System and method for detecting group B streptococcus

By targeting crRNA-mediated LbCas12a system that is non-classical PAM sequences and combining single-stranded DNA fluorescent reporter groups, the problem of insufficient efficiency, sensitivity and specificity in the existing Group B Streptococcus detection methods is solved, and high sensitivity detection under low concentration conditions is achieved, suitable for rapid and accurate disease diagnosis.

CN120485398APending Publication Date: 2025-08-15PEKING UNIVERSITY THIRD HOSPITAL (THE THIRD CLINICAL MEDICAL SCHOOL OF PEKING UNIVERSITY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510633086.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing B-group streptococci detection methods cannot take into account the detection efficiency, sensitivity and specificity, especially in low concentration conditions, which is difficult to achieve high sensitivity detection, resulting in extended disease diagnosis time and misjudgment.

Method used

CrRNA-mediated LbCas12a system targeting non-classical PAM sequences is used to mediate LbCas12a system, combine single-stranded DNA fluorescent reporter groups, and react through PCR amplification products to achieve high sensitivity detection of Group B Streptococcus.

Benefits of technology

Under low concentration conditions (10pg), this method significantly improves detection efficiency and accuracy, shortens the detection cycle, reduces experimental costs, reduces misjudgment and misjudgment, and is suitable for fast and accurate disease diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485398A_ABST
    Figure CN120485398A_ABST
Patent Text Reader

Abstract

The invention discloses a group B streptococcus detection system and method, relates to the technical field of biology, and aims to solve the problem that the existing group B streptococcus detection method cannot give consideration to detection efficiency, sensitivity and specificity at the same time. The detection system comprises a PCR amplification product aiming at a cfb gene specific fragment, crRNA, LbaCas12a and a single-chain DNA fluorescent reporter group, the PCR amplification of the specific fragment of the cfb gene comprises a forward / reverse primer GBS-F / R; wherein the sequence of the crRNA is as shown in one of SEQ ID NO: 1 to SEQ ID NO: 4. When a PCR amplification product of a reaction substrate cfb gene is in a low-concentration condition (10pg), high-sensitivity detection can be realized, and the method has the advantage of low-abundance sample detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a detection system and method for group B streptococci. Background Art

[0002] Group B Streptococcus (GBS), also known as Streptococcus, is a common opportunistic pathogen that typically colonizes the lower gastrointestinal tract and urogenital tract. GBS poses a serious threat to pregnant women and newborns, with carrier rates as high as 15%-35% in healthy individuals, who are often asymptomatic. GBS can cause serious infections such as pneumonia, sepsis, and purulent meningitis in neonates, and can even cause miscarriage in immunocompromised women. The risk of complications, disability, and mortality in premature infants increases with the duration of prematurity.

[0003] Common GBS detection methods include bacterial culture, immunoassays, and PCR molecular diagnosis. Bacterial culture is considered the gold standard for GBS detection, but it has the disadvantages of long diagnostic time, complex result interpretation, and cumbersome operating steps, which may delay the optimal time for treatment and lead to premature birth. Immunological analysis based on antigen-antibody reaction has a shorter detection cycle, but slightly lower sensitivity and specificity. Different serotypes of GBS may lead to missed detection, limiting clinical application. Molecular diagnostic methods based on PCR nucleic acid amplification have high sensitivity and specificity, but the equipment is expensive and the operation is complicated, and the requirements for both operators and equipment are very high.

[0004] Therefore, providing a GBS detection method with high sensitivity under low concentration conditions is a technical problem that needs to be solved urgently by those skilled in the art. Summary of the Invention

[0005] In view of the above analysis, the present invention aims to provide a system and method for detecting Group B Streptococcus, so as to solve the problem that existing Group B Streptococcus detection methods cannot simultaneously take into account detection efficiency, sensitivity and specificity.

[0006] The purpose of the present invention is mainly achieved through the following technical solutions:

[0007] On the one hand, the present invention provides a detection system for group B streptococci, which includes a PCR amplification product for a specific fragment of the cfb gene, crRNA, LbaCas12a, and a single-stranded DNA fluorescent reporter group; the PCR amplification of the specific fragment of the cfb gene includes forward / reverse primers GBS-F / R;

[0008] Wherein, the crRNA sequence is shown as one of SEQ ID NO: 1 to SEQ ID NO: 4;

[0009] Furthermore, the crRNA is a crRNA targeting double-stranded DNA containing a non-classical PAM.

