Accurate LNA-qPCR Detection Method for Bifidobacterium longum subsp. infantis CICC 6069, including Primers, Probes, Kits, and Applications
By designing specific primers and LNA probes, the real-time fluorescence quantitative PCR technology has solved the problem of rapid and accurate quantification of Bifidobacterium longum subsp. infantis CICC 6069 strain, achieving efficient detection in complex samples and suitable for various application scenarios.
Patent Information
- Application Number
- CN202510985277.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-07-17
AI Technical Summary
Existing technologies make it difficult to achieve rapid, accurate, and economical quantitative detection of the strain level of Bifidobacterium longum subsp. infantis CICC 6069. Traditional methods are time-consuming, costly, and cannot accurately count in compound probiotic products.
By designing highly specific primers and LNA probes and combining them with real-time quantitative PCR technology, strains can be rapidly quantified in complex samples by screening for strain-specific SNP sites.
It achieves precise quantification at the strain level, with a quantification limit of 500 CFU/mL, and is suitable for probiotic products, fermented dairy products, cosmetics, feed and intestinal microbial samples, meeting the needs of industrial application and quality control.
Smart Images

Figure CN120485408B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial detection technology, specifically relating to a precise quantitative method for Bifidobacterium longum subsp. infantis CICC 6069 at the strain level, as well as supporting specific primers, LNA probes, detection kits, and their applications in food, daily chemicals, feed, and pharmaceutical fields. Background Technology
[0002] Bifidobacterium longum subsp. infantis, as a probiotic, possesses beneficial properties such as metabolizing human milk oligosaccharides (HMOs), regulating gut microbiota, enhancing immune function, reducing intestinal barrier damage, and promoting epithelial barrier repair. It has passed the assessment of the European Food Safety Authority (EFSA) and obtained the Qualified Presumption of Safety (QPS) designation. It is included in my country's "List of Microbial Strains that Can Be Used in Food," and some strains have already been included in the "List of Microbial Strains that Can Be Used in Infant Food." Among them, CICC 6069... T As the model strain of Bifidobacterium longum subsp. infantis, it has shown significant efficacy in the utilization of human milk oligosaccharides, anti-inflammation, and anti-oxidation, and has broad application prospects in the development of functional foods and disease prevention, especially in the field of infant gut health related to breastfeeding.
[0003] The beneficial properties of probiotics exhibit significant strain specificity. Achieving accurate strain-level identification is a core technological challenge for the probiotic industry. Traditional detection methods can only identify strains down to the species level. While high-throughput technologies such as whole-genome sequencing can meet the needs of strain identification, they are limited by time consumption, high cost, and high technical requirements for operators, making them difficult to widely apply in the industrial production of probiotics. Furthermore, common counting methods cannot accurately count target strains in compound probiotic products. Therefore, developing rapid, accurate, and cost-effective strain-level quantitative technologies is of great significance for ensuring the efficacy of probiotic products, supporting personalized product development, and protecting consumer health. Developing rapid, accurate, and economical strain-level detection methods is crucial for the industrial application and quality control of CICC 6069. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention aims to provide a precise LNA-qPCR quantitative detection method for Bifidobacterium longum subsp. infantis CICC 6069. By designing highly specific primers and LNA probes, and combining them with real-time quantitative PCR technology, this method enables rapid quantification of this strain at the strain level in complex samples. This solves the problems of insufficient detection accuracy and time-consuming and labor-intensive methods in existing technologies, and provides efficient technical support for the protection of intellectual property rights, quality control, and commercial application of the strain.
[0005] The objective of this invention is achieved through the following technical solution:
[0006] This invention proposes the application of the nucleotide sequence shown in SEQ ID NO:1 in the precise quantification of Bifidobacterium longum subsp. infantis CICC 6069 strain.
[0007] Optionally, the nucleotide sequence shown in SEQ ID NO:1 contains specific polymorphic sites at positions 39, 627, and 927. The specific bases at these three sites in Bifidobacterium longum subsp. infantis CICC 6069 are T, T, and A, respectively.
