Application of soybean gene GmPIF4s in soybean breeding

Abstract

The application provides application of a soybean gene GmPIF4s in soybean breeding and relates to the technical field of genetic engineering. The application comprises the following steps: performing mutation treatment on the soybean gene GmPIF4s in soybean to obtain a GmPIF4s gene mutant soybean plant; wherein the soybean gene GmPIF4s comprises GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d whose nucleotide sequences are shown in SEQ ID NOs:1-4 respectively. The soybean gene GmPIF4s in soybean is mutated to make it lose gene function, and the obtained mutant soybean plant has the phenotype of reduced plant height and increased branch number, and can tolerate dense planting in actual soybean planting to obtain soybean with high yield.

Description

TECHNICAL FIELD

[0001] The application relates to the field of genetic engineering, in particular to application of a soybean gene GmPIF4s in soybean breeding. BACKGROUND

[0002] Soybean is an important food, oil and forage crop in China. Soybean is rich in protein, and the protein yield accounts for 64.78% of the protein yield of the world's eight major crops and about 35% of the world's oil crop yield. It is one of the most important plant protein and edible oil sources for Chinese people in all ages and people all over the world. In recent years, the gap of soybean in China has been increasing, and the import volume in 2020 broke through 100 million tons, the international dependence was as high as 87%, which seriously threatened food security. Therefore, further research on the genetic breeding mechanism and cultivation mechanism of high-yield soybean, and promotion of the process of breeding new varieties of soybean with breakthrough high yield, are of great significance to promote the stable and high yield of soybean, meet the increasing demand of the public for soybean, and ensure the safety of China's agriculture and food.

[0003] Plant height and branching are important morphological indicators related to soybean yield. The application of semi-dwarf genes in wheat and rice breeding has bred dwarf and semi-dwarf varieties with enhanced resistance to lodging, thereby increasing their yield by several times. In soybean production, plant height is often reduced by applying growth regulators such as paclobutrazol, uniconazole, and methyl piperidinium, to increase resistance to lodging. However, the application of exogenous chemicals can partially solve the production problem, but the high cost and residues in the soil pose a hidden danger to the production of the next crop.

[0004] Currently, genes related to soybean plant height and branching development have been cloned. In terms of plant height, soybean Dt1 (homologous gene of Arabidopsis TERMINAL FLOWER1 (TFL1)) and Dt2 (encoding a MADS domain-containing transcription factor) are reported to be key genes determining plant height and growth habit. Among them, Dt2 can directly bind to the promoter region of Dt1 and inhibit its expression. The auxin transport carrier protein PINFORMED1 (GmPIN1) in soybean can mediate asymmetric auxin distribution at the petiole, and asymmetric auxin concentration in turn regulates asymmetric cell swelling, determining the formation of soybean petiole angle. The Gmpin1abc triple mutant and Gmpin1bc double mutant of soybean both exhibit phenotypes such as straight growth of leaves and compact plant type. Soybean RIN1 interacts with STF1 / STF2 (homologous gene of Arabidopsis ELONGATED HYPOCOTYL 5) and induces the degradation of STF1 / STF2 protein, resulting in the inhibition of the induction of STF1 / STF2 on GA2ox7a / GA2ox7b, thereby increasing the content of endogenous gibberellin GA1 and inducing the elongation of soybean internode distance. The gene CRYPTOCHROME 1 (GmCRY1) encoding the blue light receptor of soybean regulates the density tolerance of soybean by regulating gibberellin metabolism. In terms of branching, through the study of the homologous gene of Arabidopsis SQUAMOSA Promoter-Binding Protein-Like 9 (SPL9) in soybean, it is found that the quadruple mutant with simultaneous knockout of GmSPL9 function can lead to more branches in soybean. microRNA156 (miR156) controls soybean plant type by post-transcriptional regulation of GmSPL9, and overexpression of miR156b can significantly increase the number of branches, nodes, pods and hundred-grain weight of soybean, greatly improving the yield per plant of soybean.

[0005] In addition, reasonable planting density is also a key link to achieve high yield of soybean. In the actual planting scene of soybean, the increase of soybean planting density or the compound planting with corn makes the plant height and internode length of soybean show an increasing trend, and the node number of the main stem of soybean shows a decreasing trend. Too high planting density and too strong shading will lead to excessive growth and lodging of soybean, resulting in yield reduction and quality deterioration.

[0006] Therefore, the present application aims to provide an application of a gene that can effectively improve the yield of soybean, promote the breeding of high-yield varieties with density tolerance, establish a reasonable soybean planting mode, and provide an important theoretical basis for reasonable density planting of soybean with high yield. SUMMARY

[0007] The main purpose of the present application is to provide an application of soybean gene GmPIF4s in soybean planting, so as to provide a new gene which can increase soybean yield by reducing plant height and increasing branch number.