[0010] Furthermore, the targeted atypical PAM sequence is 5'-NCCV-3', wherein N is A, T, G or C, and V is A, C or G.

[0011] Furthermore, the sequence of the GBS-F is shown in SEQ ID NO: 5; the sequence of the GBS-R is shown in SEQ ID NO: 6.

[0012] Furthermore, the single-stranded DNA fluorescent reporter group is 5'-FAM-TTATT-BHQ1-3'.

[0013] Furthermore, the concentration of the PCR amplification product of the cfb gene specific fragment is 10 pg.

[0014] Another aspect of the present invention provides a method for detecting Group B Streptococcus, comprising the following steps:

[0015] PCR primers are used to perform PCR amplification on the GBS-specific sequence to be detected to obtain a PCR amplification product;

[0016] The crRNA, the PCR amplification product, LbaCas12a, and the single-stranded DNA fluorescent reporter group are mixed in a reaction system for reaction;

[0017] The reaction products are detected by fluorescence to obtain the detection results.

[0018] Furthermore, the reaction conditions of the reaction are 37° C., 0 min to 20 min.

[0019] Furthermore, the reaction system is 10 μl.

[0020] Furthermore, the reaction system includes: 2 μl of crRNA, 2 μl of LbaCas12a, 1 μl of 10×NEBufferTM2.1, 1 pmol of single-stranded DNA fluorescent reporter group, 1 μl of PCR amplification product and 3 μl of sterile water.

[0021] Compared with the prior art, the present invention can achieve at least one of the following beneficial effects:

[0022] (1) The detection system for group B streptococci provided by the present invention adopts the LbCRISPR / Cas12a system mediated by the non-classical PAM sequence, which achieves high-sensitivity detection when the PCR amplification product of the specific fragment of the reaction substrate cfb gene is at a low concentration condition (10 pg, about 0.07 pmol), and has the advantage of detecting low-abundance samples.

[0023] (2) The detection system for Group B Streptococcus provided by the present invention is a detection system based on non-classical PAM (TCCA). When detecting low-concentration samples, it can capture fluorescent signals earlier, which means that effective detection results can be obtained in a shorter time. This not only greatly improves the detection efficiency, shortens the detection cycle, and significantly improves the accuracy of the detection, but also reduces the misjudgment or missed judgment caused by untimely or unclear signal capture, thereby gaining valuable time for accurate diagnosis and subsequent treatment of the disease.

[0024] (3) The detection method of Group B Streptococcus provided by the present invention reduces the dependence on high-concentration samples in the detection, reduces the experimental cost, and simplifies the experimental operation process. For complex samples that require rapid response and accurate detection, the research and clinical application of low-concentration target nucleic acids are of great significance.

[0025] Other features and advantages of the present invention will be described in the following description, and part of them will become obvious from the description, or will be understood by practicing the present invention. The purpose and other advantages of the present invention can be realized and obtained by the structures particularly pointed out in the written description and the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings are only used for the purpose of illustrating particular inventions and are not to be considered as limiting the invention. Like reference symbols denote like components throughout the drawings.

[0027] Figure 1 Flowchart of detection of Group B Streptococcus by crRNA-mediated LbCas12a targeting non-classical PAM (TCCA, GCCA, CCCA, ACCA) sequences;

[0028] Figure 2 Flow chart for obtaining double-stranded DNA substrates containing TTTA, TCCA, GCCA, CCCA, and ACCAPAM sequences;

[0029] Figure 3 The electrophoretic pattern of the cleavage of double-stranded DNA sequences (SEQ ID NO: 23-SEQ ID NO: 27) mediated by crRNA targeting the classical PAM (5'-TTTA-3') and crRNA targeting the non-classical PAM (5'-NCCV-3');

[0030] Figure 4 Grayscale values ​​of the cleavage efficiency of double-stranded DNA sequences (SEQ ID NO: 23-SEQ ID NO: 27) mediated by crRNA targeting the classical PAM (5'-TTTA-3') and crRNA targeting the non-classical PAM (5'-NCCV-3');

[0031] Figure 5Electrophoretic patterns of the group B Streptococcus (GBS)-specific sequence (i.e., cfb gene-specific fragment) cleaved by crRNA targeting the classic PAM (SEQ ID NO: 7-SEQ ID NO: 14);

