Application of soybean gene GmPIF4s in soybean breeding

The soybean gene GmPIF4s was knocked out through CRISPR/Cas9 technology, reducing the plant height and increasing the number of branches, solving the environmental risks and cost problems of reducing the rod height of exogenous chemicals, and achieving an increase in soybean yield under high-density planting conditions.

CN120485264AActive Publication Date: 2025-08-15SHANDONG LAB OF ADVANCED AGRI SCI AT WEIFANG +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510986678.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-08-15
Estimated Expiration
2045-07-17

AI Technical Summary

Technical Problem

In the prior art, soybean breeding methods that strengthen rods and reduce highs by applying exogenous chemicals have high costs and environmental risks, and it is difficult to effectively increase soybean yield, especially under high-density planting conditions, which are prone to lodging and yield decreases.

Method used

Through gene editing technology, especially the CRISPR/Cas9 system, the soybean gene GmPIF4s is knocked out to lose its function, thereby obtaining mutant soybean plants with reduced plant height and increased branch count, adapting to high-density planting conditions and increasing yield.

Benefits of technology

It has achieved the improvement of density and yield of soybean plants under high-density planting conditions, and is suitable for multi-layer cultivation systems or crop rotation systems, solving the environmental risks and cost problems of exogenous chemical agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485264A_ABST
    Figure CN120485264A_ABST
Patent Text Reader

Abstract

The invention provides application of a soybean gene GmPIF4s in soybean breeding, and relates to the technical field of gene engineering. The application comprises the following steps: performing mutation treatment on a soybean gene GmPIF4s in soybeans to obtain a GmPIF4s gene mutation soybean plant; the soybean gene GmPIF4s comprises the following nucleotide sequences: GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d, wherein the nucleotide sequences of the GmPIF4a, the GmPIF4b, the GmPIF4c and the GmPIF4d are respectively shown as SEQ ID NOs: 1-4. The soybean gene GmPIF4s in the soybean is mutated, so that the soybean gene GmPIF4s loses gene functions, the phenotype of the obtained mutated soybean plant is that the plant height is reduced, the number of branches is increased, and the soybean plant can resist close planting during actual planting, so that the soybean with higher yield is obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to an application of a soybean gene GmPIF4s in soybean breeding. Background Art

[0002] Soybeans are an important dual-purpose crop for food, oilseed, and feed in my country. Rich in nutritious protein, soybeans account for 64.78% of the protein output of the world's eight major crops and approximately 35% of the world's oilseed crop output. They are one of the most important sources of plant protein and edible oils for generations of Chinese people and people around the world today. In recent years, my country's soybean shortage has continued to grow, with imports exceeding 100 million tons in 2020 and international dependence reaching 87%, posing a serious threat to food security. Therefore, further research into the genetic breeding and cultivation mechanisms of high-yield soybeans, and advancing the selection and breeding of breakthrough high-yield soybean varieties in my country, is crucial for promoting high-quality, stable, and high-yield soybean production, meeting the nation's growing soybean consumption demand, and safeguarding my country's agricultural and food security.

[0003] Plant height and branching are important morphological indicators related to soybean yield. The application of semi-dwarf genes in wheat and rice breeding has resulted in dwarf and semi-dwarf varieties with enhanced lodging resistance, thereby doubling their yield. In soybean production, growth regulators such as paclobutrazol, clofosamide, and chlorpyrifos are often applied to strengthen stems, reduce lodging resistance, and enhance plant growth. While the application of exogenous chemicals can partially address production issues, their high cost and the presence of residues in the soil pose a risk to subsequent crop production.

[0004] Genes related to soybean plant height and branching development have been cloned. Regarding plant height, soybean Dt1 (a homolog of Arabidopsis TERMINAL FLOWER1 (TFL1)) and Dt2 (encoding a MADS-domain-containing transcription factor) have been reported as key genes determining plant height and growth habit. Dt2 directly binds to the Dt1 promoter and represses its expression. The soybean auxin transporter protein PINFORMED1 (GmPIN1) mediates asymmetric auxin distribution in the soybean petiole. Asymmetric auxin concentrations, in turn, regulate asymmetric cell expansion, determining the formation of the soybean petiole angle. Both soybean Gmpin1abc triple and Gmpin1bc double mutants exhibit phenotypes such as upright leaf growth and a compact plant shape. Soybean RIN1 (reduced internode 1) interacts with STF1 / STF2 (Arabidopsis ELONGATED HYPOCOTYL 5 homologs) and induces STF1 / STF2 protein degradation, resulting in the inhibition of STF1 / STF2's induction of GA2ox7a / GA2ox7b, thereby increasing the endogenous gibberellin GA1 content and inducing soybean internode elongation. The gene CRYPTOCHROME 1 (GmCRY1), encoding a soybean blue light receptor, regulates soybean tolerance to dense planting by modulating gibberellin metabolism. In terms of branching, through the study of the homologous gene of SQUAMOSA Promoter-Binding Protein-Like 9 (SPL9) in Arabidopsis thaliana in soybean, it was found that the quadruple mutant with simultaneous knockout of GmSPL9 function can cause soybean to form more branches, and microRNA156 (miR156) controls soybean plant type by post-transcriptionally regulating GmSPL9. Overexpression of miR156b can significantly increase the number of soybean branches, nodes, pods and 100-grain weight, thereby greatly increasing the yield of soybean per plant.