[0008] This invention proposes a precise quantitative method for Bifidobacterium longum subsp. infantis CICC 6069, characterized by comprising at least the following steps:
[0009] S1. Extract genomic DNA from the sample to be tested;
[0010] S2. Design primers and probes for the nucleotide sequence shown in SEQ ID NO:1, wherein the amplification region of the primers covers the polymorphic sites at positions 39, 627 and 927 of SEQ ID NO:1, and the probes contain the nucleotide sequences of the corresponding sites and are modified with LNA;
[0011] S3. Perform real-time quantitative PCR amplification using the primers and probes described in S2;
[0012] S4. Calculate the concentration of CICC 6069 in the sample based on the standard curve.
[0013] Optionally, in S2, the primer sequences are as shown in SEQ ID NO:4 and SEQ ID NO:5, and the amplification product is 190 bp in length, covering the specific SNP site at position 627 of SEQ ID NO:1; the probe sequence is as shown in SEQ ID NO:14, with a sequence length of 20 bp, containing the polymorphic site at position 627 of SEQ ID NO:1 and modified with LNA, the 5' end is labeled with the fluorescent reporter group FAM, and the 3' end is labeled with the quencher group BHQ1.
[0014] Optionally, in S3, the qPCR reaction system is as follows: 10 μL of 2×TaqMan qPCR premix, 0.4 μL each of upstream and downstream primers at a working concentration of 10 μmol / L, 0.4 μL of probe at a working concentration of 10 μmol / L, 2 μL of DNA template, and sterile water to a final volume of 20 μL; the qPCR reaction conditions are: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 63℃ annealing for 32 s, and 72℃ extension for 25 s, for a total of 40 cycles.
[0015] This invention proposes a kit for the precise quantitative detection of Bifidobacterium longum subsp. infantis CICC 6069, which contains at least specific primer pairs SEQ ID NO:4 and SEQ ID NO:5 and an LNA probe SEQ ID NO:14, for the identification and quantitative detection of CICC 6069 at the strain level in probiotic products, fermented dairy products, cosmetics, feed and intestinal microbial samples.
[0016] The technical solution provided by the embodiments of the present invention has the following advantages compared with the prior art:
[0017] This invention establishes a precise, sensitive, and efficient quantitative detection system for CICC 6069 by screening for specific SNP sites in Bifidobacterium longum subsp. infantis CICC 6069 and designing highly specific LNA probes. Through single-base mismatch recognition, it generates specific signals only for CICC 6069, eliminating interference from other strains under complex conditions.
[0018] In the preferred embodiment, the primers and LNA probes of the present invention exhibit high specificity, with a limit of quantitation of approximately 500 CFU / mL, and are effective even at interfering bacterial concentrations up to 10. 8 The difference between the measured value and the theoretical value at CFU / mL is ≤|±0.5Log--|(CFU / mL), which is applicable to different matrix samples such as bacterial powder, compound probiotic products, and intestinal microorganisms, and can meet the precise quality control needs of this strain in the entire process of research and development, production and supervision. Attached Figure Description
[0019] Figure 1These are electrophoresis images verifying primer exclusive amplification; where (a) is primer pair SEQ ID NO:2 and SEQ ID NO:3, (b) is primer pair SEQ ID NO:4 and SEQ ID NO:5, (c) is primer pair SEQ ID NO:6 and SEQ ID NO:7, (d) is primer pair SEQ ID NO:8 and SEQ ID NO:9, (e) is primer pair SEQ ID NO:10 and SEQ ID NO:11, and (f) is primer pair SEQ ID NO:12 and SEQ ID NO:13. Lanes in the diagram: M represents the DNA Marker; 1 represents CICC 6069; 2 represents CICC 6186; 3 represents CICC 6070; 4 represents CICC 6250; 5 represents CICC 24210; 6 represents CICC 6071; 7 represents CICC 6079; 8 represents CICC 6081; 9 represents CICC 25191; 10 represents CICC 6103; 11 represents CICC 25164; 12 represents CICC 24878; 13 represents CICC 24208; 14 represents CICC 6252; 15 represents CICC 25167; 16 represents CICC 6117; 17 represents CICC 6224; 18 represents CICC 24209; 19 represents CICC 6132; 20 represents CICC 6240; 21 represents CICC 25161; 22 represents CICC 6069. 25190, 23 is CICC6245, 24 is CICC 6222, 25 is CICC 6246, 26 is CICC 24337, 27 is CICC 25163, 28 is CICC24923, 29 is CICC 25070, 30 is CICC 25245, 31 is CICC 25166, 32 is CICC 25165, 33 is CICC25162, 34 is CCUG 33636, 35 is CICC 25192, 36 is CCUG 15605, CK is blank.