[0008] In order to achieve the above-mentioned purpose, according to the first aspect of the present application, an application of soybean gene GmPIF4s in soybean breeding is provided, and the application comprises: performing mutation treatment on the soybean gene GmPIF4s in soybean to obtain a GmPIF4s in a genetically mutated soybean plant; wherein the soybean gene GmPIF4s comprises GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d whose nucleotide sequences are respectively shown as SEQ ID NOs: 1-4.

[0009] Further, the nucleotide coding sequence of GmPIF4a is shown as SEQ ID NO: 5; the nucleotide coding sequence of GmPIF4b is shown as SEQ ID NO: 6; the nucleotide coding sequence of GmPIF4c is shown as SEQ ID NO: 7; and the nucleotide coding sequence of GmPIF4d is shown as SEQ ID NO: 8.

[0010] Further, the amino acid sequences of the proteins encoded by GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d are shown as SEQ ID NOs: 9-12.

[0011] Further, the mutation treatment on the soybean gene GmPIF4s comprises loss of function of the encoded protein.

[0012] Further, the mutation treatment on the soybean gene GmPIF4s is performed by gene editing.

[0013] Further, the gene editing is performed by CRISPR / Cas9 technology.

[0014] Further, the mutation treatment on the soybean gene GmPIF4s comprises: constructing a recombinant knockout vector of the soybean gene GmPIF4s, transforming the recombinant knockout vector of the soybean gene GmPIF4s into soybean to obtain a transgenic soybean plant; and performing homozygous mutation analysis on the transgenic soybean plant to obtain a GmPIF4s in a genetically mutated soybean plant.

[0015] Further, the soybean gene GmPIF4s in the recombinant knockout vector comprises sgRNA sequences shown as SEQ ID NOs: 21-24.

[0016] Further, the homozygous mutation analysis is performed by a method of PCR amplification and sequencing on the knockout target.

[0017] Further, the GmPIF4s in the genetically mutated soybean plants are soybean plants with reduced plant height and increased branch number.

[0018] By applying the technical solution of the present application, the soybean gene GmPIF4s in soybean is mutated to lose its gene function, and the obtained genetically mutated soybean plants have the phenotype of reduced plant height and increased branch number, and can tolerate dense planting in actual soybean planting to obtain high-yield soybean. BRIEF DESCRIPTION OF DRAWINGS

[0019] The drawings constituting a part of the specification illustrate the present application further, the schematic embodiments of the present application and the description thereof are used to explain the present application, and do not constitute improper limitation on the present application. In the drawings:

[0020] Figure 1 The main structure schematic diagram of the recombinant vector pCBSG015 (Basta) used in the present application is shown;

[0021] Figure 2 The phenotype of gmpif4-qm and Williams 82 in soybean monoculture and soybean-corn strip intercropping to the mature stage in Example 2 of the present application is shown;

[0022] Figure 3 The phenotype of gmpif4-qm in different density planting to the mature stage in Example 3 of the present application is shown;

[0023] Figure 4 The statistical diagram of the parameter data of gmpif4-qm and Williams 82 in soybean monoculture and soybean-corn strip intercropping to the mature stage in Example 2 of the present application is shown;

[0024] Figure 5 The statistical diagram of the parameter data of gmpif4-qm in different density planting to the mature stage in Example 3 of the present application is shown;

[0025] Figure 6 The sgRNA sequence and position schematic diagram of the soybean gene GmPIF4s in the present application are shown;

[0026] Figure 7 The result diagram of mRNA level detection of gmpif4-qm mutant strain in Example 1 of the present application is shown. DETAILED DESCRIPTION

[0027] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to the drawings and in combination with the embodiments.

[0028] As mentioned in the background, the prior art uses exogenous application of compounds for breeding soybeans with high resistance to stem strengthening and lodging, but growth agents and the like cannot achieve better results and also cause certain harm to the environment. Therefore, the present application provides a new application of a gene capable of improving soybean yield in soybean breeding.

[0029] The first typical technical solution of the present application provides an application of a soybean gene GmPIF4s in soybean breeding, which comprises: performing mutation treatment on the soybean gene GmPIF4s in soybeans to obtain a GmPIF4s gene mutant soybean plant; wherein the soybean gene GmPIF4s comprises GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d having nucleotide sequences as shown in SEQ ID NOs: 1-4, respectively.

[0030] Based on the RNA-seq data, the applicant takes the cDNA of Williams 82 as a template, takes Arabidopsis PIF4 as a homologous gene, finds four homologous genes (Glyma.02G282100: GmPIF4a; Glyma.08G303900: GmPIF4b; Glyma.18G115700: GmPIF4c; Glyma.14G032200: GmPIF4d) of GmPIF4s through NCBI. The soybean gene GmPIF4s comprises the above four homologous genes and plays an important role in the light and temperature signal transduction pathway of soybeans. After phenotype analysis of the four genes, it is found that the mutant strains (gmpif4-qm) after knockout of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d have the phenotypes of reduced plant height and increased branch number. The soybean plants with such phenotypes can obtain higher yield of soybean planting results under the conditions of dense planting or co-planting with corn having higher plant height, thereby providing certain technical support for soybean breeding.

