Markers closely linked to resistance to maize smut and their applications

Abstract

This invention discloses markers closely linked to resistance to maize smut and their applications, belonging to the field of molecular marker-assisted breeding technology. This invention discovers for the first time two markers closely linked to maize resistance to corn smut, namely qSB1 and qSB5. qSB1 is located at locus 24428166 on chromosome 1, and qSB5 is located at locus 220156746 on chromosome 5. When the bases of markers qSB1 and qSB5 are T and C, respectively, maize exhibits high resistance to corn smut. The invention also provides KASP primers for detecting these two markers closely linked to maize resistance to corn smut. The KASP primer sequences for qSB1 are shown in SEQ ID NO.3–SEQ ID NO.5, and the KASP primer sequences for qSB5 are shown in SEQ ID NO.6–SEQ ID NO.8. The provided markers closely linked to maize resistance to corn smut and the related KASP primers can be used for breeding maize varieties resistant to corn smut and for identifying resistance performance. This is of great significance for saving breeding costs, improving breeding efficiency, and shortening the breeding cycle.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to markers closely linked to resistance to maize smut and their applications. Background Technology

[0002] Corn smut, also known as black smut or corn smut, is a global fungal disease of maize caused by *Ustilago maydis*, which limits maize production. It is spread by air currents and is a locally infectious disease. Affected tissues swell into galls due to stimulation by the pathogen. It can occur at any time during the maize's growth cycle, affecting all above-ground young tissues and organs of the plant, such as stems, leaves, flowers, tassels, ears, and aerial roots. Corn smut occurs in more than 100 countries and regions worldwide, and according to statistics, this disease causes yield losses of 2% to 20% annually.

[0003] The surface of corn smut galls is white or light red, later turning grayish-white to grayish-black with a thin pith. Finally, the outer membrane ruptures, releasing a dark brown powder (thick-walled spores of the pathogen). Galls on leaves and leaf sheaths are usually smaller and generally produce little or no smut. Galls on stem nodes and ears are larger, causing stem twisting, stunted growth, and dwarfing. Early infection results in small ears, or even no ears at all. When only a few florets are infected and develop galls, the uninfected parts can still produce grains.

[0004] The smut fungus overwinters as chlamydospores in the soil and on diseased plant debris, becoming the primary source of infection for the following year. Under natural conditions, clustered chlamydospores have a longer lifespan than scattered spores. Chlamydospores mixed in manure still have the ability to germinate; therefore, compost containing diseased plant debris is also a source of primary infection. After spring temperatures rise, once humidity is suitable, the chlamydospores of the pathogen overwintering on the soil surface, in the shallow soil layer, on straw, or in compost will germinate and produce basidiospores, which are spread by air currents, successively causing disease in corn seedlings and mature plants. Chlamydospores on early galls can also cause repeated infections and spread the disease through air currents or other media.

[0005] Breeding highly resistant varieties of maize smut is the most economical, effective, and fundamental method for controlling the disease. Applying marker-assisted selection (MAS) technology to maize variety breeding offers advantages such as cost savings, convenience, speed, and immunity to environmental influences. It can significantly improve breeding efficiency, shorten breeding cycles, and reduce workload, playing a crucial role in screening high-quality, highly resistant materials, cultivating smut-resistant varieties, and advancing research on maize smut. Therefore, identifying genes related to resistance to maize smut and developing linked SNPs and KASP molecular markers are of great significance for breeding against maize smut. Summary of the Invention

[0006] The purpose of this invention is to provide markers closely linked to maize smut resistance and their applications, in order to assist in the breeding, identification and research of smut-resistant varieties and related molecular mechanisms.

[0007] To achieve the above objectives, the present invention provides markers closely linked to maize resistance to head smut, designated qSB1 and qSB5; qSB1 is located at locus 24428166 on chromosome 1; qSB5 is located at locus 220156746 on chromosome 5; the sequence of marker qSB1 and its upstream and downstream 100bp is shown in SEQ ID NO.1; the sequence of marker qSB5 and its upstream and downstream 100bp is shown in SEQ ID NO.2.