[0020] Figure 2This is an electrophoresis diagram verifying the inclusive amplification of the primers. (a) shows primer pairs SEQ ID NO:2 and SEQ ID NO:3; (b) shows primer pairs SEQ ID NO:4 and SEQ ID NO:5; (c) shows primer pairs SEQ ID NO:6 and SEQ ID NO:7; and (d) shows primer pairs SEQ ID NO:12 and SEQ ID NO:13. Lanes in the diagram are labeled: M for DNA Marker, 1 for CICC 6069, 2 for CICC 6203, 3 for CICC 6202, 4 for CICC 6199, 5 for CICC 6197, 6 for CICC 6196, 7 for CICC 25033, 8 for CICC 6186, 9 for CICC 6198, and CK is the blank.
[0021] Figure 3 These are amplification curves verifying probe specificity and primer compatibility. (a) shows the specificity of SEQ ID NO:14; (b) shows the specificity of SEQ ID NO:15; (c) shows the compatibility of primer pairs SEQ ID NO:2 and SEQ ID NO:3 with probe SEQ ID NO:14; (d) shows the compatibility of primer pairs SEQ ID NO:4 and SEQ ID NO:5 with probe SEQ ID NO:14; (e) shows the compatibility of primer pairs SEQ ID NO:6 and SEQ ID NO:7 with probe SEQ ID NO:14; and (f) shows the compatibility of primer pairs SEQ ID NO:12 and SEQ ID NO:13 with probe SEQ ID NO:14.
[0022] Figure 4 This is to verify the amplification efficiency of the probe shown in SEQ ID NO:14 and two pairs of primers under different annealing temperature conditions.
[0023] Figure 5 This is the result of genetic stability verification of specific loci in strain CICC 6069. In the figure, lanes M represent the DNA marker, 1 to 10 represent the number of passages of CICC 6069, and CK represents the blank. Detailed Implementation
[0024] To better understand the above-mentioned objectives, features, and advantages of the present invention, the solutions of the present invention will be further described below. It should be noted that, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.
[0025] Many specific details are set forth in the following description to provide a full understanding of the invention, but the invention may also be practiced in other ways different from those described herein; obviously, the embodiments in the specification are only some embodiments of the invention, and not all embodiments. The experimental reagents used in the following embodiments are all commercially available products; the strains involved in this invention are all existing strains, deposited at the China Industrial Microbial Culture Collection Center (CICC), and can be obtained by the public through formal channels by applying to CICC, provided that research ethics and legal procedures are followed.
[0026] Example 1
[0027] This example illustrates the primer and probe design and simulation verification process.
[0028] This invention provides the application of a conserved gene sequence specific to *Bifidobacterium longum* in the detection of *Bifidobacterium longum* subsp. *infantica* strain CICC 6069 at the strain level. This nucleotide sequence is shown in SEQ ID NO:1.
[0029] The sequence information of SEQ ID NO:1 is as follows:
[0030] The genome sequence of *Bifidobacterium longum* was retrieved from the China Industrial Microbial Culture Collection (CICC) and the NCBI GenBank database. Comparative genomics analysis was performed on 513 genomes after data quality control, and a conserved cell division protein, FtsQ, was identified in the CICC 6069 genome. Its nucleotide sequence is shown in SEQ ID NO:1. Homology search in the NCBI database revealed 192 homologous sequences. Within *Bifidobacterium longum*, 127 homologous sequences were obtained, with sequence coverage ranging from 96% to 100% and similarity greater than 96%. In non-*Bifidobacterium longum* species, all sequences had coverage below 10%. These results indicate that the sequence shown in SEQ ID NO:1 is a conserved and ubiquitous characteristic sequence within *Bifidobacterium longum*.