[0005] Furthermore, proper planting density is crucial for achieving high soybean yields. In actual soybean cultivation scenarios, increasing soybean planting density or combining soybeans with corn results in an increase in plant height and internode length, while a decrease in the number of nodes on the main stem. Excessive planting density and excessive shading can lead to excessive growth and lodging, resulting in reduced yield and poor quality.

[0006] Therefore, this application aims to provide an application of genes that can effectively increase soybean yield, promote the breeding of high-yield varieties that are resistant to dense planting, establish a reasonable soybean planting model, and provide an important theoretical basis for reasonable dense planting of soybeans to achieve high yields. Summary of the Invention

[0007] The main purpose of the present invention is to provide an application of a soybean gene GmPIF4s in soybean planting, so as to provide a new gene that can increase soybean yield by reducing plant height and increasing the number of branches.

[0008] In order to achieve the above-mentioned object, according to a first aspect of the present invention, there is provided an application of a soybean gene GmPIF4s in soybean breeding, the application comprising: mutating the soybean gene GmPIF4s in soybean to obtain a GmPIF4s-mutated soybean plant; wherein the soybean gene GmPIF4s comprises GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d, whose nucleotide sequences are respectively shown in SEQ ID NOs: 1-4.

[0009] Furthermore, the nucleotide coding sequence of GmPIF4a is shown in SEQ ID NO: 5; the nucleotide coding sequence of GmPIF4b is shown in SEQ ID NO: 6; the nucleotide coding sequence of GmPIF4c is shown in SEQ ID NO: 7; and the nucleotide coding sequence of GmPIF4d is shown in SEQ ID NO: 8.

[0010] Furthermore, the amino acid sequences of the proteins encoded by GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d are shown in SEQ ID NOs: 9-12.

[0011] Furthermore, the soybean gene GmPIF4s is mutated to cause the soybean gene GmPIF4s to lose its protein encoding function.

[0012] Furthermore, gene editing was used to mutate the soybean gene GmPIF4s.

[0013] Furthermore, gene editing is performed using CRISPR / Cas9 technology.

[0014] Furthermore, the soybean gene GmPIF4s is subjected to mutation treatment, including: constructing a soybean gene GmPIF4s recombinant knockout vector, transferring the soybean gene GmPIF4s recombinant knockout vector into soybeans, and obtaining transgenic soybean plants; performing homozygous mutation analysis on the transgenic soybean plants to obtain GmPIF4s gene mutant soybean plants.

[0015] Furthermore, the soybean gene GmPIF4s comprises sgRNA sequences as shown in SEQ ID NOs: 21-24 in the recombinant knockout vector.

[0016] Furthermore, homozygous mutation analysis was performed by PCR amplification and sequencing of the knockout target site.

[0017] Furthermore, GmPIF4s in gene-mutated soybean plants has reduced plant height and increased branch number.

[0018] By applying the technical solution of the present invention, the soybean gene GmPIF4s in soybeans is mutated to cause it to lose its gene function. The resulting mutant soybean plant phenotype has a reduced plant height and an increased number of branches. When soybeans are actually planted, they can tolerate dense planting to obtain higher soybean yields. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:

[0020] Figure 1 The main structure diagram of the recombinant vector pCBSG015 (Basta) used in this application is shown;

[0021] Figure 2 The phenotypes of gmpif4-qm and Williams 82 in Example 2 of the present application after soybean monoculture and soybean-corn strip multiculture to maturity are shown;

[0022] Figure 3 The phenotype of gmpif4-qm planted at different densities to maturity in Example 3 of the present application is shown;

[0023] Figure 4 Statistical graphs showing various parameter data of gmpif4-qm and Williams 82 in Example 2 of the present application after soybean monoculture and soybean-corn strip multi-cropping to maturity;

[0024] Figure 5 Statistical graphs showing various parameter data of gmpif4-qm planted at different densities to maturity in Example 3 of the present application are shown;

[0025] Figure 6 The sgRNA sequence and position diagram of the soybean gene GmPIF4s of the present application are shown;

[0026] Figure 7 The figure shows the result of mRNA level detection of the gmpif4-qm mutant strain in Example 1 of the present application. DETAILED DESCRIPTION

[0027] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments in this application can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0028] As mentioned in the background, prior art soybean breeding for stronger stems, lowered height, and lodging resistance relies on exogenous chemical compounds. However, these growth enhancers and other substances fail to achieve optimal results and can cause environmental damage. Therefore, this application aims to provide a novel gene for increasing soybean yield for use in soybean breeding.