[0031] The nucleotide sequence of the above soybean gene GmPIF4s has an intron structure (as shown in Figure 6 In a preferred embodiment, the nucleotide coding sequence (CDS sequence) of GmPIF4a is as shown in SEQ ID NO: 5; the nucleotide coding sequence of GmPIF4b is as shown in SEQ ID NO: 6; the nucleotide coding sequence of GmPIF4c is as shown in SEQ ID NO: 7; and the nucleotide coding sequence of GmPIF4d is as shown in SEQ ID NO: 8.

[0032] The amino acid sequence of the protein encoded by the soybean gene GmPIF4s is shown in SEQ ID NOs: 9-12 in a preferred embodiment.

[0033] The mutation treatment in the present application is gene knockout, which is achieved by randomly / directionally destroying the DNA sequence of a specific gene, resulting in mutation of the protein encoded by the gene and partial / complete loss of the original function. In a preferred embodiment, the mutation treatment of the soybean gene GmPIF4s includes loss of function of the protein encoded by the soybean gene GmPIF4s.

[0034] Any technology capable of gene mutation treatment is suitable for the present application, such as transgenic technology, gene overexpression technology, gene silencing technology, RNA interference technology, or chromosome engineering, etc. In a preferred embodiment, the mutation treatment of the soybean gene GmPIF4s is performed by gene editing.

[0035] Any technology capable of gene editing is suitable for the present application, such as ZFNs (zinc finger nuclease), TALENs (transcription activator-like effector nuclease), etc. In a preferred embodiment, the gene editing is performed by CRISPR / Cas9 technology.

[0036] The target guide RNA of the gene to be knocked out in the present application is introduced into soybean by constructing a CRISPR / Cas9 system expression vector. In a preferred embodiment, the mutation treatment of the soybean gene GmPIF4s includes: constructing a soybean gene GmPIF4s recombinant knockout vector, transforming the soybean gene GmPIF4s recombinant knockout vector into soybean to obtain transgenic soybean plants; performing homozygous mutation analysis on the transgenic soybean plants to obtain GmPIF4s gene mutant soybean plants.

[0037] To further efficiently knockout the soybean gene GmPIF4s in the present application, in a preferred embodiment, the soybean gene GmPIF4s recombinant knockout vector comprises sgRNA sequences shown in SEQ ID NOs: 21-24. The sgRNA sequence can be designed using the Huazhong CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and a target with high target score and low off-target rate is selected. The positions of the target points corresponding to the sgRNA sequences (SEQ ID NOs: 21-24) in the gene are shown in SEQ ID NOs: 25-28. Figure 6 For convenience in marking in the gene structure of Figure 6 , the positions of the target points corresponding to the sgRNA sequences (SEQ ID NOs: 21-24) in the gene are shown in SEQ ID NOs: 25-28. Figure 6SEQ ID NO: 36 is the complement of the sgRNA sequence shown in SEQ ID NO: 23.

[0038] sgRNA common target 1 for GmPIF4a, GmPIF4b genes (SEQ ID NO: 21):

[0039] ATGGAAACAAGGCTTCTCAGCGG.

[0040] sgRNA common target 2 for GmPIF4a, GmPIF4b genes (SEQ ID NO: 22):

[0041] ATAGGATCAACGAGAAGATGAGG.

[0042] sgRNA common target 1 for GmPIF4c, GmPIF4d genes (SEQ ID NO: 23):

[0043] GTTCCAATGGATCCTCAAGAGGG.

[0044] sgRNA common target 2 for GmPIF4c, GmPIF4d genes (SEQ ID NO: 24):

[0045] AAGATGATGAGACAGTCTCATGG.

[0046] In order to facilitate subsequent genetic stability evaluation and trait phenotype analysis, homozygous mutant strains are screened from the mutant strains. In a preferred embodiment, homozygous mutation analysis is performed by PCR amplification and sequencing of the knockout target. The method for PCR amplification of the knockout target includes amplifying the knockout target in the transgenic soybean plant with primers (such as those shown in SEQ ID NOs: 28-35), and sequencing the amplified fragment containing the knockout target. If the sequencing information obtained is that the GmPIF4a, GmPIF4b, GmPIF4c, GmPIF4d genes are all sequencing single peaks and have base mutations compared with the wild type, it indicates that the GmPIF4s gene in the quadruple mutant has been mutated, the mutation causes premature termination of protein translation, and thus leads to loss of gene function. Therefore, the transgenic soybean plant is a homozygous quadruple mutant gmpif4-qm.