[0031] Further comparative analysis of 513 Bifidobacterium longum genomes revealed that the 39th, 627th, and 927th bases in the nucleotide sequence shown in SEQ ID NO:1 are polymorphic sites unique to CICC 6069: CICC 6069 has a T at the 39th base (C in other Bifidobacterium longum), a T at the 627th base (C in other Bifidobacterium longum), and an A at the 927th base (G in other Bifidobacterium longum). This specific SNP site can be used to achieve accurate detection of CICC 6069 at the strain level. Primers and probes were designed for the nucleotide sequence shown in SEQ ID NO:1 and its polymorphic site at position 627, resulting in 6 pairs of specific primers and 2 LNA probes. Specific sequence information is shown in Table 1. The target product lengths of the 6 primer pairs ranged from 87 bp to 190 bp, and all covered SNP sites specific to strain CICC 6069. Two sets of specifically LNA-modified TaqMan probes were also developed: SEQ ID NO:14 had a lock nucleic acid site modification, and SEQ ID NO:15 had a three-site modification. The probe lengths were 20 bp and 21 bp, respectively, and both covered strain CICC 6069-specific sites on the template gene.
[0032] Table 1: Specific primers and probes for CICC 6069
[0033] Serial Number type Sequence(5′->3′) length Tm (°C) GC% SEQ ID NO:2 Primers gtgttgaactcggtgaaga 19 55.1 47.4 SEQ ID NO:3 Primers gtgaccttggtaatggactt 20 55 45 SEQ ID NO:4 Primers gaaaagaggcgataccctga 20 57 50 SEQ ID NO:5 Primers ggtaatggacttacgcatcg 20 56.4 50 SEQ ID NO:6 Primers agcggtgaccttggtaatggactta 25 63.8 48 SEQ ID NO:7 Primers gcgtgtgttgaactcggtgaaga 23 63.7 52.2 SEQ ID NO:8 Primers aggcgcgtgtgttgaactc 19 61.2 57.9 SEQ ID NO:9 Primers tcttgagactggcgtctatatcctt 25 60.9 44 SEQ ID NO:10 Primers acggttcttgagactggcgt 20 61.8 55 SEQ ID NO:11 Primers cccaagtcgatgagcgtgga 20 62.2 60 SEQ ID NO:12 Primers agcggtgaccttggtaatgg 20 60 55 SEQ ID NO:13 Primers tgtgttgaactcggtgaagaac 22 59.1 45.5 SEQ ID NO:14 probe cttgacctcA*atcaccggaa 20 66.2 50 SEQ ID NO:15 probe ccttgacCtcA*atCaccggaa 21 71.6 52.4
[0034] Note: * indicates a CICC 6069-specific SNP site on the probe sequence; uppercase letters indicate LNA-modified bases.
[0035] Using the NCBI primer tool Primer-BLAST, bacteria (Bacteria) <taxid:2>The specificity and exclusivity of specific sites of the six primer pairs were verified across the genome, allowing up to four base mismatches per primer and an amplified fragment length not exceeding 2000 bp. Primers with good specificity on Bifidobacterium longum were screened. The results showed that all six primer pairs had good specificity, and the exclusivity of specific sites on the probes was good, making them suitable for precise identification of CICC 6069 at the strain level.
[0036] Example 2
[0037] This embodiment illustrates the specificity verification and optimization process of primers and probes.
[0038] To systematically evaluate the intraspecific inclusion and interspecific exclusion of primers, type strains of 36 species, including *Bifidobacterium longum* subspecies CICC6069, were selected as experimental validation strains for primer exclusion verification. Nine *Bifidobacterium longum* strains, including CICC6069, were selected as experimental validation strains for primer inclusion verification. Strain information is shown in Table 2. PCR amplification results showed that primers SEQ ID NO:2 / NO:3, SEQ ID NO:4 / NO:5, SEQ ID NO:6 / NO:7, and SEQ ID NO:12 / NO:13 specifically amplified *Bifidobacterium longum* strains (CICC 6069 and CICC 6186) and showed no amplification signal for extraspecific strains, exhibiting good exclusion (e.g., ...). Figure 1 (As shown); Inclusivity verification showed that all four primer pairs produced bright target bands, effectively amplifying Bifidobacterium longum, and exhibiting good inclusion at the species level (e.g. Figure 2 (As shown). Based on the above results, these four primer pairs were selected for subsequent quantitative system development.
