydroponic box (10), comprising an air pump, a ventilation pipe and an aeration stone. The air pump is fixedly arranged on the outer side of the hydroponic box, the aeration stone is arranged in the hydroponic box and located below the partition plate, and the two ends of the ventilation pipe are respectively connected to the air pump and the aeration stone.

[0038] In some embodiments, a height-adjustable bracket is further included, and the bracket includes a support plate, a fixing rod, a sleeve and a base plate. One end of the fixing rod is fixed to the bottom of the support plate, and one end of the sleeve is fixed to the top of the base plate. The sleeve is sleeved outside the fixing rod and is fastened to the fixing rod by bolts. The hydroponic box is placed on the top of the support plate.

[0039] In some embodiments, a limiting groove adapted to the shape and size of the hydroponic box is provided on the top of the support plate, and the hydroponic box is fixed to the support plate by the limiting groove.

[0040] In some embodiments, a base is fixedly mounted on the bottom of the base plate, a bubble level is mounted in the center of the base, and the base is further provided with a horizontal calibration component, which includes adjustment feet threadedly connected to the four corners of the base.

[0041] In some embodiments, a base is installed at the bottom of the bottom plate, a universal wheel with a brake is installed at the bottom of the base, and the base is also provided with adjustable supporting feet, and the supporting feet are threadedly connected to the base through screws.

[0042] In some embodiments, mounting blocks are fixedly provided on two opposite side walls inside the hydroponic box, and a slot is provided on the side where the two mounting blocks are close to each other, and the two sides of the partition plate are respectively held in the two slots.

[0043] In some embodiments, the fixing holes are distributed in a rectangular array on the partition plate.

[0044] In some embodiments, the ventilation and moisturizing cover is made of highly light-transmitting acrylic material, and the ventilation and moisturizing cover is connected to the hydroponic box via a sealing strip.

[0045] In some embodiments, a water outlet is provided at the bottom of the hydroponic box, and a sealing plug is threadedly connected to the water outlet.

[0046] In some embodiments, the method further includes PCR detection of transgenic adventitious roots: extracting adventitious root DNA, and then performing PCR identification, wherein the identified genes include the target gene and the reporter gene in the expression vector.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] 1. The present invention utilizes the RUBY visual marking system, which uses betalain to develop color, to achieve naked-eye identification of transgenic sweet potato adventitious roots, significantly reducing the detection cycle and cost;

[0049] 2. The existing sweet potato infection method mainly relies on bacterial liquid infection. The original culture medium contains antibiotics and metabolic byproducts, which may inhibit the activity of Agrobacterium or damage plant cells. The present invention proposes and optimizes the infection liquid formula, which significantly improves the induction efficiency of adventitious roots by removing inhibitory components and adding auxiliary agents.

[0050] 3. The existing adventitious root induction is carried out by placing the explant in moist vermiculite. The present invention directly places the explant in an efficient hydroponic solution and a hydroponic device. The transparent hydroponic device can be used to observe the root growth and development process in real time from multiple angles, ensuring the timeliness of experimental data collection. The LED lamp is used to increase the light for the plant stem segment and the aeration device is used to increase the dissolved oxygen content of the hydroponic solution in the hydroponic box to ensure the normal growth and development of the plant. The aeration device simultaneously realizes the circulation of the hydroponic solution and the oxygen supply operation, which is simple to operate and improves the practicality and functionality of the hydroponic device.

[0051] 4. The present invention combines the RUBY visual marker system with optimized infection solution formulations, hydroponic solution formulations, and hydroponic equipment. Under non-tissue culture conditions, the CID method can rapidly induce sweet potato adventitious roots, eliminating the need for chemical treatment or specialized equipment, enabling naked-eye identification of transgenic adventitious roots. This increases the transgenic adventitious root induction efficiency to 96.3%, with a conversion efficiency as high as 93.5%. The induction period is shortened to 10-14 days. Identified positive adventitious roots can continue to expand, forming positive sweet potato tubers. This improves the efficiency of sweet potato genetic transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 Schematic diagram of the expression vector for sweet potato transgenic method;

[0053] Figure 2 Schematic diagram showing the operation of Agrobacterium infection of sweet potato seedlings;

[0054] Figure 3 The following are the control results of adventitious roots of two transgenic sweet potato plants in Example 1;

[0055] Figure 4 The results of the identification of transgenic adventitious roots containing the RUBY gene in Example 1 are shown, wherein lane 1 is a marker, lanes 2 to 6 represent the DNA identification results of transgenic adventitious roots stained red with RUBY, with clear bands and a target fragment of 790 bp, and lane 7 represents the DNA identification results of adventitious roots of the control group plants, with no bands;

[0056] Figure 5 Schematic diagram of the three-dimensional structure of the visualized plant hydroponic device in Example 1;

[0057] Figure 6 1. A front view of the visualized plant hydroponic device in Example 1 is shown;

[0058] Figure 7 1. A side view of the visualized plant hydroponic device in Example 1 is shown;

[0059] Figure 8 Schematic diagram showing the structure of the partition plate in the visualized plant hydroponic device in Example 1;

[0060] Figure 9 Schematic diagram of the structure of the bracket in Example 1 is shown;

[0061] Figure 10 Schematic diagram of the structure of the support plate in Example 1 is shown.