[0008] Preferably, when the bases of qSB1 and qSB5 are labeled with T and C respectively, the maize exhibits high resistance to maize smut.

[0009] A kit for detecting maize head smut resistance, comprising primers for detecting the markers closely linked to maize head smut resistance.

[0010] Preferably, the primers are KASP primers or other primers that can amplify the markers that are closely linked to maize smut resistance.

[0011] Preferably, the KASP primer sequences labeled qSB1 are shown in SEQ ID NO.3 to SEQ ID NO.5; and the KASP primer sequences labeled qSB5 are shown in SEQ ID NO.6 to SEQ ID NO.8.

[0012] The application of a marker closely linked to maize head smut resistance as described above in maize variety breeding, where the maize variety is highly resistant to head smut.

[0013] The application of a kit for detecting maize head smut resistance as described above in maize variety breeding, wherein the maize variety is a highly resistant variety to head smut.

[0014] Application of a marker, as described above, closely linked to resistance to corn smut, in the identification of resistance to corn smut.

[0015] Application of a kit for detecting resistance to corn smut as described above in the identification of resistance to corn smut.

[0016] Therefore, the specific technical effects of the markers closely linked to maize smut resistance and their applications provided by this invention are as follows:

[0017] (1) This invention first discovered two markers closely linked to maize resistance to head smut, namely qSB1 and qSB5, where qSB1 is located at position 24428166 on chromosome 1; qSB5 is located at position 220156746 on chromosome 5; when the bases of markers qSB1 and qSB5 are T and C respectively, maize exhibits high resistance to head smut.

[0018] (2) The present invention also provides two KASP primers for detecting two markers closely linked to maize resistance to head smut, the KASP primer sequences labeled qSB1 are shown in SEQ ID NO.3~SEQ ID NO.5; the KASP primer sequences labeled qSB5 are shown in SEQ ID NO.6~SEQ ID NO.8;

[0019] (3) The KASP primers related to the markers and detection markers closely linked to maize smut resistance provided by the present invention can be used for the breeding of maize smut resistance varieties and the identification of smut resistance performance. This is of great significance for saving breeding costs, improving breeding efficiency and shortening the breeding cycle.

[0020] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is the genotyping result in Embodiment 1 of the present invention; where A is the qSB1 marker; B is the qSB5 marker;

[0023] Figure 2 This is the result of the correlation analysis between genotyping information and the evaluation criteria for resistance to head smut in seedling maize in Embodiment 2 of the present invention; where *** indicates a significant difference at the 0.001 probability level;

[0024] Figure 3 These are the results of multiple comparison analysis in Embodiment 3 of the present invention; where A is a pie chart showing the proportion of the four haplotypes; and B is a violin chart showing the proportion of the four haplotypes.

[0025] Figure 4These are the typing results of known highly resistant and highly susceptible maize inbred lines for detecting head smut using two markers in Embodiment 4 of the present invention; where A is the typing diagram of 5 highly resistant inbred lines using the qSB1 marker; B is the typing diagram of 5 highly resistant inbred lines using the qSB5 marker; C is the typing diagram of 5 highly susceptible inbred lines using the qSB1 marker; and D is the typing diagram of 5 highly susceptible inbred lines using the qSB5 marker.

[0026] Figure 5 These are field photos of 10 maize inbred lines in Embodiment 4 of the present invention. Among them, A consists of 5 highly resistant inbred lines, from left to right: 8982, DM07, Q1261, e220, and P25; B consists of 5 highly susceptible inbred lines, from left to right: 3189, LH132, Q381, D88, and P136. Detailed Implementation

[0027] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0029] The instruments, equipment, reagents and materials used in the embodiments were all obtained through commercial means; the methods and steps not described in detail in the embodiments are all conventional techniques in the art.