[0032] Figure 6 A bar graph showing the cleavage efficiency of group B Streptococcus (GBS)-specific sequences (i.e., cfb gene-specific fragments) mediated by crRNAs targeting the classic PAM (SEQ ID NO: 7-SEQ ID NO: 14);

[0033] Figure 7 This is the electrophoretic pattern after cleavage of a group B Streptococcus (GBS)-specific sequence (i.e., a cfb gene-specific fragment) mediated by crRNA targeting a non-classical PAM (SEQ ID NO: 1-SEQ ID NO: 4);

[0034] Figure 8 This is a bar graph showing the cleavage efficiency of crRNA (SEQ ID NO: 1-SEQ ID NO: 4) targeting non-classical PAMs, targeting group B Streptococcus (GBS)-specific sequences (i.e., cfb gene-specific fragments);

[0035] Figure 9 The dynamic curves of the real-time fluorescence signal units (RFU) changes over time when the content of group B Streptococcus (GBS) specific sequence (i.e., cfb gene specific fragment) is 10 ng, respectively, mediated by crRNA targeting the classical PAM and crRNA targeting the non-classical PAM;

[0036] Figure 10 The curves show the dynamic changes of real-time fluorescence signal units (RFU) over time, respectively, mediated by crRNA targeting the classical PAM and crRNA targeting the non-classical PAM, when the content of group B Streptococcus (GBS) specific sequence (i.e., cfb gene specific fragment) is 10 pg. DETAILED DESCRIPTION

[0037] The present invention is further illustrated by examples below in conjunction with the accompanying drawings, but is not intended to limit the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention. Materials identical or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0038] The present invention provides a detection system for group B streptococci, which utilizes crRNA targeting a non-classical PAM to mediate LbCas12a to cut the specific fragment PCR amplification product (double-stranded DNA) of the cfb gene, and verifies the detection result through a single-stranded DNA fluorescent reporter group, achieving a high-sensitivity detection advantage under low concentration conditions (as low as 10 pg, about 0.07 pmol).

[0039] First, in order to better prove that the crRNAs targeting the atypical PAM sequence (5'-NCCV-3') mediate the cutting efficiency of LbCas12a on double-stranded DNA, the following detection was performed: the crRNA for the atypical PAM sequence (5'-NCCV-3') described in the present invention was compared with the crRNAs designed for the classical PAM sequence (TTTA), and the cutting efficiency of double-stranded DNA mediated by LbCas12a was compared.

[0040] like Figure 1 and Figure 2 As shown, double-stranded deoxy oligonucleotides containing PAMs of TTTA, TCCA, GCCA, CCCA, and ACCA (SEQ ID NO: 16-SEQ ID NO: 20):

[0041] SEQ ID NO: 16 (TTTA): 5'-TACACGACGCTCTTCCGATCTTTTA GTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTG AACTCCAGTCAC-3';

[0042] SEQ ID NO: 17 (TCCA): 5'-TACACGACGCTCTTCCGATCTTCC AGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCT GAACTCCAGTCAC-3';

[0043] SEQ ID NO: 18 (GCCA): 5'-TACACGACGCTCTTCCGATCTGCC AGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCT GAACTCCAGTCAC-3';

[0044] SEQ ID NO: 19 (CCCA): 5'-TACACGACGCTCTTCCGATCTCCC AGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCT GAACTCCAGTCAC-3';

[0045] SEQ ID NO: 20 (ACCA) 5'-TACACGACGCTCTTCCGATCTACCAG TACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGA ACTCCAGTCAC-3';

[0046] The plasmid was then ligated to a T-vector using T4 DNA ligase. Transformation was then performed, and plasmids were extracted from the transformed bacteria. Next, double-stranded DNA containing the PAM sequences TTTA, TCCA, GCCA, CCCA, and ACCA was obtained by PCR amplification.

[0047] PCR primers, sequences are as follows:

[0048] F (SEQ ID NO:21): 5'-GTTGGCCGATTCATTAATGC-3';

[0049] R (SEQ ID NO:22): 5'-CGAAAGGGGGATGTGCTGC-3'.