[0062] Figures 5 to 10 Reference numerals in the accompanying drawings: 10, hydroponic box; 11, partition plate; 111, fixing hole; 12, water outlet; 20, ventilation and moisturizing cover; 201, ventilation hole; 202, LED lamp; 30, vent pipe; 31, aeration stone; 40, bracket; 41, support plate; 411, limiting groove; 42, fixing rod; 43, sleeve; 44, bottom plate; 45, bolt. DETAILED DESCRIPTION

[0063] The present invention provides a highly efficient sweet potato transgenic method and reagent combination based on visual markers. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0064] Plant expression vectors typically contain a target gene, a screening gene, and a reporter gene, with the reporter gene being crucial for identifying transgenic plants. The RUBY marker, a visual reporter gene system based on the betaine biosynthesis pathway, introduces genes related to betaine biosynthesis (such as TaTYR, TaCYP76AD1, and TaDODA) to impart a ruby red color to transformed cells, enabling visual detection without complex instrumentation, providing a convenient tool for genetic transformation research. Notably, while this marker system has been successfully applied in dicotyledonous plants such as tomato and tobacco, it has rarely been reported in sweetpotato transgenic research, and its visual advantages have not yet been exploited for optimizing sweetpotato transformation systems. Furthermore, while Agrobacterium rhizogenes has the ability to induce adventitious root growth and has established an efficient genetic transformation platform in medicinal plants such as Salvia miltiorrhiza, its transformation system in sweetpotato still faces technical bottlenecks such as a long induction period (typically exceeding 30 days) and low genetic transformation efficiency.

[0065] The present invention innovatively combines the RUBY visual marking system with optimized infection solution formula, hydroponic solution formula and hydroponic device, and proposes a CID method (Cut-Inject-Dip) mediated by Agrobacterium rhizogenes. The method steps are as follows: cut stem segments from sweet potato seedlings germinated from tuberous roots, remove leaves, petioles and adventitious roots at the base of 3-5 stem nodes to expose the root base, resuspend the root-inducing Agrobacterium K599 containing the Ruby gene expression vector in infection solution (1 / 4 MS+0.1% sucrose+150 μm AS+0.02% Silwet L-77, pH 5.6) and inject into each internode, then soak the infected stem segments in the infection solution for 2 hours, and then place the stem segments in a high-efficiency hydroponic device. The hydroponic solution contains 1 / 2 Hoagland+0.5 mg / L NAA+0.1 mg / L 6-BA+0.1% sucrose (Ph=5.8-6.0). After 7 days, a large number of red transgenic adventitious roots can be induced from the root base at the base of the stem segments, which can be identified with the naked eye, and the transformation efficiency is as high as 93.5%. The present invention significantly improves the induction efficiency and detection convenience of transgenic sweet potato adventitious roots through the following innovations: The present invention constructs and optimizes the sweet potato transgenic system, providing innovative technical support for sweet potato gene function research and transgenic breeding.

[0066] The test materials used in the present invention are all common commercial products and can be purchased in the market. The present invention will be further described below with reference to the examples.

[0067] Example 1 Rapid Visualization Method for Sweet Potato Transgenic

[0068] This example provides a rapid and visual method for sweet potato transgenic transgenesis, comprising the following steps:

[0069] 1. Preparation of sweet potato plants

[0070] Wipe the surface of fresh sweet potato tubers with 75% ethanol and rinse five times with sterile water. Plant the sterilized sweet potato tubers in pots with fertile soil at a depth of 5-10 cm. After germination in 2-3 weeks, a large number of sweet potato seedlings will be obtained. Cut the stem segments (the lower cut end is about 1 cm from the internode) from the seedlings growing from the sweet potato tubers. The seedlings should be about 12 cm long and have 2-3 mature leaves. Use a sterile knife to remove the leaves and petioles at the base of the 3-5 stem nodes and any adventitious roots to expose the root base. Figure 2 )

[0071] 2. Transformation of Agrobacterium rhizogenes and activation of recombinant Agrobacterium rhizogenes

[0072] 1) Take the competent Agrobacterium rhizogenes K599 cells out of the -80°C freezer and thaw on ice.

[0073] 2) Add 1 μg of plasmid carrying the RUBY gene (pHDE, Figure 1 ), after gentle mixing, incubate on ice for 30 min;

[0074] 3) Quickly freeze the mixture in liquid nitrogen for 1 min and then transfer to a 37°C water bath and incubate for 5 min.

[0075] 4) Add 700 μL LB liquid medium, shake and culture at 28°C, 200 rpm for 2-4 hours, and centrifuge at 5000 rpm for 3 minutes;

[0076] 5) Discard the supernatant, resuspend the cells in 50 μL LB medium, spread evenly on LB plates containing 50 mg / L spectinomycin and 50 mg / L streptomycin, and incubate inverted at 28°C for 16-24 hours.

[0077] 6) After selecting a single colony, perform PCR on the bacterial solution using gene-specific primers (RUBY-F: TTGAGGTGGGCAAGAAGC and RUBY-R: CGAATGTGGAGGATGTGGTAT) to screen for positive single clones. After sequencing verification, store the clone at -80°C until use.