[0029] The first typical technical solution of the present application provides an application of a soybean gene GmPIF4s in soybean breeding, the application comprising: mutating the soybean gene GmPIF4s in soybeans to obtain GmPIF4s gene mutant soybean plants; wherein the soybean gene GmPIF4s comprises GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d, whose nucleotide sequences are respectively shown in SEQ ID NOs: 1-4.

[0030] Based on RNA-seq data, the applicant used the cDNA of Williams 82 as a template and the Arabidopsis PIF4 as a homologous gene, and found four homologous genes of GmPIF4s (Glyma.02G282100: GmPIF4a; Glyma.08G303900: GmPIF4b; Glyma.18G115700: GmPIF4c; Glyma.14G032200: GmPIF4d) through NCBI. The soybean gene GmPIF4s includes the above-mentioned four homologous genes and plays an important role in the soybean light and temperature signal transduction pathway. After phenotypic analysis of the four genes, this application found that the mutant strain (gmpif4-qm) after knocking out GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d had a phenotype of reduced plant height and increased number of branches. Soybean plants with this phenotype can obtain higher soybean yields when planted more densely or planted together with corn with taller plant height, providing certain technical support for soybean breeding.

[0031] The nucleotide sequence of the soybean gene GmPIF4s has an intron structure (e.g. Figure 6 In a preferred embodiment, the nucleotide coding sequence (CDS sequence) of GmPIF4a is shown in SEQ ID NO: 5; the nucleotide coding sequence of GmPIF4b is shown in SEQ ID NO: 6; the nucleotide coding sequence of GmPIF4c is shown in SEQ ID NO: 7; and the nucleotide coding sequence of GmPIF4d is shown in SEQ ID NO: 8.

[0032] The amino acid sequence of the protein encoded by the soybean gene GmPIF4s, in a preferred embodiment, the amino acid sequences of the proteins encoded by GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d are shown in SEQ ID NOs: 9-12.

[0033] The mutation treatment performed in this application is gene knockout, which is a random / directional disruption of the DNA sequence of a specific gene, causing the protein encoded by the gene to mutate, causing it to partially / completely lose its original function. In a preferred embodiment, the mutation treatment of the soybean gene GmPIF4s includes causing the soybean gene GmPIF4s to lose its function.

[0034] Any technology capable of performing gene mutation treatment is applicable to this application, such as transgenic technology, gene overexpression technology, gene silencing technology, RNA interference technology or chromosome engineering, etc. In a preferred embodiment, gene editing is used to perform mutation treatment on the soybean gene GmPIF4s.

[0035] Any technology capable of gene editing is applicable to this application, such as ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases), etc. In a preferred embodiment, gene editing is performed using CRISPR / Cas9 technology.

[0036] By constructing a CRISPR / Cas9 system expression vector, the target guide RNA of the gene to be knocked out in the present application is introduced into soybeans. In a preferred embodiment, the soybean gene GmPIF4s is mutated, including: constructing a soybean gene GmPIF4s recombinant knockout vector, transferring the soybean gene GmPIF4s recombinant knockout vector into soybeans, and obtaining transgenic soybean plants; performing homozygous mutation analysis on the transgenic soybean plants to obtain GmPIF4s gene mutant soybean plants.

[0037] In order to further efficiently knock out the soybean gene GmPIF4s of the present application, in a preferred embodiment, the soybean gene GmPIF4s recombinant knockout vector contains sgRNA sequences as shown in SEQ ID NOs: 21-24. The sgRNA sequence can be designed using the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and targets with high target scores and low off-target rates are selected. The target sites corresponding to the above sgRNA sequences (SEQ ID NOs: 21-24) in the gene are as follows Figure 6 As shown, for convenience Figure 6 The gene structure of Figure 6The indicated SEQ ID NO: 36 is the complementary sequence of the sgRNA sequence shown in SEQ ID NO: 23.

[0038] sgRNA common target 1 for GmPIF4a and GmPIF4b genes (SEQ ID NO: 21):

[0039] ATGGAAACAAGGCTTCTCAGCGG.

[0040] sgRNA common target 2 for GmPIF4a and GmPIF4b genes (SEQ ID NO: 22):

[0041] ATAGGATCAACGAGAAGATGAGG.

[0042] sgRNA common target 1 for GmPIF4c and GmPIF4d genes (SEQ ID NO: 23):

[0043] GTTCCAATGGATCCTCAAGAGGG.

[0044] sgRNA common target 2 for GmPIF4c and GmPIF4d genes (SEQ ID NO: 24):

[0045] AAGATGATGAGACAGTCTCATGG.

[0046] To facilitate subsequent genetic stability assessment and phenotypic analysis, homozygous mutants are screened within the mutant strains. In a preferred embodiment, homozygous mutation analysis is performed by PCR amplification and sequencing of the knockout target site. The PCR amplification method comprises amplifying the knockout target site in the transgenic soybean plant using primers (such as those shown in SEQ ID NOs: 28-35), and sequencing the amplified fragment containing the knockout target site. If the resulting sequencing information shows singlet peaks for the GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d genes compared to the wild type and contains base mutations, this indicates that the GmPIF4s gene in the quadruple mutant has mutated, resulting in premature termination of protein translation and loss of gene function. This indicates that the transgenic soybean plant is the homozygous quadruple mutant gmpif4-qm.