[0047] The soybean plant obtained after knocking out the above-mentioned soybean gene GmPIF4s has the phenotypes of reduced plant height and increased branch number. In a preferred embodiment, the GmPIF4s gene mutant soybean plant is a soybean plant with reduced plant height and increased branch number. The soybean plant with reduced plant height and increased branch number further exhibits tolerance to high-density planting. The standard for reduced plant height and increased branch number is whether the data of plant height / branch number of the soybean plant is significantly different (P≤0.05) from the data of plant height / branch number of the wild type. High-density tolerance refers to the tolerance of a plant to a high-density environment. In a high-density environment, adjacent plants block each other, resulting in a decrease in red and blue light in the lower part of the canopy, weak shade-avoidance response of the plant, and reduced yield. However, the plant of the present application can exhibit stronger growth potential and higher yield potential under high-density planting conditions, and is particularly suitable for multi-layer cultivation systems or crop rotation systems, which helps to solve the problem of land resource shortage in agricultural production.

[0048] The present application will be further described in detail below in combination with specific examples, which should not be construed as limiting the scope of the present application.

[0049] The soybean material Williams 82 used in the embodiments of the present application was planted in the transgenic base of the Qizhou base of the Modern Agricultural Research Institute of Peking University.

[0050] Example 1 Cloning of gene GmPIF4s and obtaining of knockout plant

[0051] 1.1 Cloning of gene GmPIF4s

[0052] (1) The full-length nucleotide sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d were obtained by bioinformatics means using phytozome (https: / / phytozome-next.jgi.doe.gov / ), as shown in SEQ ID NOs: 1-4.

[0053] (2) The cDNA sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d were amplified using the full-length nucleotide sequences of GmPIF4a, GmPIF4b, GmPIF4c, and GmPIF4d as templates.

[0054] (3) The soybean material Williams 82 was used as the genetic background, and the cDNA of Williams 82 was used as the template to clone the CDS sequence of gene GmPIF4s using KOD polymerase and the corresponding primers (as shown in SEQ ID NOs: 13-20).

[0055] The total volume of the total reaction system was 50 μL, the template (Williams 82 cDNA) was 1 μL (about 50 ng), 10 x KOD buffer was 5 μL, 25 mM MgCL2 was 2 μL, 5 mM dNTP was 5 μL, 10 μM F primer and R primer were 5 μL (2.5 μL for each primer), 1 μL KOD FX, and ddH20 (sterile deionized water) was added to 50 μL. The reaction program was denaturation at 94°C for 5 min, 94°C for 30 s, 62°C for 1 min, 68°C for 1 min for 35 cycles, and extension at 68°C for 10 min.

[0056] The amplified product was recovered for sequencing analysis, and the CDS sequences of the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes were obtained, as shown in SEQ ID NOs: 5-8, and the encoded amino acid sequences were as shown in SEQ ID NOs: 9-12, respectively.

[0057] The above primers are:

[0058] GmPIF4a-F (SEQ ID NO: 13):

[0059] TGGCCATGGAGGCCGAATTCATGAACAACAGTATTCCTGGTTGG (with an EcoR1 enzyme cutting site).

[0060] GmPIF4a-R (SEQ ID NO: 14):

[0061] CGCTGCAGGTCGACGGATCCTCAATTAAAGGTGGAAGAACCCG (with a BamH1 enzyme cutting site).

[0062] GmPIF4b-F (SEQ ID NO: 15):

[0063] TGGCCATGGAGGCCGAATTCATGAACAACAGTGTTCCT (with an EcoR1 enzyme cutting site).

[0064] GmPIF4b-R (SEQ ID NO: 16):

[0065] CGCTGCAGGTCGACGGATCCTCAATTTGTTGTTAGCCAA (with a BamH1 enzyme cutting site).

[0066] GmPIF4c-F (SEQ ID NO: 17):

[0067] TGGCCATGGAGGCCGAATTCATGAACAACAGTGTTCCTGATTGGA (EcoR1 enzyme cutting site is added).

[0068] GmPIF4c-R (SEQ ID NO: 18):

[0069] CGCTGCAGGTCGACGGATCCTTAACCCATTTTGCCACTCACAGC (BamH1 enzyme cutting site is added).

[0070] GmPIF4d-F (SEQ ID NO: 19):

[0071] TGGCCATGGAGGCCGAATTCATGAAGAACAGTATTCCTGGTTTGG (EcoR1 enzyme cutting site is added).

[0072] GmPIF4d-R (SEQ ID NO: 20):

[0073] CGCTGCAGGTCGACGGATCCTCAGTTAAAGGTGGAAGAACCTG (BamH1 enzyme cutting site is added).

[0074] 1.2 Obtaining of GmPIF4s knockout plants

[0075] 1.2.1 Construction of knockout vector

[0076] With soybean genes GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d (as shown in SEQ ID NOs: 1-4) as templates, target sequences suitable for gene editing were designed to obtain sgRNAs as shown in SEQ ID NOs: 21-24, which were constructed into pCBSG015 (Basta) vectors (purchased from Genwise Biotech, vector structure as shown in Figure 1 SEQ ID NO: 28) to verify whether the plasmid construction of the recombinant vector is accurate. The upstream and downstream sequencing primers are set on the vector backbone, and the middle sequencing primer is set on the target of one of the genes, and whether the target is successfully constructed is verified by PCR amplification and sequencing.