[0039] To verify the probe's specificity at the strain level, 12 *Bifidobacterium longum* strains (including CICC 6069) and 5 different species within the same genus (*Bifidobacterium adolescentis* CICC 6070, *Bifidobacterium animalis* subsp. *animal* CICC 6250, *Bifidobacterium animalis* subsp. *lactobacter* CICC 24210, *Bifidobacterium bifidum* CICC 6071, and *Bifidobacterium breve* CICC 6079) were selected for qPCR experiments. The results showed that the probe shown in SEQ ID NO:14 could accurately distinguish CICC 6069 from other *Bifidobacterium* strains (including different strains within the same species and different species, such as...). Figure 3 (as shown in a); while the probe shown in SEQ ID NO:15 detected non-specific amplification signals other than CICC 6069, such as Figure 3 As shown in b. Therefore, the probe SEQ ID NO:14, which has higher specificity, is preferred for the construction of the subsequent detection system.
[0040] The compatibility between the primers and probes was verified by combining the four selected primer pairs and probe SEQ ID NO:14. Specificity verification results showed that primer pairs SEQ ID NO:4 / NO:5 and SEQ ID NO:6 / NO:7 exhibited high specificity during amplification, accurately detecting the target strain CICC 6069 without producing non-specific amplification signals. Figure 3 d, 3e); while SEQ ID NO:2 / NO:3 and SEQ ID NO:12 / NO:13 ( Figure 3 (c) and (3f) primer pairs exhibited significant non-specific amplification signals during the amplification process, affecting the accuracy of the results. Furthermore, the amplification efficiency of primer combinations SEQ ID NO:4 / NO:5 and SEQ ID NO:6 / NO:7 with probe SEQ ID NO:14 was verified at different annealing temperatures. Optimization was achieved through gradient annealing temperature (e.g.,...). Figure 4 As shown in the figure, 63℃ was determined to be the optimal annealing temperature. At this temperature, the amplification efficiency of the SEQ ID NO:4 / NO:5 primer pair reached 98.39%, which was significantly better than the 91.57% at 62℃. The amplification efficiency of the SEQ ID NO:6 / NO:7 primer pair was less than 90%.
[0041] In summary, after rigorous specificity screening and condition optimization, the primer sets SEQ ID NO:4 and SEQ ID NO:5 and probe SEQ ID NO:14 with higher specificity and better amplification efficiency were finally selected to construct a precise detection system at the CICC 6069 strain level. This combination showed excellent performance in species identification and strain-specific recognition, which can ensure the accuracy and reliability of detection results.
[0042] Table 2: Information on the experimental strains used in the validation experiment
[0043]
[0044] Example 3
[0045] This example illustrates the general applicability of polymorphic sites in identifying CICC 6069 strains within the Bifidobacterium longum species.
[0046] To fully validate the universality of polymorphic sites as a standard for identifying Bifidobacterium longum strain CICC 6069 within the species, supplementary validation at the gene level was conducted based on 513 collected Bifidobacterium longum genomes. Homologous sequences of SEQ ID NO:1 were retrieved from the 513 genomes using SEQ ID NO:1 as a template. Clustering and redundancy removal were performed using 100% sequence similarity as a threshold, resulting in 177 homologous groups. One representative nucleotide sequence from each group was selected for differential alignment analysis with SEQ ID NO:1, and the results are shown in Table 3.
[0047] The results showed that the full-length nucleotide sequence of SEQ ID NO:1 was 1400 bp, and 133 SNP sites were detected by comparison with homologous genes. Among them, CICC 6069 showed specific differences from other Bifidobacterium longum homologous sequences at positions 39 (T / C), 627 (T / C), and 927 (A / G), which can be used as specific genetic markers for strain-level identification, and this discrimination criterion is universal within the Bifidobacterium longum species.
[0048] Table 3: Differential sites of SEQ ID NO:1 between CICC 6069 strain and other Bifidobacterium longum strains
[0049] Note: "." indicates that the sequence is identical to the reference sequence of CICC 6069.
[0050] Example 4
[0051] This example illustrates the genetic stability of polymorphic sites across different generations of CICC 6069 strains.