[0047] The soybean plants obtained after knocking out the soybean gene GmPIF4s in the present application have a phenotype of reduced plant height and increased number of branches. In a preferred embodiment, the soybean plants with the GmPIF4s gene mutation are soybean plants with reduced plant height and increased number of branches. The reduced plant height and increased number of branches of the soybean plants further manifest as tolerance to dense planting. Among them, the criteria for reduced plant height and increased number of branches are whether the data of plant height / number of branches are significantly different from the data of plant height / number of branches of the wild type (P≤0.05). Dense planting tolerance refers to the ability of plants to tolerate high-density environments. Under high-density conditions, neighboring plants block each other, resulting in a reduction in red and blue light in the middle and lower parts of the canopy, a weak shade-avoidance response of the plants, and a small reduction in yield. The plants of the present application can show stronger growth potential and higher yield potential under high-density planting conditions, and are particularly suitable for multi-layer cultivation systems or crop rotation systems, which helps to solve the problem of tight land resources in agricultural production.

[0048] The present application is further described in detail below with reference to specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in this application.

[0049] The soybean material Williams 82 used in the examples of this application was planted in the transgenic base of the Modern Agricultural Research Institute of Peking University.

[0050] Example 1 Cloning of the GmPIF4s gene and obtaining knockout plants

[0051] 1.1 Cloning of the GmPIF4s gene

[0052] (1) The full-length nucleotide sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d were obtained by bioinformatics search using phytozome (https: / / phytozome-next.jgi.doe.gov / ), as shown in SEQ ID NOs: 1-4.

[0053] (2) Using the full-length nucleotide sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d as templates, primers were designed to amplify the cDNA sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d.

[0054] (3) The soybean material Williams 82 was used as the genetic background, and the cDNA of Williams 82 was used as the template to clone the CDS sequence of the gene GmPIF4s using KOD polymerase and corresponding primers (as shown in SEQ ID NOs: 13-20).

[0055] The total reaction volume was 50 μL, consisting of 1 μL (approximately 50 ng) of template (Williams 82 cDNA), 5 μL of 10× KOD buffer, 2 μL of 25 mM MgCl₂, 5 μL of 5 mM dNTPs, 5 μL of 10 μM F and R primers (2.5 μL of each), and 1 μL of KOD FX. The volume was then filled with ddH₂O (sterile deionized water) to 50 μL. The reaction protocol was as follows: denaturation at 94°C for 5 min, followed by 30 s at 94°C, 1 min at 62°C, 35 cycles at 68°C for 1 min, and extension at 68°C for 10 min.

[0056] The amplified products were recovered and sequenced to obtain the CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes, which are shown in SEQ ID NOs: 5-8, respectively, and the encoded amino acid sequences are shown in SEQ ID NOs: 9-12, respectively.

[0057] The primers are:

[0058] GmPIF4a-F (SEQ ID NO: 13):

[0059] TGGCCATGGAGGCCGAATTCATGAACAACAGTATTCCTGGTTGG (plus EcoR1 restriction enzyme site).

[0060] GmPIF4a-R (SEQ ID NO: 14):

[0061] CGCTGCAGGTCGACGGATCCTCAATTAAAGGTGGAAGAACCCG (plus BamH1 restriction enzyme site).

[0062] GmPIF4b-F (SEQ ID NO: 15):

[0063] TGGCCATGGAGGCCGAATTCATGAACAACAGTGTTCCT (plus EcoR1 restriction enzyme site).

[0064] GmPIF4b-R (SEQ ID NO: 16):

[0065] CGCTGCAGGTCGACGGATCCTCAATTTGTTGTTAGCCAA (plus BamH1 restriction enzyme site).

[0066] GmPIF4c-F (SEQ ID NO: 17):

[0067] TGGCCATGGAGGCCGAATTCATGAACAACAGTGTTCCTGATTGGA (plus EcoR1 restriction enzyme site).

[0068] GmPIF4c-R (SEQ ID NO: 18):

[0069] CGCTGCAGGTCGACGGATCCTTAACCCATTTTGCCACTCACAGC (plus BamH1 restriction enzyme site).

[0070] GmPIF4d-F (SEQ ID NO: 19):

[0071] TGGCCATGGAGGCCGAATTCATGAAGAACAGTATTCCTGGTTTGG (plus EcoR1 restriction enzyme site).

[0072] GmPIF4d-R (SEQ ID NO: 20):

[0073] CGCTGCAGGTCGACGGATCCTCAGTTAAAGGTGGAAGAACCTG (plus BamH1 restriction enzyme site).