[0078] 7) Streak the recombinant Agrobacterium rhizogenes K599 containing the RUBY target gene onto LB plates containing 50 mg / L spectinomycin and 50 mg / L streptomycin and incubate inverted at 28°C for 48 h.

[0079] 8) Pick a single colony and inoculate it into LB liquid medium containing 50 mg / L spectinomycin and 50 mg / L streptomycin. Incubate the culture on a shaker at 220 rpm at 28°C for expansion. Add the overnight culture to fresh LB liquid medium containing 50 mg / L spectinomycin and 50 mg / L streptomycin. Incubate the culture on a shaker at 220 rpm at 28°C until the logarithmic growth phase. Centrifuge at 6000 rpm for 8 min to collect the cells and discard the supernatant.

[0080] 3. Preparation of infection solution

[0081] The collected bacteria were dissolved in 1 / 4 MS + 0.1% sucrose + 150 μm AS + 0.02% Silwet L77 (PH = 5.6) infection solution.

[0082] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0083] Inject the infection solution into the internodes of the treated sweet potato seedling stem segments. Use a syringe to inject 10-20 μL of the Agrobacterium rhizogenes infection solution horizontally and upward at a 45-degree angle into each internode. The injection depth is 1-2 mm. Insert the syringe into the lower cut end of the stem segment and inject the Agrobacterium rhizogenes infection solution into the stem. The solution will overflow from the internodes. Then, soak the infected stem segment in the infection solution for 2 hours. Afterwards, rinse the explants with sterile water containing 200 mg / L cephalosporin for 10 minutes. Finally, rinse the stem segment twice with distilled water. Infected seedlings were cultured in a visible hydroponic device (hydroponic solution formula: 1 / 2 Hoagland + 0.5 mg / L NAA + 0.1 mg / L 6-BA + 0.1% sucrose (Ph = 5.8-6.0). The culture consisted of 2 days of incubation in the dark followed by growth under a photoperiod (28°C, 10-h / 14-h light / dark cycle, light intensity ~ 200 μmol m-2 s-1). The water was changed every 7 days to prevent water contamination. After 2 weeks, the transparent transplanting cover was removed and culture continued until a large number of adventitious roots formed. Positive adventitious roots were visible to the naked eye under visible light, indicating the expression of the target gene RUBY in red. The control group consisted of uninfected wild-type sweet potato seedlings.

[0084] Among them, the visualized plant hydroponic device provided by the present invention adopts a transparent visualized hydroponic box 10 to realize the visualized monitoring of the whole process of plant root development, and meets the light and oxygen supply required for plant growth and development through LED lights 202 and aeration devices.

[0085] Please refer to Figures 5 and 6 The visualized plant hydroponic device provided by the present invention includes:

[0086] The hydroponic box 10 is made of a light-transmitting material and has a rectangular box structure with an open top. The hydroponic solution is loaded into the hydroponic box 10.

[0087] The partition plate 11 is fixedly arranged inside the hydroponic box 10 and is arranged near the bottom of the hydroponic box 10. The partition plate 11 is evenly provided with a plurality of fixing holes 111. The fixing holes 111 are used to fix the stem segments of the sweet potato seedlings. The roots of the sweet potato seedlings are immersed in the hydroponic solution for cultivation;

[0088] The ventilation and moisturizing cover 20 is made of a light-transmitting material and is fixedly mounted on the top opening of the hydroponic box 10. The top is provided with a plurality of ventilation holes 201. The ventilation and moisturizing cover 20 is equipped with an LED light 202.

[0089] The aeration device is used to release microbubbles to increase the dissolved oxygen content of the hydroponic solution in the hydroponic box 10, and includes an air pump, a ventilation pipe 30 and an aeration stone 31. The air pump is fixed to the external side of the hydroponic box 10, and the aeration stone 31 is arranged in the hydroponic box 10, below the partition plate 11. The two ends of the ventilation pipe 30 are respectively connected to the air pump and the aeration stone 31.

[0090] When the sweet potato is hydroponically cultivated, hydroponic liquid is added to the hydroponic box 10, and the sterilized sweet potato stem segment is placed in the fixing hole 111 of the partition plate 11. The fixing hole 111 serves to limit and fix the sweet potato stem segment, so that the sweet potato stem segment is half immersed in the hydroponic liquid, thereby promoting the growth of hairy roots. The ventilation and moisturizing cover 20 on the top of the hydroponic box 10 can be ventilated through the ventilation hole 201 and is also conducive to moisturizing, so that the sweet potato stem segment grows in a moist environment. The LED lamp 202 is used to increase the light for the sweet potato stem segment, and the aeration device is used to increase the dissolved oxygen content of the hydroponic liquid in the hydroponic box 10, thereby ensuring the normal growth and development of the sweet potato.

[0091] The hydroponic box 10 and the ventilation and moisturizing cover 20 are made of translucent materials, so that the hydroponic device as a whole has a transparent structure, which can observe the root growth and development process in real time from multiple angles, ensuring the timeliness of experimental data collection. The aeration device simultaneously realizes the circulation of hydroponic liquid and oxygen supply operation, simplifies the operation process, and improves the practicality and functionality of the hydroponic device.