[0077] PCR amplification product sequencing of the constructed recombinant plasmid pCBSG015 (Basta) was performed using the following primers to confirm whether the recombinant plasmid construction is correct:

[0078] Upstream sequencing primer (SEQ ID NO: 25): TCCCAGTCACGACGTTGTAA.

[0079] Intermediate sequencing primer (SEQ ID NO: 26): TGGAAACAAGGCTTCTCA.

[0080] Downstream sequencing primer (SEQ ID NO: 27): GCCATTTGTCTGCAGAATTG.

[0081] 1.2.2 Genetic transformation of soybean Williams 82 and screening and identification of GmPIF4s knockout plant

[0082] The above recombinant plasmid is transformed into soybean Williams 82 by a CRISPR-Cas9 gene knockout system to obtain a quadruple mutant gmpif4-qm. The core steps include: construction of a recombinant plasmid → preparation of Agrobacterium → preparation of sensitive explants (such as immature cotyledons) → Agrobacterium infection of explants and co-culture (T-DNA transfer) → bacteriostasis → screening culture (obtain resistant callus / embryo) → somatic embryogenesis and plant regeneration → rooting and transplanting → molecular identification → screening of offspring to obtain homozygous transgenic lines.

[0083] When identifying the mutant, young leaf tissue of the regenerated plant is taken to extract genomic DNA, and PCR amplification of the knockout target (amplification primers are shown as SEQ ID NOs: 28-35) and first-generation sequencing technology are used to verify the mutation type of the quadruple mutant. The sequencing results confirm that GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d are cut and broken, resulting in frame shift mutation, premature termination and other mutation types, thereby losing gene function.

[0084] GmPIF4a-F knockout identification primer (SEQ ID NO: 28):

[0085] GAGAAAAGGGACAGAAGAAGAAGCGTTA.

[0086] GmPIF4a-R knockout identification primer (SEQ ID NO: 29):

[0087] CTTACGACATCCATCCGAATC.

[0088] GmPIF4b-F knockout identification primer (SEQ ID NO: 30):

[0089] GGTAGTGCACAGCCAAACT.

[0090] GmPIF4b-R knockout identification primer (SEQ ID NO: 31):

[0091] GGCCGGTATAGGAATTCCTGAGAAA.

[0092] GmPIF4c-F knockout identification primer (SEQ ID NO: 32):

[0093] GTGGACCAAGAGCTTGTAGAGCTTCA.

[0094] GmPIF4c-R knockout identification primer (SEQ ID NO: 33):

[0095] GTTTCAGTCACATGGGGGGTACTAGAG.

[0096] GmPIF4d-F knockout identification primer (SEQ ID NO: 34):

[0097] GTGTCCAGAGACCAATTTGTCCTAGGAG.

[0098] GmPIF4d-R knockout identification primer (SEQ ID NO: 35):

[0099] TGATTTTGGCACATTAAATTCTGGTTTGGC.

[0100] After identifying the regenerated plants, 13 hybrid mutant T0 generation plants were obtained, each of which had mutations in the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes.

[0101] The hybrid material was then separated by further planting, and all hybrid seeds of the T0 generation were sown, and after the seedlings grew, PCR amplification and sequencing identification were performed, and each generation was identified in this way until the homozygous gmpif4-qm was obtained, at which time the GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d four gene target sequencing were all single peak and had base mutations. Finally, four homozygous gmpif4-qm gene editing mutant strains were obtained.

[0102] The four homozygous gmpif4-qm gene editing mutant strains were Gmpif4-qm 1# , Gmpif4-qm 2# , Gmpif4-qm 3# and Gmpif4-qm 4# , wherein Gmpif4-qm 1#The specific CDS sequences of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown as SEQ ID NOs: 45-48, and the specific mutation types are as follows: the GmPIF4a gene has a deletion of TC at positions 1050-1051 (-2 bp) and a deletion of 15 bp long bases at positions 1138-1152 (-15 bp); the GmPIF4b gene has a deletion of TC at positions 196-197 (-2 bp) and a deletion of CTTGAG at positions 214-219 (-6 bp); the GmPIF4c gene has a deletion of G at position 1137 (-1 bp); and the GmPIF4d gene has a deletion of TC at positions 268-269 (-2 bp) and a deletion of CTTGAGGAT at positions 287-295 (-9 bp).

[0103] Gmpif4-qm 2# The specific CDS sequences of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown as SEQ ID NOs: 49-52, and the specific mutation types are as follows: the GmPIF4a gene has a deletion of TC at positions 1050-1051 (-2 bp) and a deletion of 15 bp long bases at positions 1138-1152 (-15 bp); the GmPIF4b gene has a deletion of TC at positions 196-197 (-2 bp) and a deletion of CTTGAG at positions 214-219 (-6 bp); the GmPIF4c gene has a deletion of GAAGA at positions 1134-1138 (-5 bp); and the GmPIF4d gene has an addition of 42 bp long bases at positions 267-308 (+42 bp) and a deletion of 25 bp long bases (-25 bp).