[0050] A double-stranded DNA with a length of 524 base pairs was obtained, and the sequence was as follows (SEQ ID NO: 23-27):

[0051] DNA1(SEQ ID NO:23):5’-GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTTTACACGACGCTCTTCCGATCTTTTAGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGGCAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG-3’

[0052] DNA2(SEQ ID NO:24):5’-GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTTTACACGACGCTCTTCCGATCTTCCAGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGGCAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG-3’;

[0053] DNA3(SEQ ID NO:25):5’-GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTTTACACGACGCTCTTCCGATCTGCCAGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGGCAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG-3’;

[0054] DNA4(SEQ ID NO:26):5’-GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTGCCCTTTACACGACGCTCTTCCGATCTCCCAGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGGCAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG-3’;

[0055] DNA5(SEQ ID NO:27): 5'-GTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGC TTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGTAACGGCCGCCAGTGTGCTGGAATTGCC CTTTACACGACGCTCTTCCGATCTACCAGTACCGTCACAGTATGAACTTTCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGGCAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCAT GCATCTAGAGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG-3';

[0056] The above substrates will be used to test whether the LbCRISPR / Cas12a in vitro enzyme cleavage system is also applicable to non-classical PAMs.

[0057] The crRNA sequence targeting the above double-stranded DNA substrate is as follows:

[0058] RNA-UNI (SEQ ID NO: 28): 5'-UAAUUUCUACUAAGUGUAGAUGUACCGUCACAGUAUGAACUUUC-3'.

[0059] We constructed an RNase-free reaction buffer system. In this system, crRNA (SEQ ID NO: 28) and LbCas12a ribonucleoprotein complex (RNP) were incubated with double-stranded DNA substrates (SEQ ID NO: 23-27) containing PAM sequences of TTTA, TCCA, GCCA, CCCA, and ACCA at 37 °C.

[0060] In order to fully explore the kinetic characteristics of the cleavage process, we set six different incubation time points, namely 0 minutes, 1 minute, 2 minutes, 5 minutes, 15 minutes and 20 minutes. After the incubation, the cleavage bands were detected by 2% agarose gel electrophoresis, and the cleavage kinetics of LbCas12a on the substrate were evaluated by analyzing the gray value.

[0061] The results showed that, similar to the double-stranded DNA cleavage mediated by the classic PAM-TTTA (5'-TTTV-3', V is A / C / G), in the in vitro cleavage experiment, e.g. Figure 3 As shown in Figure 2, crRNA can also recognize non-classical PAM and effectively guide LbCas12a nuclease to cut dsDNA under in vitro conditions. Figure 4 As shown, crRNA with a non-classical PAM sequence of 5'-NCCA-3' (N is A / T / G / C) showed a cleavage efficiency of 75.67% to 84.07% within 20 minutes of in vitro reaction.

[0062] Therefore, in the in vitro reaction system, LbCRISPR / Cas12a can achieve double-stranded DNA cutting by recognizing non-classical PAM.

[0063] Secondly, the detection effect of the crRNAs targeting the atypical PAM sequence on Group B Streptococcus was further verified. The detection method of Group B Streptococcus described in the present invention was used to compare the crRNAs with the classic PAM sequence to detect the detection efficiency of the crRNAs using the atypical PAM sequence.

[0064] 1. The crRNAs targeting the atypical PAM sequence (5'-NCCV-3') are as follows:

[0065] RNA-TCCA (SEQ ID NO: 1): 5'-UAAUUUCUACUAAGUGUAGAUCAAGUGGUAAAUCAUGUAAAUAG-3':

[0066] RNA-TCCA-2 (SEQ ID NO:2): 5'-UAAUUUCUACUAAGUGUAGAUGAUGAUAGAUACAUCAUAUGUGUAAC-3':

[0067] RNA-CCCA (SEQ ID NO:3): 5'-UAAUUUCUACUAAGUGUAGAUGCAAAUGGCUCAAAAGCUUGAUC-3':

[0068] RNA-GCCC (SEQ ID NO: 4): 5'-UAAUUUCUACUAAGUGUAGUAGCAAAUGGCUCAAAAGCUUGAU-3'.

[0069] 2. The crRNAs targeting the classic PAM (5'-TTTV-3') sequence are as follows:

[0070] RNA1 (SEQ ID NO:7): 5'-UAAUUUCUACUAAGUGUAGAUUCAA CUGAAUGCUAUCUUGAUCA-3';

[0071] RNA2 (SEQ ID NO:8): 5'-UAAUUUCUACUAAGUGUAGAUAUAU UUCUCAACUGAAUGCUAUC-3';

[0072] RNA3 (SEQ ID NO:9): 5'-UAAUUUCUACUAAGUGUAGAUUUAUG AACGUUACACAUAUGAUG-3';