[0092] Furthermore, to better suit sweet potato hydroponics, the volume of the hydroponic box 10 can be set to 10L, and the diameter of the fixing holes 111 can be set to 1cm. The sides of the hydroponic box 10 are marked along the height direction to directly indicate the volume of the hydroponic solution (e.g., liters or milliliters). This ensures consistent liquid volume across experiments, avoids fluctuations in experimental conditions due to volume deviations, and improves experimental repeatability. Furthermore, the scale lines on the transparent hydroponic box 10 (e.g., markings every 1cm) can assist in measuring root length. Combined with time recording, this can quantify growth rate, providing direct visualization support for scientific research data (e.g., root hair germination time and extension speed), improving data collection accuracy.

[0093] In some embodiments, please refer to Figures 5 and 6 The visualized plant hydroponic device provided by the present invention also includes a height-adjustable bracket 40, which includes a support plate 41, a fixing rod 42, a sleeve 43, and a bottom plate 44. One end of the fixing rod 42 is fixed to the bottom of the support plate 41, and one end of the sleeve 43 is fixed to the top of the bottom plate 44. The sleeve 43 is sleeved outside the fixing rod 42 and is fastened to the fixing rod 42 by a bolt 45. The hydroponic box 10 is placed on top of the support plate 41. Specifically, the bolt 45 passes through the side wall of the sleeve 43 and abuts against the fixing rod 42. This arrangement achieves the fixation of the fixing rod 42 and the sleeve 43.

[0094] The hydroponic chamber 10 is placed entirely on a support 40. The height of the support 40 can be adjusted to suit different experimental needs. The height of the support 40 can be adjusted from 30 to 80 cm. To adjust the height, first loosen the bolt 45, allowing the fixing rod 42 to slide along the sleeve 43 to change the overall height of the support 40. Once the adjustment is complete, tighten the bolt 45 to secure the fixing rod 42 and sleeve 43. This is a simple operation.

[0095] In some embodiments, please refer to Figures 9 and 10 The top of the support plate 41 is provided with a limiting groove 411 that is adapted to the shape and size of the hydroponic box 10 , and the hydroponic box 10 is fixed to the support plate 41 through the limiting groove 411 .

[0096] With this arrangement, the hydroponic box 10 is fixed and limited by the limiting groove 411, which can prevent the hydroponic box 10 from moving during the process of adjusting the height of the bracket 40, and prevent the hydroponic box 10 from moving due to accidental contact during the experiment.

[0097] In some embodiments, a base is fixedly mounted on the bottom of the base plate 44, a bubble level is mounted in the center of the base, and the base is further provided with a leveling assembly, which includes adjusting feet threadedly connected to the four corners of the base.

[0098] By observing the position of the bubble in the bubble level, the user can intuitively determine whether the hydroponic device is in a horizontal state. When the hydroponic device is in a tilted state, the hydroponic device can be horizontally calibrated by manually rotating each adjustment foot to change the height of each adjustment foot.

[0099] In other embodiments, a base is installed at the bottom of the bottom plate 44, and a universal wheel with a brake is installed at the bottom of the base. The base is also provided with adjustable supporting feet, and the supporting feet are threadedly connected to the base through screws.

[0100] Universal casters make the hydroponic device easy to move, adapting quickly to different scenarios, such as laboratories and greenhouses. Once in place, the casters are locked with brakes to prevent accidental movement from disrupting experiments or creating safety hazards. With the casters locked, the screws are rotated, moving the support legs away from the base until they touch the ground. Leveling is achieved by adjusting the height of each leg.

[0101] In some embodiments, mounting blocks are fixedly provided on two opposite side walls inside the hydroponic box 10 , and a slot is provided on the side where the two mounting blocks are close to each other, and both sides of the partition plate 11 are respectively held in the two slots.

[0102] With such arrangement, the partition plate 11 is mounted inside the hydroponic box 10 by being engaged with the two slots, which facilitates installation and removal.

[0103] Please refer to Figure 5 and Figure 8 The fixing holes 111 are distributed in a rectangular array on the partition plate 11. During hydroponics, multiple sweet potato stem segments can be arranged in a one-to-one correspondence in the multiple fixing holes 111.

[0104] In some embodiments, the ventilation and moisture-retention cover 20 is made of a highly transparent acrylic material and is connected to the hydroponic box 10 via a sealing strip. The highly transparent acrylic material ensures light transmission, facilitating clear observation of root growth and development, allowing researchers to accurately capture the critical timing of hairy root germination.

[0105] In other embodiments, the ventilation and moisturizing cover 20 can also be connected to the hydroponic box 10 through a magnetic sealing strip, which not only ensures the connection reliability but also improves the disassembly and assembly efficiency.

[0106] In some embodiments, please refer to Figures 5 to 8 A water outlet 12 is provided at the bottom of the hydroponic box 10, and a sealing plug is threadedly connected to the water outlet 12.

[0107] The water outlet 12 is used to drain the hydroponic solution from the hydroponic box 10 after the hydroponic experiment is completed or to periodically replace the hydroponic solution. During the hydroponic experiment, the water outlet 12 is sealed by a sealing plug to prevent leakage of the hydroponic solution. In this embodiment, the inner wall of the water outlet 12 is provided with an internal thread, and the sealing plug is provided with an external thread. The sealing plug is threadedly connected to the water outlet 12 via the mating internal and external threads.