[0104] Gmpif4-qm 3# The specific CDS sequences of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown as SEQ ID NOs: 53-56, and the specific mutation types are as follows: the GmPIF4a gene has a deletion of TC at positions 1050-1051 (-2 bp) and a deletion of 15 bp long bases at positions 1138-1152 (-15 bp); the GmPIF4b gene has a deletion of CAGTC at positions 191-195 (-5 bp) and a deletion of GAGGAT at positions 217-222 (-6 bp); the GmPIF4c gene has a deletion of GAAGA at positions 1134-1138 (-5 bp); and the GmPIF4d gene has an addition of 42 bp long bases at positions 267-308 (+42 bp) and a deletion of 25 bp long bases (-25 bp).

[0105] Gmpif4-qm 4#The specific CDS sequences of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes are shown as SEQ ID NOs: 57-60, and the specific mutation types are as follows: deletion of G at position 1137 of GmPIF4a gene (-1 bp); deletion of 19 bp long bases at positions 180-198 of GmPIF4b gene (-19 bp), and addition of T in the middle of positions 216-217 (+1 bp); deletion of TC at positions 1050-1051 of GmPIF4c gene (-2 bp), and deletion of G at position 1137 (-1 bp); deletion of TC at positions 268-269 of GmPIF4d gene (-2 bp), and deletion of CTTGAG at positions 286-291 (-6 bp).

[0106] Gmpif4-qm 1# , Gmpif4-qm 2# , Gmpif4-qm 3# , Gmpif4-qm 4# All the lines have the phenotypes of reduced plant height and increased branching. The homozygous gmpif4-qm gene editing mutant lines were taken for the phenotype observation and functional test in Examples 2-3.

[0107] Meanwhile, the mRNA level of the four homozygous gmpif4-qm quadruple mutant lines was detected. When the four homozygous gmpif4-qm quadruple mutant lines were cultured to the third trifoliate leaf, the tender roots, stems and leaves of the four gmpif4-qm were taken, mixed and ground in liquid nitrogen. According to the RNA extraction kit of Novagen, the RNA was extracted, and the reverse transcription kit of the company was used for reverse transcription to obtain the cDNA of the gmpif4-qm roots, stems and leaves. Then specific qRT-PCR primers were designed to determine the expression amount of the four GmPIF4 genes in the gmpif4-qm roots, stems and leaves. The results are shown in Table 2. Figure 7 As can be seen from Table 2, the expression levels of GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d genes in the root, stem and leaf tissues of the quadruple mutant lines were significantly lower than those of the wild type. The primers used for identification are shown as SEQ ID NOs: 37-44:

[0108] mRNA detection primer 08-qPCR-F (SEQ ID NO: 37): CTAGACCGCCTTTCCCTCCTC.

[0109] mRNA detection primer 08-qPCR-R (SEQ ID NO: 38): TGGGTGTAATCATTGTTTGACTATGTT.

[0110] mRNA detection primer 18-qPCR-F (SEQ ID NO: 39):

[0111] TTCAATCAACATTAAGGACTAGTGAGCCATTTGGG.

[0112] mRNA detection primer 18-qPCR-R (SEQ ID NO: 40): AGATTTCATGGTAGGTGATTGCGAAG.

[0113] mRNA detection primer 02-qPCR-F (SEQ ID NO: 41): GTGATCAATCAGTATTAAGGTCTAGC.

[0114] mRNA detection primer 02-qPCR-R (SEQ ID NO: 42): CAAACTTTTCCTCTTCCAATTGCC.

[0115] mRNA detection primer 14-qPCR-F (SEQ ID NO: 43): CTGATCATTCAACATTAAGGTCTAGT.

[0116] mRNA detection primer 14-qPCR-R (SEQ ID NO: 44): GTAAACTTGTCCTCTTCCAATTGCT.

[0117] Example 2 Verification of the function of GmPIF4s in soybean monoculture and soybean-corn strip interplanting

[0118] Using the homozygous gmpif4-qm gene editing mutant strain obtained in Example 1, the biological function of soybean genes GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d was verified using soybean material Williams 82 as wild type control. gmpif4-qm (4 mutant strains mixed) and Williams 82 were respectively subjected to soybean monoculture and soybean-corn strip interplanting treatment, and the morphological traits of the two at the mature stage were quantitatively analyzed from plant height, stem diameter, branch number, pod number per plant, grain number per plant, and hundred-grain weight. The specific data are shown in Table 1 and Table 2. Figure 4

[0119] ​The soybean monoculture included monoculture of gmpif4-qm and Williams 82, with 4 rows planted in each plot, 40 cm apart, 1 m long, 13 cm apart, and 50 cm between plots. The plot area was 9 m². 2 The planting density was approximately 10,000 plants per acre. All plots were randomized block experiments with three replicates.