[0052] Strain CICC 6069 was obtained from the CICC strain resource bank and passaged under anaerobic conditions at 37℃ using MRS culture to obtain strains from generations 1 to 10. Genomic DNA was extracted from each generation of strains as templates, and amplification was performed using primer pairs SEQ ID NO:4 and SEQ ID NO:5. The PCR reaction system consisted of a total volume of 50 μL: 2 μL DNA template, 1 μL × 2 primers at a working concentration of 10 μmol / L, 25 μL of 2×PCR Taqmix, and 21 μL of ddH2O. The PCR amplification conditions were: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 1 min, 72℃ for 35 s, for 35 cycles; 72℃ for 10 min. The amplified products were verified by 1% agarose gel electrophoresis and analyzed by Sanger sequencing.
[0053] The results showed that the PCR amplification products of each generation of strains all exhibited a target band of 190 bp. Figure 5 The sequencing results showed that the product sequence matched the predicted sequence of SEQ ID NO:1 by 100%, and the 627th base was a characteristic T base, with no base mutations or polymorphisms. This result confirms that the SNP site at position 627 of SEQ ID NO:1 has high genetic stability in CICC 6069 strain and can be used as a specific molecular marker for strain-level identification.
[0054] Example 5
[0055] This example illustrates the accuracy of the precise quantification method for Bifidobacterium longum subsp. infantis CICC 6069.
[0056] By simulating a complex bacterial community background, 15 interfering bacteria (including 10 heterologous strains and 5 different strains of the same species of Bifidobacterium longum) at a concentration of 10⁻⁶ CFU / mL were mixed with a CICC 6069 bacterial suspension (concentration 10⁻⁶ CFU / mL). 8 The mixture (CFU / mL) was used for repeatability testing using the established qPCR method. The accuracy of the method was evaluated by the difference between the measured value and the theoretical value of plate count. The results are shown in Table 4.
[0057] Experimental data showed that when 10 non-long Bifidobacterium strains and 5 different long Bifidobacterium strains of the same species were used as high-concentration (10⁻⁶ CFU / mL) interfering bacteria, the difference between the measured value and the theoretical value of the target strain CICC 6069 was ≤|±0.5Log⁻¹|(CFU / mL), which meets the acceptable error range of ISO 16140-2 standard, indicating good consistency of the detection results. These results demonstrate that this qPCR method can achieve accurate identification with its highly specific primer-probe combination, confirming its efficient detection capability for CICC6069 in complex microbial matrices. This provides reliable technical support for the practical detection of CICC 6069 in complex samples such as probiotic products, fermented dairy products, cosmetics, feed, and intestinal microbial samples.
[0058] Table 4: Accuracy results of CICC 6069 detection under mixed culture conditions
[0059]
[0060] Example 6
[0061] This embodiment is used to verify the applicability of the accurate quantification method for Bifidobacterium longum subsp. infantis CICC 6069 in compound bacterial agents.
[0062] Five samples containing *Bifidobacterium longum* but not CICC 6069, and two samples containing CICC 6069 were collected for method applicability studies. The results are shown in Table 5. No Ct values were detected in the five samples without CICC 6069 (Products 1–5), indicating that the method has good exclusion for non-target strains in compound probiotic products. CICC 6069 was successfully and accurately detected in the two compound probiotic products containing CICC 6069 (Products 6–7), and the Ct values were within acceptable ranges, indicating that the method has good inclusiveness and accuracy. In summary, the validation results demonstrate that the established LNA-qPCR method has high specificity and reliability in identifying the target strain CICC 6069T, and is suitable for the accurate detection of the target strain in compound strain cases.
[0063] Table 5: Applicability of CICC 6069 testing in probiotic products
[0064]
[0065] Example 7
[0066] This example illustrates the limit of quantification (LOQ) of the precise quantification method for Bifidobacterium longum subsp. infantis CICC 6069.
[0067] Based on the characteristics of TaqMan-qPCR technology, a Ct value of 35 was set as the upper limit of detection. Using standard curve data from 10 replicate assays, the concentration of CICC 6069 strain corresponding to Ct=35 was calculated to be approximately 500 CFU / mL (verified by plate counting method). To evaluate the consistency and accuracy of low-concentration detection, DNA samples were diluted to 500 CFU / mL and 10 replicate assays were performed. The results are shown in Table 6.