[0108] Optionally, a multi-parameter sensor (such as pH, temperature, and dissolved oxygen sensor) is integrated at the bottom of the hydroponic box 10 to monitor the status of the hydroponic solution in real time. The data is transmitted to the user terminal via the Wi-Fi / Bluetooth module. The user can remotely view the data through the mobile phone APP, which facilitates timely adjustment of the light intensity of the LED lamp 202, the aeration frequency, and the replenishment of the hydroponic solution, thereby achieving precise environmental control and reducing human operation errors.

[0109] Optionally, the inner bottom surface of the hydroponic box 10 is coated with a nano-scale anti-algae and antibacterial coating to inhibit the growth of algae and the reproduction of pathogenic microorganisms, reduce hydroponic solution pollution, extend the solution replacement cycle, and reduce maintenance costs.

[0110] It should be understood that the anti-algae and antibacterial coating is provided on the inner bottom surface of the hydroponic box 10 , which does not affect the user's clear observation of the growth and development process of the sweet potato roots in the hydroponic box 10 .

[0111] The workflow of conducting a hydroponic experiment using the visualized plant hydroponic device provided by the present invention includes:

[0112] (1) Device preparation: adjust the height of the bracket 40, install the partition plate 11, and add the hydroponic solution;

[0113] (2) Stem segment fixation: insert the sterilized stem segment into the fixing hole 111 of the partition plate 11;

[0114] (3) Daily management: Change water regularly and observe growth;

[0115] (4) Data collection: record root development and changes in environmental parameters.

[0116] It should be noted that, in this specification, relational terms such as first and second are merely used to distinguish one entity from other entities, but do not necessarily require or imply any actual relationship or order between these entities.

[0117] After the hydroponic culture, the transgenic adventitious roots of sweet potato were positively identified. The genomic DNA of sweet potato adventitious roots was extracted by CTAB method, and the target gene sequence was amplified by PCR using primers RUBY-F and RUBY-R. The target gene band was detected by agarose gel electrophoresis. The results are as follows: Figure 4 This is consistent with the results of the red reporter gene RUBY observed directly with the naked eye ( Figure 3 ), DNA extracted from adventitious roots of positive RUBY plants can amplify a target fragment of approximately 790 bp ( Figure 4 ), while the normal plant as a negative control could not amplify the fragment ( Figure 4 The results of RUBY colorimetric and DNA identification experiments showed that the CID method can be used to quickly and efficiently obtain transgenic sweet potato adventitious roots.

[0118] Example 2 Analysis of transformation efficiency of sweet potato with different genotypes

[0119] In order to study the differences in sweet potato transformation efficiency among different genotypes, we selected three sweet potato varieties, namely "Fushu 18", "Gaoxi 14" and "Haida 7798", which were grown at the Batou Base of Hainan University's South China Seed Breeding Research Institute for experiments.

[0120] 1. Preparation of sweet potato plants

[0121] Three sweet potato varieties were selected, namely "Fushu 18", "Gaoxi 14" and "Haida 7798". Stem segments were cut from the seedlings grown from the tubers of the three sweet potato varieties (the lower cut end was about 1 cm away from the internode). The seedlings were about 12 cm long, with 3 to 5 internodes and 2 to 3 mature leaves. The leaves and petioles at the base of 3-5 stem nodes and possible adventitious roots were removed with a sterile knife to expose the root base.

[0122] 2. Transformation of Agrobacterium rhizogenes and activation of recombinant Agrobacterium rhizogenes

[0123] Same as Example 1.

[0124] 3. Preparation of infection solution

[0125] Same as Example 1.

[0126] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0127] The infection solution was injected into the internodes of sweet potato seedlings from varieties "Fushu 18," "Gaoxi 14," and "Haida 7798." The infected stem segments were then immersed in the infection solution for 2 hours. The explants were then rinsed with sterile water containing 200 mg / L cephalosporin for 10 minutes, followed by two rinses with distilled water. The infected seedlings were cultured in a transparent hydroponic device containing 0.10 mg / L NAA growth hormone. The device was covered with a transparent hood with ventilation holes and black cloth to ensure high humidity and darkness. The seedlings were cultured in darkness for 2 days and then grown under a photoperiod (28°C, 10-h / 14-h light / dark cycle, light intensity ~200 μmol m⁻² s⁻¹). The water was changed every 7 days to prevent water contamination. After 2 weeks, the hood was removed and culture continued until numerous adventitious roots formed. Positive adventitious roots were visible under visible light, indicating the expression of the target gene, RUBY, in red.

[0128] Then, positive identification of transgenic sweet potato adventitious roots and PCR detection of the RUBY gene were performed, with the same steps as in Example 1.

[0129] The results are shown in Table 1. “Haida 7798” had the highest genetic transformation efficiency, with an adventitious root induction rate of 96.3% and an adventitious root positive rate of 93.5%. Therefore, in subsequent transformation experiments, we uniformly used “Haida 7798” to improve transformation efficiency.

[0130] Table 1 Analysis of transformation efficiency of sweet potato with different genotypes

[0131]

[0132] Example 3 Different infection fluid OD 600 Analysis of sweet potato transformation efficiency

[0133] In order to study the different infection fluid OD 600 To determine whether there is a difference in the transformation efficiency of sweet potato, we dissolved the collected Agrobacterium rhizogenes cells in the prepared infection solution and measured the OD value of the infection solution. 600 The dilution is 0.4, 0.6, 0.8, 1.0. The specific steps are as follows:

[0134] (1) Preparation of sweet potato plants

[0135] Same as Example 1.