[0030] Example 1

[0031] Genotyping of maize plants was performed using markers qSB1 and qSB5, as detailed below:

[0032] (1) The marker qSB1 is located at position 244281660 on chromosome 1, and the marker qSB5 is located at position 220156746 on chromosome 5. The sequences of marker qSB1 and its upstream and downstream 100bp are obtained from the maize genome database (http: / / www.maizegdb.org) as shown in SEQ ID NO.1, and the sequences of marker qSB5 and its upstream and downstream 100bp are shown in SEQ ID NO.2.

[0033] SEQ ID NO.1:

[0034] AGCTGCGCGTTGCCGGAGGCGGAGAAGAACCCAGTCGCCCACTTGATAGG TGATCGAACGATGAGCCCGATCATAGTGGCGCTTCTGCACCGCCTGGGCC[C / T]GCTCTAGTCGTAGACAGATGTCCTCCATGGTTCTAGCTATGGCAGCGACC CGCGTCTCGCCCTATTCATAGGATCGAATGGACGGGGGGCATGACCATAC

[0035] SEQ ID NO.2:

[0036] AATATCCATGCTGAAATCACTGTCATTCATCGTATGATTTTGCAACTCAAACT CAATTTCAAATAGACTGTCACTGAGGTGAGAGATACCACAGTCCTAT[C / T]TAGCCACTTGGTATGGGCTGCCAGGGTGTAGGACAAGGGCATGATGAAGAA TCCCAACAAACTAATTAGTGCCATGTGCTTCAGGGTACGAAAACTGATG

[0037] The KASP primers for amplifying qSB1 and qSB5 markers are shown in Table 1. Each primer includes two upstream genotyping primers, A and B (targeting the two alleles respectively), and one downstream universal primer, C. The KASP primer sequence information in Table 1 was sent to the company for primer synthesis, and the primers were dissolved according to the instructions attached to the received primers.

[0038] Table 1. KASP primer information for amplification markers qSB1 and qSB5.

[0039]

[0040]

[0041] (2) Genomic DNA was extracted from 167 maize inbred lines provided by the Hebei Branch of the National Maize Improvement Center of Hebei Agricultural University, which had undergone breeding practices in both China and the United States. (These 167 maize inbred lines represent the heterotic group of maize inbred lines in China and broadly represent the germplasm resource base of the main maize producing areas in China. For specific information on the 167 inbred lines, please refer to (Yin Bingyu's Master's Thesis of Hebei Agricultural University in 2024, titled: Identification of Candidate Genes for Resistance to Maize Seedling Tuberculosis Based on Transcriptome and GWAS Analysis). After electrophoresis and Nanodrop detection, high-quality DNA solutions were selected as templates. Using the KASP primers shown in Table 1, the following mixture was prepared: 1.5 μL DNA, 0.75 μL 2×Mastermix (KASPV4.02X Mastermix96 / 384, catalog number: KBS-1016-012, brand: LGC), 0.0417 μL primers, and ddH2O. A reaction mixture of 0.75 μL and a total volume of 3 μL was prepared. PCR amplification was performed using a high-throughput PCR instrument. The amplification program was as follows: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ (gradient annealing, decreasing by 0.6℃ per cycle) for 60 s, 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 26 cycles; 94℃ for 20 s, 57℃ for 60 s, 5 cycles.

[0042] After the PCR reaction, the fluorescence signal was converted into analyzable values ​​using an Omega fluorescence signal reader and an Araya instrument. Genotyping was then performed using Kraken™ software provided by LGC (Laboratory of the Government Chemist). The results were visualized using SNPviewer software. The specific principles for genotyping were as follows:

[0043] If the tested material shows a blue fluorescent signal at the qSB1 marker site, its genotype is homozygous CC; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple indicate unknown genotypes. If the tested material shows a blue fluorescent signal at the qSB5 marker site, its genotype is homozygous CC; if it shows a dark red fluorescent signal, its genotype is TT; if it shows a green fluorescent signal, its genotype is TC; black dots represent NTC empty tube controls; pink and purple indicate unknown genotypes.