[0120] Soybean-corn strip intercropping includes a 4:2 pattern of 4 rows of soybean intercropped with 2 rows of corn. The row spacing between corn and soybean is 70 cm, the row spacing between corn is 40 cm, the row spacing between soybean is 30 cm, the row length is 3 m, the plant spacing is 10 cm, the inter-cell spacing is 50 cm, 3 production units are planted, and the cell area is 9 m². 2 The planting density was approximately 9,800 plants per acre. All plots were randomized block experiments with three replicates.

[0121] Compared with monoculture soybeans, in the soybean-corn strip intercropping pattern, corn occupies a higher ecological niche and provides shade for soybeans in a lower ecological niche. The impact of shading is mainly reflected in the middle and late stages of crop growth.

[0122] Sowing in 2023 was completed on July 10, 2023, and harvesting was around November 7. Sowing in 2024 was completed on June 26, 2024, and harvesting was around November 2. During the planting period, conventional watering, fertilization, weeding, and pest control were carried out according to the corn-soybean intercropping pattern. In the strip intercropping pattern, 50 kg of nitrogen, phosphorus, and potassium (25-5-10) per mu was used when sowing corn.

[0123] The results showed that, regardless of whether soybean was monoculture or soybean-maize strip intercropping (4:2 soybean-maize intercropping), the gmpif4-qm mutant line exhibited lower plant height, more effective branches (potentially pod-bearing branches were considered effective, while non-pod-bearing branches were considered ineffective) and thicker main stem diameter compared to the wild-type Williams 82. Figure 2 As shown in the figure, the soybean-maize intercropping pattern showed a highly significant effect, with an increase in the number of pods per plant. Simultaneously, the number of grains per plant also increased significantly under the soybean monoculture pattern, while there was no significant difference in the 100-grain weight between the monoculture and intercropping patterns. The overall yield data indicate that the gmpif4-qm mutant line of this application showed increased yields under both monoculture and intercropping with maize. Therefore, knocking out the GmPIF4s gene in soybean using genetic engineering technology can alter plant architecture and increase yield. Furthermore, its lodging resistance is more pronounced under the shade of intercropped maize, thus highlighting its yield advantage.

[0124] Among them, the soybean lodging resistance is reflected in lower plant height, increased stem diameter, and greater stem bending resistance. The detection method of stem bending resistance is as follows: in each treatment, 4 soybeans with consistent growth are selected, and a YYD-1 type stem strength tester (Zhejiang Top Instrument Co., Ltd.) is used to detect the stem bending resistance: the 20 cm stem above the cotyledon scar is cut and placed in the groove (the distance between the two ends of the groove is 10 cm) under the stem strength tester, and the pressure sensor is aligned with the middle position of the stem. Hold the handle of the stem strength tester pressure sensor, slowly and evenly vertically press down, until the stem is broken, at which time the value displayed on the instrument display screen is the maximum pressure to break the stem, which is recorded as the bending resistance of soybean.

[0125] Table 1 Morphological trait statistics of soybean material gmpif4-qm under soybean monoculture and corn-soybean intercropping planting

[0126]

[0127] Note: * P≤0.05, ** P≤0.01, *** P≤0.001.

[0128] Yield (kg / acre) = number of plants per 100 * hundred seed weight (g) / 100 * effective plant number / 1000, and the yield per acre is converted according to the plot yield.

[0129] Yield ratio of monoculture = yield under corn-soybean intercropping / yield under soybean monoculture.

[0130] Example 3 Function verification of gene GmPIF4s in soybean monoculture under different planting densities

[0131] As the density increases, intraspecific competition of crops intensifies, which destroys the relationship between plant vegetative growth and reproductive growth, resulting in lodging and yield reduction. Therefore, the growth state of the gmpif4-qm mutant strain under different planting densities was tested in this example. The homozygous gmpif4-qm gene editing mutant strain obtained in Example 1 was used as a wild type control with soybean material Williams 82, and the biological functions of soybean genes GmPIF4a, GmPIF4b, GmPIF4c and GmPIF4d were verified. The gmpif4-qm and Williams 82 were treated with different planting densities of soybean monoculture, and the morphological traits of the two at the mature stage were quantitatively analyzed in terms of plant height, stem diameter, branch number, internode number, pod number per plant, seed number per plant, and hundred seed weight. The specific data are shown in Table 2 and Table 2. Among them, the main stem of soybean is composed of nodes and internodes, and the node is the position where the axillary bud is born at the leaf axil. The part between adjacent nodes is called internode. Figure 5

[0132] ​This example demonstrates monoculture of soybeans, with 6 rows planted in each plot, 50cm apart, 3m long rows, 1m spacing between plots, and a plot area of ​​9m². 2 Three plant spacings (13.3cm, 8.9cm, and 6.7cm) were set for soybeans, corresponding to three density conditions (approximately 10,000 plants / acre, approximately 15,000 plants / acre, and approximately 20,000 plants / acre), respectively. The experiment was conducted in three replicates, with each plot using a randomized block design. The treatments used in this example during soybean monoculture were the same as in Example 2, and the planting time was similar.