[0068] Experimental data showed that the logarithmic difference between the measured values of 10 repeated tests and the theoretical values of plate counts was ≤|±0.5Log-
[0069] The concentration (CFU / mL) met the acceptable error range of ISO 16140-2, and all repeated experiments consistently detected the target signal. This result confirms that the limit of quantitation for this method is 500 CFU / mL, demonstrating good repeatability and accuracy even at low concentrations, meeting the detection requirements for the low-abundance target strain CICC 6069 in the product.
[0070] Table 6: Validation of the method limit of quantitation
[0071] batch <![CDATA[C T ]]> <![CDATA[Quantitative value Log 10 > <![CDATA[Theoretical value Log 10 > Difference Repeat 1 34.83 2.72 2.69 -0.04 Repeat 2 35.62 2.49 2.69 0.2 Repeat 3 36.44 2.13 2.69 0.46 Repeat 4 35.64 2.49 2.69 0.2 Repeat 5 36.44 2.25 2.69 0.44 Repeat 6 36.02 2.37 2.69 0.32 Repeat 7 36.24 2.31 2.69 0.38 Repeat 8 35.84 2.42 2.69 0.26 Repeat 9 35.88 2.41 2.69 0.27 Repeat 10 36.35 2.27 2.69 0.41
[0072] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments described herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. The application of the nucleotide sequence shown in SEQ ID NO:1 in the precise quantification of *Bifidobacterium longum* subsp. *infantii* CICC6069 at the "strain" level, characterized in that... The nucleotide sequence shown has a specific polymorphic site at position 627. When this site is T, the tested strain is identified as Bifidobacterium longum subsp. infantis CICC 6069.
2. A precise quantitative method for Bifidobacterium longum subsp. infantis CICC 6069, characterized in that, At least the following steps are included: S1. Extract genomic DNA from the sample to be tested; S2. Real-time quantitative PCR amplification was performed using specific primers and LNA-modified TaqMan probes. The nucleotide sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probes is shown in SEQ ID NO:
14. S3. Calculate the concentration of CICC 6069 in the sample based on the standard curve; The combination of primers and probes enables precise quantification of CICC 6069, with a limit of quantification of 500 CFU / mL, and a range up to 10 8 It can maintain specific quantification capability even in the presence of non-target Bifidobacteria at CFU / mL.
3. The method according to claim 2, characterized in that, The real-time quantitative PCR reaction system is as follows: 10 μL of 2×TaqManqPCR premix, 0.4 μL of upstream primer with a working concentration of 10 μmol / L, 0.4 μL of downstream primer with a working concentration of 10 μmol / L, 0.4 μL of probe with a working concentration of 10 μmol / L, 2 μL of DNA template, and sterile water to a final volume of 20 μL.
4. The method according to claim 2, characterized in that, The qPCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 63℃ annealing for 32 s, 72℃ extension for 25 s, for a total of 40 cycles.
5. The application of primer-probe combination in the precise quantification of Bifidobacterium longum subsp. infantis CICC 6069 at the strain level, characterized in that the nucleotide sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5, and their amplification product is 190 bp in length, covering the specific SNP site at position 627 of SEQ ID NO:1, suitable for real-time fluorescence quantitative PCR detection of Bifidobacterium longum; the nucleotide sequence of the probe is shown in SEQ ID NO:14, designed based on the SNP site at position 627 of SEQ ID NO:1, with LNA modified to specifically recognize the T base polymorphism site of CICC 6069, the 5' end labeled with the fluorescent reporter group FAM, and the 3' end labeled with the quencher group BHQ1.
6. The application of the detection kit in the precise quantification of Bifidobacterium longum subsp. infantis CICC 6069 at the strain level, characterized in that... The kit, comprising the primer and probe combination as described in claim 5, qPCR premix, and standards, enables precise quantification of Bifidobacterium longum subsp. infantis CICC 6069, with a limit of quantification of 500 CFU / mL.
7. The application of the primer-probe combination as described in claim 5 or the detection kit as described in claim 6 in the preparation of products for quantitative detection of Bifidobacterium longum subsp. infantis CICC 6069 at the strain level, wherein the application includes quality control, research and development testing and colonization studies of probiotic products, fermented dairy products, cosmetics, feed and intestinal microbial samples.