[0136] Agrobacterium rhizogenes transformation and activation of recombinant Agrobacterium rhizogenes

[0137] Same as Example 1.

[0138] 3. Preparation of infection solution

[0139] The collected bacteria were dissolved in 1 / 4 MS + 0.1% sucrose + 150 μm AS + 0.02% Silwet L77 (PH = 5.6) infection solution, and the infection solution was diluted to OD 600 The spare values are 0.4, 0.6, 0.8 and 1.0 respectively.

[0140] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0141] Different OD 600 The infectious liquid was applied to the internodes of the "Haida 7798" sweet potato seedlings, and the specific steps were the same as those in Example 1 to obtain transgenic sweet potato composite plants.

[0142] Then, the positive identification of transgenic sweet potato adventitious roots and PCR detection of RUBY gene were carried out, and the steps were the same as those in Example 1. The results are shown in Table 2. As can be seen from Table 2, the OD values of different infection solutions were 600 The values had significant effects on the transformation efficiency of sweet potato. 600 =0.8, the induction rate and positive rate of adventitious roots were the highest, 95.7% and 93.5% respectively. 600 =0.8 to infect sweet potato.

[0143] Table 2 OD of different infection solutions 600 Analysis of sweet potato transformation efficiency

[0144]

[0145] Example 4 Analysis of sweet potato transformation efficiency with different infection solution formulations

[0146] To investigate the effects of different inoculum formulations on sweet potato transformation efficiency, we prepared inoculum solutions using various concentrations of AS, Silwet L-77, and sucrose. AS, a phenolic inducer, activates Vir gene expression in Agrobacterium. The experiment compared the effects of different AS concentrations on transformation efficiency. Silwet L-77, a surfactant, enhances the permeability of the inoculum, and the effect of different addition ratios on the residual rate of the inoculum was tested. (The residual rate reflects the difficulty of Agrobacterium removal; high residual rates can lead to subsequent contamination.) Sucrose provides osmotic pressure and a carbon source in the inoculum, but high concentrations may inhibit Agrobacterium activity. We compared the OD600 stability of Agrobacterium (24 hours) using different sucrose concentrations. The specific steps are as follows:

[0147] (1) Preparation of sweet potato plants

[0148] Same as Example 1.

[0149] Agrobacterium rhizogenes transformation and activation of recombinant Agrobacterium rhizogenes

[0150] Same as Example 1.

[0151] 3. Preparation of infection solution

[0152] The collected bacteria were dissolved in 1 / 4 MS solution containing different concentrations of AS, Silwet L-77 and sucrose for later use.

[0153] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0154] Same as Example 1. The induction rate of sweet potato adventitious roots by infection solutions with different concentrations of AS, Silwet L-77 and sucrose was statistically analyzed. The residual of sweet potato adventitious roots by infection solutions with different addition ratios of Silwet L-77 was compared and statistically analyzed. At the same time, the OD values of Agrobacterium were tested for infection solutions containing different concentrations of sucrose. 600 Stability in the infection solution (24 hours) to evaluate the survival status of Agrobacterium in the infection solution and the uniformity of the bacterial solution.

[0155] Positive identification of transgenic sweet potato adventitious roots and PCR detection of the RUBY gene were then performed, following the same procedures as in Example 1. The results are shown in Tables 3-5. Tables 3-5 show that different inoculation fluid formulations significantly differed in sweet potato transformation efficiency. Comparing different concentrations of AS, Silwet L-77, and sucrose, we found that a mixture of 1 / 4 MS + 0.1% sucrose + 150 μM AS (acetosyringone) + 0.02% Silwet L-77 (pH 5.6) was the most effective. Therefore, we selected this inoculation fluid for sweet potato genetic transformation.

[0156] Table 3 AS (acetosyringone) concentration screening

[0157]

[0158] Table 4 Silwet L-77 concentration screening

[0159]

[0160] Table 5 Sucrose concentration screening

[0161]

[0162] Example 5 Analysis of sweet potato conversion efficiency with different hydroponic solution formulas

[0163] To study the effects of different hydroponic solution formulations on sweet potato conversion efficiency, we used different concentrations of Hoagland, NAA (auxin), and 6-BA (cytokinin) to prepare hydroponic solutions. The specific steps are as follows:

[0164] (1) Preparation of sweet potato plants

[0165] Same as Example 1.

[0166] Agrobacterium rhizogenes transformation and activation of recombinant Agrobacterium rhizogenes

[0167] Same as Example 1.

[0168] 3. Preparation of infection solution

[0169] Same as Example 1.

[0170] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0171] Same as Example 1. The infected sweet potato seedlings were placed in hydroponic solutions containing various concentrations of Hoagland, NAA, and 6-BA and cultured in a transparent hydroponic apparatus. After 7 days, adventitious root length, fresh root weight, browning rate, adventitious root density, and root morphology were statistically analyzed and evaluated.