[0074] 1.2 Obtaining GmPIF4s knockout plants

[0075] 1.2.1 Construction of knockout vector

[0076] Using soybean genes GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d (shown in SEQ ID NOs: 1-4) as templates, suitable target sequences for gene editing were designed, and sgRNAs shown in SEQ ID NOs: 21-24 were obtained and constructed into the pCBSG015 (Basta) vector (purchased from Weimi Technology, the vector structure is shown in FIG). Figure 1 The recombinant vector was then verified for plasmid construction using primers shown in SEQ ID NOs: 25-27. Upstream and downstream sequencing primers were placed on the vector backbone, and an intermediate sequencing primer was placed at the target site of one of the genes. PCR amplification and sequencing were performed to verify successful target construction.

[0077] The constructed recombinant plasmid pCBSG015 (Basta) was sequenced by PCR amplification products using the following primers to confirm whether the recombinant plasmid was constructed correctly:

[0078] Upstream sequencing primer (SEQ ID NO: 25): TCCCAGTCACGACGTTGTAA.

[0079] Middle sequencing primer (SEQ ID NO: 26): TGGAAACAAGGCTTCTCA.

[0080] Downstream sequencing primer (SEQ ID NO: 27): GCCATTTGTCTGCAGAATTG.

[0081] 1.2.2 Genetic transformation of soybean Williams 82 and screening and identification of GmPIF4s knockout plants

[0082] The recombinant plasmid was transformed into soybean Williams 82 using the CRISPR-Cas9 gene knockout system, generating the quadruple mutant gmpif4-qm. The core steps include: constructing the recombinant plasmid → preparing Agrobacterium → preparing susceptible explants (such as immature cotyledons) → infecting the explants with Agrobacterium and co-cultivating them (T-DNA transfer) → inhibiting the growth of the bacteria → screening and culturing (obtaining resistant calli / embryos) → somatic embryogenesis and plant regeneration → rooting and transplanting → molecular characterization → screening of progeny to obtain homozygous transgenic lines.

[0083] To identify mutants, genomic DNA was extracted from young leaf tissue of the regenerated plants. PCR amplification of the knockout target sites (amplification primers are shown in SEQ ID NOs: 28-35) and first-generation sequencing technology were used to verify the mutation type of the quadruple mutant. The sequencing results confirmed that GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d were cut and broken, causing the genes to produce mutation types such as frameshift mutations and premature termination, thereby losing gene function.

[0084] GmPIF4a-F knockout identification primer (SEQ ID NO: 28):

[0085] GAGAAAAGGGACAGAAGAAGAAGCGTTA.

[0086] GmPIF4a-R knockout identification primer (SEQ ID NO: 29):

[0087] CTTACGACATCCATCCGAATC.

[0088] GmPIF4b-F knockout identification primer (SEQ ID NO: 30):

[0089] GGTAGTGCACAGCCAAACT.

[0090] GmPIF4b-R knockout identification primer (SEQ ID NO: 31):

[0091] GGCCGGTATAGGAATTCCTGAGAAA.

[0092] GmPIF4c-F knockout identification primer (SEQ ID NO: 32):

[0093] GTGGACCAAGAGCTTGTAGAGCTTCA.

[0094] GmPIF4c-R knockout identification primer (SEQ ID NO: 33):

[0095] GTTTCAGTCACATGGGGGGTACTAGAG.

[0096] GmPIF4d-F knockout identification primer (SEQ ID NO: 34):

[0097] GTGTCCAGAGACCAATTTGTCCTAGGAG.

[0098] GmPIF4d-R knockout identification primer (SEQ ID NO: 35):

[0099] TGATTTTGGCACATTAAATTCTGGTTTGGC.

[0100] After identification of the regenerated plants, 13 heterozygous mutant T0 generation plants were obtained, each of which had mutations in four genes: GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d.

[0101] Planting was then continued, and heterozygous material was isolated. All heterozygous seeds from the T0 generation were sown again. After seedlings grew, PCR amplification and sequencing were performed again. Each generation was identified using this method until homozygous gmpif4-qm was obtained. At this point, sequencing of the four gene targets, GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d, all showed single peaks and base mutations. Ultimately, four homozygous gmpif4-qm gene-edited mutant lines were obtained.

[0102] The four homozygous gmpif4-qm gene-edited mutant lines are Gmpif4-qm 1# 、Gmpif4-qm 2# 、Gmpif4-qm 3# and Gmpif4-qm 4# , where Gmpif4-qm 1#The specific CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown in SEQ ID NOs:45-48. The specific mutation types are TC deletion (-2 bp) at positions 1050-1051 of the GmPIF4a gene, and a 15 bp-long base deletion (-15 bp) at positions 1138-1152; TC deletion (-2 bp) at positions 196-197 of the GmPIF4b gene, and CTTGAG deletion (-6 bp) at positions 214-219; G deletion (-1 bp) at position 1137 of the GmPIF4c gene; TC deletion (-2 bp) at positions 268-269 of the GmPIF4d gene, and CTTGAGGAT deletion (-9 bp) at positions 287-295.