[0073] RNA4 (SEQ ID NO: 10): 5'-UAAUUUCUACUAAGUGUAGAUACCA GCUGUAUUAGAAGUACAUG-3';

[0074] RNA5 (SEQ ID NO: 11): 5'-UAAUUUCUACUAAGUGUAGAUCCAC UUGUGGAGUUGUCACUUGA-3';

[0075] RNA6 (SEQ ID NO:12): 5'-UAAUUUCUACUAAGUGUAGAUCAUG AUUUACCACUUGUGGAGUU-3';

[0076] RNA7 (SEQ ID NO: 13): 5'-UAAUUUCUACUAAGUGUAGAUCUGG GCUUGAUUAUUACUAUUUA-3';

[0077] RNA8 (SEQ ID NO: 14): 5'-UAAUUUCUACUAAGUGUAGAUAGCC AUUUGCUGGGCUUGAUUAU-3'.

[0078] 3. Obtaining the plasmid pLVX-GBS-IRES-Puro containing the GBS-specific sequence (cfb gene-specific fragment): The cfb gene-specific fragment was synthesized by Qingke Company and cloned into the pLVX-IRES-Puro vector via the EcoRI / BamHI restriction sites. The sequence information is as follows (as shown in SEQ ID NO: 15):

[0079] 5'-GAATTCATGAACGTTACACATATGATGTATCTATCTGGAACTC TAGTGGCTGGTGCATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCAAGTGACAACTCCACAAGTGGTAAATCATGTAAATAGTAATAATCAAGCCCAGCAAATGGCTCAAAAGCTTGATCAAGATAGCATTCAGTTGAGAAATATCAAAGATAATGTTCAGGGAACGGATCC-3'.

[0080] The cfb gene-specific fragment is a DNA sequence with specific functions and sequence characteristics in the GBS genome. It is designed to target a conserved region of the cfb gene and is used to specifically detect GBS. In molecular diagnosis of GBS, primers and probes are designed using the cfb gene-specific fragment to detect the presence of GBS in samples.

[0081] 4. Design and synthesize PCR primers for amplifying the target sequence based on SEQ ID NO: 15. The sequences are as follows:

[0082] GBS-F (SEQ ID NO:5):GAAATTTATTATGAACGTTACACATATG ATGTATCTATC;

[0083] GBS-R (SEQ ID NO: 6): GTTCCCTGAACATTATCTTTGAT.

[0084] 5. PCR Amplification

[0085] The plasmid pLVX-GBS-IRES-Puro was diluted to 1 ng / μl and amplified using KOD One PCR Master Mix (TOYOBO). The PCR amplification product of the cfb gene-specific fragment can be used as a dsDNA substrate for in vitro enzymatic digestion by LbCRISPR / Cas12a.

[0086] The amplification system is as follows:

[0087] Reagents Usage KODOnePCRMasterMix 25 μl <![CDATA[H2O]]> 19 μl GBS forward primer (10 μl) 2.5 μl GBS reverse primer (10 μl) 2.5 μl pLVX-GBS-IRES-Puro 1 μl

[0088] After the amplification system was mixed, it was transferred to an Applied Biosystems PCR instrument for amplification. The amplification procedure was as follows: first, pre-denaturation at 98°C for 1 minute; then, cycling, each cycle consisted of denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 68°C for 1 second, repeated 30 times; and finally, a final extension at 68°C for 1 minute.

[0089] The amplified PCR products were loaded onto a 2% agarose gel for electrophoresis. After confirming the presence of a single band, the PCR products were purified using the TaKaRa MiniBEST DNA Fragment Purification Kit Ver. 4.0 (Takara, 9761). The extracted DNA concentration was measured using a Nanodrop 2000 nucleic acid analyzer. DNA samples that passed the test were stored at -20°C for subsequent experimental use.

[0090] 6. Targeting the GBS-specific sequence (cfb gene-specific fragment), Lba Cas12a (NEB, M0653S) was used to cleave GBS in vitro. The crRNA (SEQ ID NO: 1 to SEQ ID NO: 4) was synthesized by Ruibo Sinovac Biotech. The reaction system was configured at 4°C as shown in the following table:

[0091] Reagents Usage LbaCas12a (2 pmol / μl) 2 μl <![CDATA[H2O]]> 4 μl GBS product (30 ng / μl) 1 μl Buffer2.1 1 μl crRNA (5 pmol / μl) 2 μl

[0092] like Figure 5 As shown in Figure 2, in vitro cleavage experiments showed that all eight crRNAs targeting classic PAMs exhibited efficient and stable double-stranded DNA break mediating capabilities. Figure 6 At the same time, Figure 7 As shown in Figure 2, the four crRNAs targeting non-classical PAMs were also able to effectively mediate double-stranded DNA breaks after 10 minutes of in vitro reaction. The efficiency of non-classical crRNA in cutting double-stranded DNA was as follows: Figure 8 .