[0172] Subsequently, positive identification of transgenic sweet potato adventitious roots and PCR detection of the RUBY gene were performed using the same procedures as in Example 1. The results are shown in Tables 6-7. As shown in Tables 6-7, different concentrations of Hoagland, NAA, and 6-BA showed significant differences in sweet potato transformation efficiency. The hydroponic solution consisting of 1 / 2 Hoagland + 0.5 mg / L NAA + 0.1 mg / L 6-BA + 0.1% sucrose (pH = 5.8-6.0) was the most effective. Therefore, this hydroponic solution was selected for sweet potato cultivation.

[0173] Table 6 Hoagland concentration screening

[0174]

[0175] Table 7 NAA and 6-BA concentration screening

[0176]

[0177] Example 6 Analysis of the Effect of Different Dark Culture Times on Sweet Potato Transformation Efficiency

[0178] In order to investigate whether different dark culture times have different effects on the transformation efficiency of sweet potatoes, we dark cultured the infected sweet potato seedlings for 1, 2, and 3 days. The specific steps are as follows:

[0179] (1) Preparation of sweet potato plants

[0180] Same as Example 1.

[0181] Agrobacterium rhizogenes transformation and activation of recombinant Agrobacterium rhizogenes

[0182] Same as Example 1.

[0183] 3. Preparation of infection solution

[0184] Same as Example 1.

[0185] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0186] The infection procedure was the same as in Example 1. The infected sweet potato seedlings were cultured in darkness for 1, 2, and 3 days, followed by growth under a photoperiod (28°C, 10-h / 14-h light / dark cycle, light intensity ~200 μmol m⁻² s⁻¹). The water was changed every 7 days to prevent water contamination. After 2 weeks, the transparent transplanting cover was removed, and the culture was continued until a large number of adventitious roots formed. Positive adventitious roots were visible to the naked eye under visible light, indicating the expression of the target gene RUBY.

[0187] Afterwards, positive identification of transgenic sweet potato adventitious roots and PCR detection of the RUBY gene were performed, following the same procedures as in Example 1. The experimental results are shown in Table 8. As can be seen from Table 8, the transformation efficiency of sweet potato was highest when the dark incubation time was 2 days, with an adventitious root induction rate of 95.8% and an adventitious root positivity rate of 94.5%. Therefore, we selected a dark incubation time of 2 days to improve the transformation efficiency of sweet potato.

[0188] Table 8 Analysis of sweet potato transformation efficiency at different dark culture times

[0189]

[0190] Example 7 Analysis of sweet potato transformation efficiency by different culture methods

[0191] In order to investigate whether different culture methods have different effects on the transformation efficiency of sweet potatoes, we cultured the infected sweet potato seedlings in water and soil respectively. The specific steps are as follows:

[0192] (1) Preparation of sweet potato plants

[0193] Same as Example 1.

[0194] Agrobacterium rhizogenes transformation and activation of recombinant Agrobacterium rhizogenes

[0195] Same as Example 1.

[0196] 3. Preparation of infection solution

[0197] Same as Example 1.

[0198] 4. Inducing the formation of transgenic adventitious roots in sweet potatoes

[0199] The infection solution was injected into the internodes of sweet potato seedlings of the "Haida 7798" variety. The infected stem segments were then immersed in the infection solution for 2 hours. The explants were then rinsed with sterile water containing 200 mg / L cephalosporin for 10 minutes, and the stem segments were finally rinsed twice with distilled water. The infected seedlings were cultured in two batches: one in a transparent hydroponic device containing 1 / 2 Hoagland®, 0.5 mg / L NAA, 0.1 mg / L 6-BA, and 0.1% sucrose (pH 5.8-6.0), and the other in moistened vermiculite. The cells were covered with a transparent transplant hood with ventilation holes and black cloth to ensure high humidity and darkness. The cells were cultured in darkness for 2 days and then grown under a photoperiod (28°C, 10-h / 14-h light / dark cycle, light intensity ~200 μmol m⁻² s⁻¹). Under hydroponic conditions, water was changed every 7 days to prevent water contamination. After 2 weeks, the transparent transplanting cover was removed and culture continued until a large number of adventitious roots formed. The positive adventitious roots could be observed with the naked eye under visible light, indicating the expression of the red target gene RUBY.

[0200] Afterwards, positive identification of transgenic sweet potato adventitious roots and PCR detection of the RUBY gene were performed, following the same procedures as in Example 1. The experimental results are shown in Table 9. The transformation efficiency of hydroponic culture was significantly higher than that of soil culture. Hydroponic culture not only facilitated the observation of adventitious roots, but also showed higher induction rates and positive rates for adventitious root transformation than soil culture. Therefore, we chose hydroponic culture as a method for inducing adventitious roots to improve the transformation efficiency of sweet potato.

[0201] Table 9 Analysis of sweet potato transformation efficiency by different culture methods

[0202]

[0203] In summary, the genetic transformation of sweet potatoes can be rapidly accomplished by injecting an Agrobacterium rhizogenes infection solution containing the target gene expression vector into wounded sweet potato internodes, followed by immersing the infected stem segments in the infection solution and hydroponically cultivating them. The RUBY-marked vector can be introduced into the sweet potatoes, enabling naked-eye identification of transgenic adventitious roots without the need for chemical treatment or specialized equipment, significantly improving transformation efficiency and detection speed. Compared to traditional sweet potato genetic transformation methods, the present invention eliminates the need for tissue culture, significantly reduces the time required to obtain transgenic plants, and achieves a positive rate of 90% to 100%, significantly increasing transgenic efficiency.