[0103] Gmpif4-qm 2# The specific CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown in SEQ ID NOs: 49-52. The specific mutation types are TC deletion (-2 bp) at positions 1050-1051 of the GmPIF4a gene, and 15 bp of bases deleted (-15 bp) at positions 1138-1152; TC deletion (-2 bp) at positions 196-197 of the GmPIF4b gene, and CTTGAG deletion (-6 bp) at positions 214-219; GAAGA deletion (-5 bp) at positions 1134-1138 of the GmPIF4c gene; and an increase of 42 bp of bases (+42 bp) and a deletion of 25 bp of bases (-25 bp) at positions 267-308 of the GmPIF4d gene.

[0104] Gmpif4-qm 3# The specific CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown in SEQ ID NOs: 53-56. The specific mutation types are TC deletion (-2 bp) at positions 1050-1051 of the GmPIF4a gene, and 15 bp of bases deleted (-15 bp) at positions 1138-1152; CAGTC deletion (-5 bp) at positions 191-195 of the GmPIF4b gene, and GAGGAT deletion (-6 bp) at positions 217-222; GAAGA deletion (-5 bp) at positions 1134-1138 of the GmPIF4c gene; and an increase of 42 bp of bases (+42 bp) and a deletion of 25 bp of bases (-25 bp) at positions 267-308 of the GmPIF4d gene.

[0105] Gmpif4-qm 4#The specific CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown in SEQ ID NOs: 57-60. The specific mutation types are G deletion at position 1137 of the GmPIF4a gene (-1 bp); 19 bp of bases are deleted at positions 180-198 of the GmPIF4b gene (-19 bp), and T is added in the middle of positions 216-217 (+1 bp); TC deletion at positions 1050-1051 of the GmPIF4c gene (-2 bp), and G deletion at position 1137 (-1 bp); TC deletion at positions 268-269 of the GmPIF4d gene (-2 bp), and CTTGAG deletion at positions 286-291 (-6 bp).

[0106] Gmpif4-qm 1# 、Gmpif4-qm 2# 、Gmpif4-qm 3# and Gmpif4-qm 4# All strains had a phenotype of reduced plant height and increased branching. These homozygous gmpif4-qm gene-edited mutant strains were used for phenotypic observation and functional testing in Examples 2-3.

[0107] At the same time, the mRNA levels of these four homozygous gmpif4-qm quadruple mutant lines were tested. When the four homozygous gmpif4-qm quadruple mutant lines were cultured to the third trifoliate leaf, four young roots, stems, and leaves of gmpif4-qm were taken respectively, the four gmpif4-qm roots were mixed, the four gmpif4-qm stems were mixed, the four gmpif4-qm leaves were mixed, and they were quickly frozen and ground in liquid nitrogen. RNA was extracted using Novizan's RNA extraction kit and reverse transcribed using the company's reverse transcription kit to obtain cDNA of gmpif4-qm roots, stems, and leaves. Specific qRT-PCR primers were then designed to measure the expression levels of the four GmPIF4 genes in gmpif4-qm roots, stems, and leaves. The results are as follows. Figure 7 As shown, it can be seen that the expression levels of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes in the roots, stems and leaves of the quadruple mutant strain were significantly lower than those of the wild type. The primers used for identification are shown in SEQ ID NOs: 37-44:

[0108] mRNA detection primer 08-qPCR-F (SEQ ID NO: 37): CTAGACCGCCTTTCCCTCCTC.

[0109] mRNA detection primer 08-qPCR-R (SEQ ID NO: 38): TGGGTGTAATCATTGTTTGACTATGTT.

[0110] mRNA detection primer 18-qPCR-F (SEQ ID NO: 39):

[0111] TTCAATCAACATTAAGGACTAGTGAGCCATTTGGG.

[0112] mRNA detection primer 18-qPCR-R (SEQ ID NO: 40): AGATTTCATGGTAGGTGATTGCGAAG.

[0113] mRNA detection primer 02-qPCR-F (SEQ ID NO: 41): GTGATCAATCAGTATTAAGGTCTAGC.

[0114] mRNA detection primer 02-qPCR-R (SEQ ID NO: 42): CAAACTTTTCCTCTTCCAATTGCC.

[0115] mRNA detection primer 14-qPCR-F (SEQ ID NO:43): CTGATCATTCAACATTAAGGTCTAGT.

[0116] mRNA detection primer 14-qPCR-R (SEQ ID NO: 44): GTAAACTTGTCCTCTTCCAATTGCT.

[0117] Example 2 Functional verification of the gene GmPIF4s in soybean monoculture and soybean-corn strip multiculture

[0118] The homozygous gmpif4-qm gene-edited mutant strain obtained in Example 1 was used, with soybean material Williams 82 as a wild-type control, to verify the biological functions of the soybean genes GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d. gmpif4-qm (a mixture of four mutant strains) and Williams 82 were planted in soybean monoculture and soybean-corn strip-like composite plantings, respectively. The morphological traits of the two at maturity were quantitatively analyzed in terms of plant height, stem diameter, number of branches, number of pods per plant, number of grains per plant, and 100-grain weight. Specific data are as follows: Figure 4 and as shown in Table 1.