[0133] The planting density statistics show that the first density has 136 plants per plot, with a planting density of 10,000 plants per mu; the second density has 198 plants per plot, with a planting density of 15,000 plants per mu; and the third density has 268 plants per plot, with a planting density of 20,000 plants per mu.

[0134] The results showed that all four lines of the soybean material gmpif4-qm mutant exhibited shorter plant height and more effective branches than the wild type (e.g., ...). Figure 3 As shown in the figure, high-density planting results in stronger tolerance to dense planting and higher yields. Therefore, knocking out the GmPIF4s gene through genetic engineering can alter plant development and provide insights for further optimizing soybean plant height, branching, and seed setting, thereby improving the planting population and structure of soybean plants. Seed setting refers to the following: in soybeans, a suitable plant height is beneficial for photosynthesis and ventilation / light penetration; a plant height of 70-100 cm is generally suitable; 15-20 internodes on the main stem indicate good seed setting; and a large number of pods per plant indicates sufficient nutrient supply and good seed setting.

[0135] Table 2. Statistical table of morphological characteristics of soybean material gmpif4-qm under different density conditions.

[0136]

[0137] Note: * P≤0.05, ** P≤0.01, *** P≤0.001.

[0138] Yield = Number of grains per plant * Weight of 100 grains (g) / 100 * Number of effective plants / 1000 = *** (kg / mu), and the yield per mu is calculated based on the yield of the plot.

[0139] gmpif4-qm production increase rate = (gmpif4-qm output - Williams 82 output) / Williams 82 output.

[0140] The higher the cultivation density, the higher the plant height, but the degree of change in plant height is significantly lower than that of the wild type; the number of branches slightly decreases with the increase of density, but the change degree is significantly lower than that of the wild type. Compared with the wild type, the higher the cultivation density, the more obvious the effect of yield increase.

[0141] From the above description, it can be seen that the above-mentioned embodiments of the present application achieve the following technical effects: the loss-of-function mutation treatment of GmPIF4s gene can significantly increase the branch number of soybean plants, reduce the plant height of soybean plants, and further improve the planting density of soybean plants, thereby optimizing the growth conditions of soybean, enhancing the yield of soybean crops and the stress resistance of soybean plants. It provides strong technical support for soybean breeding and improves the regional restriction problem of soybean planting in China, and provides a certain degree of support for the nationwide planting of soybeans.

[0142] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A soybean gene GmPIF4s application in soybean breeding, characterized in that, The applications include: the soybean gene in soybean GmPIF4s a soybean plant having a mutation in the soybean gene GmPIF4s a soybean plant having a mutation in the soybean gene wherein the soybean gene GmPIF4s comprises GmPIF4s , GmPIF4a , GmPIF4b and GmPIF4c the amino acid sequence of the encoded protein of the GmPIF4d , the GmPIF4a , the GmPIF4b and the GmPIF4c are shown in SEQ ID NOs: 9-12. mutating the soybean gene GmPIF4d The mutation treatment includes constructing a recombinant knockout vector for the soybean gene GmPIF4s The mutation treatment includes constructing a recombinant knockout vector for the soybean gene GmPIF4s The mutation treatment includes constructing a recombinant knockout vector for the soybean gene GmPIF4s The mutation treatment includes constructing a recombinant knockout vector for the soybean gene The soybean gene GmPIF4s comprises sgRNA sequences as set forth in SEQ ID NOs: 21-24 in a recombinant knockout vector; The GmPIF4s The genetically modified soybean plants are soybean plants with reduced plant height and increased branch number.

2. Use according to claim 1, characterized in that, The nucleotide coding sequence of the nucleic acid of SEQ ID NO: 5 is shown below: GmPIF4s SEQ ID NO: 5 The GmPIF4a The nucleotide coding sequence is shown in SEQ ID NO:6; The GmPIF4b The nucleotide coding sequence is shown in SEQ ID NO:7; The nucleotide coding sequence of the GmPIF4c is shown as SEQ ID NO:

8.

3. Use according to claim 1, characterized in that, using gene editing on the soybean gene GmPIF4d performing the mutation treatment.

4. Use according to claim 3, characterized in that, GmPIF4s 5. The use according to claim 1, characterized in that, The homozygous mutation analysis is performed on the transgenic soybean plant to obtain the The gene editing is performed using CRISPR / Cas9 technology. genetically mutated soybean plant.

6. Use according to claim 5, characterized in that, GmPIF4s The homozygous mutation analysis is performed by a method of PCR amplification and sequencing of the knockout target.

Images