[0044] The results of PCR amplification using a mixed primer set of 1-A, 1-B, and 1-C (qSB1 labeled) are as follows: Figure 1As shown in A, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous TT genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous CC genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous CT genotype.

[0045] The results of PCR amplification using a mixed primer set of 2-A, 2-B, and 2-C (qSB5 labeled) are as follows: Figure 1 As shown in B, if the primer combination perfectly matches the genomic DNA, the fluorescence signal in the detection result will be red, indicating that the detected plant is homozygous TT genotype; if the fluorescence signal in the detection result is blue, it indicates that the detected plant is homozygous CC genotype; if the fluorescence signal in the detection result is green, it indicates that the detected plant is heterozygous TC genotype.

[0046] Example 2

[0047] Ustilago maydis SG200 was kindly donated by Academician Regine Kahmann of the Max Planck Institute for Terrestrial Microbiology, Germany. After being engineered (see Brefort T, Doehlemann G, Mendoza-Mendoza A, et al. Ustilago maydis as a Pathogen[J]. Annual Review of Phytopathology, 2009, 47: 423-445.), Ustilago maydis SG200 can form infectious hyphae without prior haploid matching of different genotypes. Therefore, it can infect seedling maize even in greenhouses and form nodular structures after disease onset (Lanver D, Tollot M, Schweizer G, et al. Ustilago maydis effectors and their impact on viral ulence[J]. Nature Reviews. Microbiology, 2017, 15(7): 409-421.).

[0048] The disease severity classification of corn seedling head smut, which is currently recognized by those skilled in the art, is shown in Table 2. The disease index of each plant is calculated using Formula I (Pataky J K. Production of Cuitlacoche[Ustilago maydis(DS)Corda]on Sweet Corn[J].HortS cience,1991,26(11):1374-1377.).

[0049] Disease index = 100 × ∑(number of diseased plants at each level × disease level) / (total number of plants investigated × highest disease level) (Formula I).

[0050] Table 2 Disease classification of corn seedling head smut

[0051]

[0052] The evaluation criteria for resistance of seedling maize to head smut are shown in Table 3.

[0053] Table 3 Evaluation criteria for resistance of corn seedlings to head smut.

[0054] Disease index resistance abbreviation 0-15.0 Highly resistant to disease (High resistance, HR) 15.1-30.0 Disease resistance (Anti-, R) 30.1-50.0 Moderate disease resistance (Middle resistance, MR) 50.1-70.0 Illness (Sensation, S) 70.1-100.0 Highly susceptible to disease (High sensitivity, HS)

[0055] Based on the evaluation criteria for seedling maize resistance to head smut shown in Table 3, the genotyping information of the two markers qSB1 and qSB5 obtained in Example 1 was correlated with the evaluation criteria for seedling maize resistance to head smut. The results are shown in Table 4. Figure 2 As shown, based on the fluorescence signal of qSB1-KASP marker, the genotype of chromosome 1 locus 244281660 is determined to be either CC or TT. The average disease index of maize seedlings containing the T gene is 0.3453, and the average disease index of maize seedlings containing the C gene is 0.5228. Based on the fluorescence signal of qSB5-KASP marker, the genotype of chromosome 5 locus 220156746 is determined to be either TT or CC. The average disease index of maize seedlings containing the T gene is 0.4401, and the average disease index of maize seedlings containing the C gene is 0.3032.

[0056] Table 4. Effects of markers qSB1 and qSB5 on maize resistance to head smut.

[0057]

[0058] Materials with a disease index ≤0.3 were considered resistant to smut. The selection rates of markers qSB1 and qSB5 for resistant materials were evaluated (selection rate represents the proportion of samples with a disease index ≤0.3 among materials carrying different allelic variants). The disease index of materials carrying superior genotypes was analyzed. The results are shown in Table 4. The selection rates for materials with a disease index ≤0.3 were 49.5% and 54.5%, respectively, while the proportions of materials carrying relative genotypes were 20% and 28.9%, respectively. These results indicate that the developed KASP markers qSB1 and qSB5 play a role in the selection of resistant smut materials.