[0119] Among them, soybean monoculture includes: planting gmpif4-qm and Williams 82 as monoculture, planting 4 rows in each plot, with a row spacing of 40 cm, a row length of 1 m, a plant spacing of 13 cm, a plot spacing of 50 cm, and a plot area of 9 m 2 The planting density was about 10,000 plants per mu. Randomized block experiments were used in all plots, and the experiment was repeated three times.

[0120] The soybean-corn strip intercropping system includes: 4 rows of soybeans intercropped with 2 rows of corn (4:2) with a row spacing of 70 cm between corn and soybeans, a row spacing of 40 cm between corn and soybeans, a row spacing of 30 cm between soybeans, a row length of 3 m, a plant spacing of 10 cm, a plot spacing of 50 cm, and 3 production units with a plot area of 9 m 2 The planting density was about 9,800 plants per mu. Randomized block experiments were used in all plots, and the experiment was repeated three times.

[0121] Among them, compared with soybean monoculture, in the soybean-corn strip intercropping model, corn occupies a higher ecological niche and provides shade to soybeans in a lower ecological niche. The impact of shading is mainly reflected in the middle and late stages of crop growth.

[0122] Planting for the 2023 crop was completed on July 10, 2023, with harvest around November 7. Planting for the 2024 crop was completed on June 26, 2024, with harvest around November 2. Conventional fertilization, weeding, and insecticide application were carried out according to the corn-soybean intercropping system. For strip intercropping, 50 kg / mu of nitrogen, phosphorus, and potassium (25-5-10) was used at corn planting.

[0123] The results showed that, whether in soybean monoculture or soybean-corn strip intercropping (4:2 soybean-corn intercropping), the gmpif4-qm mutant strain showed a lower plant height, an increased number of effective branches (branches that can produce pods are effective branches, while branches that do not produce pods are ineffective branches), and a thicker main stem diameter (e.g., Figure 2 As shown), and the significance of the soybean-corn intercropping pattern reached an extremely significant level, and the number of pods per plant increased. At the same time, the number of grains per plant also increased, reaching a significant level under the soybean monoculture pattern, and there was no significant difference in the 100-grain weight under the monoculture and intercropping patterns. From the comprehensive yield data, it can be seen that the yield of the gmpif4-qm mutant strain of the present application has increased under monoculture or intercropping with corn. Therefore, knocking out the GmPIF4s gene in soybeans through genetic engineering technology can change the plant type development and increase yield, and its anti-lodging advantage is more obvious under the shade of composite corn planting, thus highlighting the yield advantage.

[0124] Soybean lodging resistance is reflected in lower plant height, increased stem thickness, and greater stem bending resistance. The specific method for testing stem bending resistance is as follows: Four soybean plants with consistent growth were selected from each treatment. The stem bending resistance was measured using a YYD-1 stem strength tester (Zhejiang Top Instrument Co., Ltd.). The stem was cut 20 cm above the cotyledon scar and placed in the groove below the stem strength tester (10 cm apart). The pressure sensor was aligned with the center of the stem. The handle of the pressure sensor was held firmly and pressed vertically downward at a steady speed until the stem broke. The value displayed on the instrument screen was the maximum pressure required to break the stem, which was recorded as the soybean bending resistance.

[0125] Table 1 Statistics of morphological traits of soybean material gmpif4-qm under soybean monoculture and corn-soybean intercropping

[0126]

[0127] Note: * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.

[0128] Yield (kg / mu) = number of grains per plant * 100-grain weight (g) / 100 * number of effective plants / 1000. Yield per mu is converted according to the yield of the plot.

[0129] Yield ratio to monocropping = yield under soybean-corn intercropping / yield under soybean monocropping.

[0130] Example 3 Functional Verification of the GmPIF4s Gene in Soybean Monoculture at Different Planting Densities

[0131] As the density increases, the intraspecific competition of crops intensifies, which destroys the relationship between the vegetative growth and reproductive growth of the plants, resulting in lodging and yield reduction. Therefore, this example experiments on the growth status of the gmpif4-qm mutant strain at different planting densities. Using the homozygous gmpif4-qm gene-edited mutant strain obtained in Example 1, the soybean material Williams 82 was used as a wild-type control to verify the biological functions of the soybean genes GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d. Gmpif4-qm and Williams 82 were treated as soybean monocultures at different planting densities, and their morphological traits at maturity were quantitatively analyzed in terms of plant height, stem thickness, number of branches, number of internodes, number of pods per plant, number of grains per plant, and 100-grain weight. The specific data are as follows. Figure 5 As shown in Table 2. The soybean main stem consists of nodes and internodes. The node is the part where the axillary buds are born in the leaf axil, and the part between adjacent nodes is called internode.

[0132] This example adopts soybean monoculture, with 6 rows planted in each plot, 50 cm row spacing, 3 m row length, 1 m spacing between plots, and a plot area of 9 m 2 Three soybean plant spacings (13.3 cm, 8.9 cm, and 6.7 cm) were set, corresponding to three density conditions (approximately 10,000 plants / mu, approximately 15,000 plants / mu, and approximately 20,000 plants / mu). The experiment was replicated three times, and all plots were randomized block experiments. The treatments performed during the soybean monoculture period in this example were the same as those in Example 2, and the planting time was similar.