[0093] Therefore, we subsequently selected the better classical crRNA (SEQ ID NO: 7) and non-classical crRNA (SEQ ID NO: 1) to continue subsequent experiments.

[0094] 7. Detection of crRNA-mediated fluorescence signals.

[0095] The reaction system is prepared as follows:

[0096] Reagents Usage LbaCas12a (2 pmol / μl) 2 μl GBS 10ng or 10pg Buffer2.1 1 μl crRNA (5 pmol / μl) 2 μl 5'-FAM-TTATT-BHQ1-3' 1 pmol <![CDATA[H2O]]> Add to 10 μl

[0097] The above system was mixed. To ensure the stability and accuracy of the experiment, the entire sample addition process was carried out on ice. After the reaction system was mixed, it was quickly transferred to the QuantStudio TM 5. Real-time fluorescence quantitative PCR detection system. During the detection process, the fluorescence signal intensity is collected at 1 minute intervals. The results are as follows Figure 9 and Figure 10 shown.

[0098] The results show that:

[0099] Under low concentration (10pg, about 0.07pmol) conditions, the detection system of group B streptococcus of the present invention exhibits excellent performance. Within 20 minutes of reaction time, the sensitivity of the fluorescence signal detection mediated by crRNA targeting the non-classical PAM sequence (5'-TCCA-3', SEQ ID NO: 1) is significantly better than that of the classical crRNA (5'-TTTA-3', SEQ ID NO: 7). When the reaction substrate (PCR amplification product) is in a low concentration condition (10pg, about 0.07pmol), during the detection of GBS-specific sequence (cfb gene-specific fragment), compared to the crRNA targeting the classical PAM sequence (5'-TTTA-3', SEQ ID NO: 7), the crRNA targeting the non-classical PAM sequence (5'-TCCA-3', SEQ ID NO: 1) has a higher detection sensitivity.

[0100] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with this technical field within the technical scope disclosed by the present invention should be covered by the scope of protection of the present invention.

Claims

1. A detection system for Group B Streptococcus, characterized in that: The detection system includes a PCR amplification product for a specific fragment of the cfb gene, crRNA, LbaCas12a, and a single-stranded DNA fluorescent reporter group; the PCR amplification of the specific fragment of the cfb gene includes forward / reverse primers GBS-F / R; wherein the crRNA sequence is shown in one of SEQ ID NO:1 to SEQ ID NO:

4.

2. The detection system according to claim 1, wherein: The crRNA is a crRNA targeting double-stranded DNA containing a non-classical PAM.

3. The detection system according to claim 2, wherein: The targeted atypical PAM sequence is 5'-NCCV-3', wherein N is A, T, G or C, and V is A, C or G.

4. The detection system according to claim 1, wherein: The sequence of the GBS-F is shown in SEQ ID NO: 5; the sequence of the GBS-R is shown in SEQ ID NO:

6.

5. The detection system according to claim 1, wherein: The single-stranded DNA fluorescent reporter group is 5'-FAM-TTATT-BHQ1-3'.

6. The detection system according to claim 1, wherein: The concentration of the PCR amplification product of the cfb gene is 10 pg.

7. A method for detecting Group B Streptococcus, characterized in that: The steps include: PCR primers are used to perform PCR amplification on the GBS sequence to be detected to obtain a PCR amplification product; The crRNA, the PCR amplification product, LbaCas12a, and the single-stranded DNA fluorescent reporter group are mixed in a reaction system for reaction; The reaction products are detected by fluorescence to obtain the detection results.

8. The detection method according to claim 7, wherein The reaction conditions of the reaction are 37° C., 0 min to 20 min.

9. The detection method according to claim 7, wherein The reaction system is 10 μl.

10. The detection method according to claim 7, wherein The reaction system includes: 2 μl of crRNA, 2 μl of LbaCas12a, 1 μl of 10×NEBufferTM2.1, 1 pmol of single-stranded DNA fluorescent reporter group, 1 μl of PCR amplification product and 3 μl of sterile water.