[0204] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent combination for inducing and cultivating transgenic adventitious roots of sweet potato, characterized in that: It includes infective solution and hydroponic solution, including: The infection solution is 1 / 4 MS liquid medium with a pH of 5-6, containing 0.1%-0.5% (w / v) sucrose, 20-200 μM acetosyringone, and 0.01%-0.03% Silwet L-77 (v / v); The hydroponic solution is a Hoagland nutrient solution with a pH of 5-6 and containing 0.5-1 mg / L NAA, 0.1-0.2 mg / L 6-BA, and 0.1%-0.5% (w / v) sucrose. The concentration of the Hoagland nutrient solution is 25%, 50%, or 100%.

2. The reagent combination according to claim 1, characterized in that The infection solution is 1 / 4 MS liquid medium with a pH of 5.6 containing 0.1% (w / v) sucrose, 150 μM acetosyringone and 0.02% Silwet L-77 (v / v); The hydroponic solution is a 50% Hoagland nutrient solution containing 0.5 mg / L NAA, 0.1 mg / L 6-BA, and 0.1% (w / v) sucrose and having a pH of 5.8-6.

0.

3. A method for inducing and cultivating transgenic adventitious roots of sweet potato, characterized in that: The steps include: Step 1: construct an expression vector containing the target gene, transform the competent Agrobacterium, screen and identify it, and obtain transgenic Agrobacterium rhizogenes containing the target gene; Step 2: Take the transgenic Agrobacterium rhizogenes described in step 1, and resuspend the bacteria in the infection solution of the reagent combination of claim 1 or 2 to obtain an infection solution; Step 3, injecting the infectious bacterial solution described in step 2 into the internodes of the stem segments of the sweet potato seedlings from which adventitious roots have been removed, and co-culturing the injected sweet potato seedlings with the infectious bacterial solution; Step 4: Take the sweet potato seedlings co-cultivated in step 3 and culture them with the hydroponic solution in the reagent combination according to claim 1 or 2 to obtain transgenic sweet potato adventitious roots.

4. The method according to claim 3, characterized in that In the step 1, The target gene includes the RUBY gene, and the competent Agrobacterium includes at least one of Agrobacterium MSU440, Agrobacterium C58C1 and Agrobacterium K599.

5. The method according to claim 3, characterized in that In step 2, the OD of the infected bacterial solution 600 The value is 0.4~1.

0.

6. The method according to claim 3, characterized in that In step 3, the method for preparing the sweet potato seedlings with adventitious roots removed comprises: taking seedlings germinated from the tuberous roots of sweet potatoes, removing leaves and petioles at 3 to 5 stem nodes at the base of the seedlings with a sterile knife, and removing existing adventitious roots on the plants to obtain the sweet potato seedlings with adventitious roots removed; The sweet potato varieties include at least one of Fushu 18, Gaoxi 14 and Haida 7798.

7. The method according to claim 3, characterized in that In the step 3, The injection depth is 1-2 mm, the injection angle is 45° upward from the horizontal, and the co-culture time is 1-3 h; After the co-cultivation, the method further comprises washing the sweet potato seedlings with sterile water containing 200 mg / L cephalosporin for 5 to 15 minutes, and then washing the stem segments with distilled water for 2 to 5 times.

8. The method according to claim 3, characterized in that In step 4, the culturing includes dark culturing and photoperiod culturing, the sweet potato seedlings are dark-cultured for 1 to 3 days and then photoperiod-cultured for 7 to 21 days, and during the photoperiod culturing, the hydroponic solution is replaced every 7 days; The photoperiodic culture temperature was 25-28°C and the light intensity was 200 μmol m -2 s -1 , daily lighting time is 10~14h.

9. The method according to claim 3, characterized in that In step 4, the culture device includes: The hydroponic box (10) is made of a light-transmitting material and has a rectangular box structure with an open top. The hydroponic liquid is loaded in the hydroponic box (10); A partition plate (11) is fixedly arranged inside the hydroponic box (10) and is arranged near the bottom of the hydroponic box (10). The partition plate (11) is evenly provided with a plurality of fixing holes (111). The fixing holes (111) are used to fix the stem segments of the sweet potato seedlings. The roots of the sweet potato seedlings are immersed in the hydroponic solution for cultivation. A ventilation and moisturizing cover (20) is made of a light-transmitting material and is fixedly arranged at the top opening of the hydroponic box (10). The top is provided with a plurality of ventilation holes (201). The ventilation and moisturizing cover (20) is equipped with an LED light (202); An aeration device is used for releasing microbubbles to increase the dissolved oxygen content of the hydroponic solution in the hydroponic box (10), comprising an air pump, a ventilation pipe (30) and an aeration stone (31), wherein the air pump is fixedly arranged on the outer side of the hydroponic box (10), the aeration stone (31) is arranged in the hydroponic box (10) and is located below the partition plate (11), and the two ends of the ventilation pipe (30) are respectively connected to the air pump and the aeration stone (31).

10. The method according to claim 3, characterized in that The method also includes PCR detection of transgenic adventitious roots: extracting adventitious root DNA, and then performing PCR identification, wherein the identified genes include the target gene and the reporter gene in the expression vector.

Images