[0133] Planting density statistics show that the number of plants in the plot under the first density is 136, and the planting density is 10,000 plants / mu; the number of plants in the plot under the second density is 198, and the planting density is 15,000 plants / mu; the number of plants in the plot under the third density is 268, and the planting density is 20,000 plants / mu.

[0134] The results showed that the four strains of soybean material gmpif4-qm mutant all showed lower plant height than wild type and more effective branches than wild type (such as Figure 3 As shown in the figure, the soybeans are more tolerant to dense planting and have higher yields under high-density planting. Therefore, knocking out the GmPIF4s gene through genetic engineering can alter plant development and provide ideas for further optimizing plant height, branching, and fruit set, thereby improving the planting population and structure of soybean plants. Fruit set refers to the fact that in soybeans, an appropriate plant height is conducive to photosynthesis and ventilation and light transmission. Generally, a plant height of 70-100 cm is more suitable; the number of internodes on the main stem is 15-20, indicating good fruit set; and a high number of grains per pod indicates that the plant has an adequate nutrient supply and good fruit set.

[0135] Table 2 Statistics of morphological traits of soybean material gmpif4-qm under different density conditions

[0136]

[0137] Note: * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001.

[0138] Yield = number of grains per plant * weight of 100 grains (g) / 100 * number of effective plants / 1000 = *** (kg / mu), and the yield per mu is converted according to the yield of the plot.

[0139] GMPIF4-QM yield increase rate = (GMPIF4-QM yield - Williams 82 yield) / Williams 82 yield.

[0140] Plant height increased with increasing planting density, but the degree of increase was significantly lower than that of the wild type. Branch number decreased slightly with increasing planting density, but the degree of change was significantly lower than that of the wild type. Compared with the wild type, the higher the planting density, the more obvious the yield increase effect.

[0141] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: performing a loss-of-function mutation on the GmPIF4s gene can significantly increase the number of branches in soybean plants, reduce the plant height of soybean plants, and thus increase the planting density of soybean plants, thereby optimizing soybean growth conditions, increasing soybean crop yield and soybean plant stress resistance. This provides strong technical support for soybean breeding, improves the geographical restrictions of soybean cultivation in my country, and provides a certain degree of support for nationwide soybean cultivation.

[0142] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. An application of soybean gene GmPIF4s in soybean breeding, characterized in that: The applications include: Mutating the soybean gene GmPIF4s in soybeans to obtain soybean plants with GmPIF4s gene mutations; The soybean gene GmPIF4s includes GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d, whose nucleotide sequences are shown in SEQ ID NOs: 1-4, respectively.

2. The use according to claim 1, characterized in that The nucleotide coding sequence of GmPIF4a is shown in SEQ ID NO: 5; The nucleotide coding sequence of GmPIF4b is shown in SEQ ID NO: 6; The nucleotide coding sequence of GmPIF4c is shown in SEQ ID NO: 7; The nucleotide coding sequence of GmPIF4d is shown in SEQ ID NO:

8.

3. The use according to claim 1, characterized in that The amino acid sequences of the proteins encoded by the GmPIF4a, the GmPIF4b, the GmPIF4c and the GmPIF4d are shown in SEQ ID NOs: 9-12.

4. The use according to claim 1, characterized in that The mutation treatment of the soybean gene GmPIF4s includes causing the function of the protein encoded by the soybean gene GmPIF4s to be lost.

5. The use according to claim 1, characterized in that The soybean gene GmPIF4s is mutated using gene editing.

6. The use according to claim 5, characterized in that The gene editing is performed using CRISPR / Cas9 technology.

7. The use according to claim 4, characterized in that The soybean gene GmPIF4s is subjected to mutation treatment, including: Construct soybean gene GmPIF4s recombinant knockout vector, Transforming the soybean gene GmPIF4s knockout vector into soybeans to obtain transgenic soybean plants; Homozygous mutation analysis is performed on the transgenic soybean plant to obtain the GmPIF4s gene mutant soybean plant.

8. The use according to claim 7, characterized in that The soybean gene GmPIF4s recombinant knockout vector contains the sgRNA sequence shown in SEQ ID NOs: 21-24.

9. The use according to claim 7, characterized in that The homozygous mutation analysis was performed by PCR amplification and sequencing of the knockout target site.

10. The use according to claim 1, characterized in that The GmPIF4s gene mutant soybean plant has reduced plant height and increased branch number.

Citation Information

Patent Citations

  • Plants having enhanced yield-related traits and a method for making the same

    CN102686604A

  • Application of knockout soybean GmDMEb gene in increasing soybean plant branch number and increasing soybean yield

    CN118531048A

  • Methods and compositions for short stature modification

    WO2025076436A1

  • Gene and method for producing high-yield soybeans with prolific flowering and podding, and use thereof

    WO2025130300A1