[0059] Example 3

[0060] Studies (Zill P, Büttner A, Eisenmenger W, et al. Single nucleotide polymorphism and haplotype analysis of a novel tryptophan hydroxylase isoform (TPH2) gene in suicide victims[J]. Biological psychiatry, 2004, 56(8): 581-586.) have shown that using combined markers to identify target traits is more accurate than using a single marker. The two markers qSB1 and qSB5 provided in this invention can form four main haplotype combinations as shown in Table 5.

[0061] Table 52 Haplotype Combinations of Markers

[0062] Tag name Hap1 Hap2 Hap3 Hap4 qSB1 T T C C qSB5 T C T C

[0063] Multiple comparison analysis was performed on 167 maize inbred lines from Example 1 using the four haplotype combinations shown in Table 5. The results are as follows: Figure 3 As shown in Table 6, 56 materials belonged to haplotype combination 1 with an average disease index of 0.413; 35 materials belonged to haplotype combination 2 with an average disease index of 0.213; 14 materials belonged to haplotype combination 3 with an average disease index of 0.519; 9 materials belonged to haplotype combination 4 with an average disease index of 0.480; and the remaining materials had gene deletions. This indicates that different haplotype combinations have a significant impact on maize resistance to head smut. Haplotype combination 2 is a highly resistant haplotype combination and can be used for head smut resistance testing and variety breeding.

[0064] Table 6. Effects of different haplotype combinations on antagonism

[0065]

[0066]

[0067] Example 4

[0068] The primers listed in Table 1 were used to analyze the qSB1 and qSB5 sites of the known highly resistant maize inbred lines DM07, Q1261, e220, P25, and 8982, and the highly susceptible (non-resistant) maize inbred lines D88, P136, LH132, 3189, and Q381 (for information on highly resistant and non-resistant maize inbred lines, please refer to Yin Bingyu's 2024 Master's thesis at Hebei Agricultural University, titled: Identification of Candidate Genes for Maize Seedling Resistance to Maize Smut Based on Transcriptome and GWAS Analysis). The method was the same as in Example 1. The results are as follows. Figure 4 As shown in Table 7, the results for the five highly resistant inbred lines using marker qSB1 showed that all five lines were TT genotype; the results for marker qSB5 showed that four inbred lines were CC genotype and one inbred line was TT genotype. The results for the five highly susceptible inbred lines using marker qSB1 showed that two inbred lines were TT genotype and three inbred lines were CC genotype; the results for marker qSB5 showed that all five inbred lines were TT genotype.

[0069] In single-marker detection, the screening rates of the two markers for dominant genes in highly resistant inbred lines were 100% (TT) and 80% (CC), respectively. The screening rate for multiple markers was 80% (TC). In highly susceptible inbred lines, the screening rates of the two markers for dominant genes were 60% (CC) and 100% (TT), respectively. The screening rate for multiple markers was 60% (CT). Therefore, markers qSB1 and qSB5 have a certain screening ability for highly resistant and highly susceptible lines and can be used for subsequent screening of resistant inbred lines.

[0070] Five highly resistant inbred lines and five highly susceptible inbred lines were field-tested, and the results are as follows: Figure 5 As shown, the five highly resistant inbred lines did not develop the disease or only showed slight discoloration, while the five highly susceptible inbred lines developed the disease more severely, proving the correctness and applicability of the marker.

[0071] Table 7 Bases of qSB1 and qSB5

[0072]

[0073] Therefore, this invention discovers for the first time two markers closely linked to maize resistance to corn smut, namely qSB1 and qSB5, where qSB1 is located at locus 24428166 on chromosome 1 and qSB5 is located at locus 220156746 on chromosome 5. When the bases of markers qSB1 and qSB5 are T and C, respectively, maize exhibits high resistance to corn smut. The invention also provides KASP primers for detecting the two markers closely linked to maize resistance to corn smut. The KASP primer sequences for qSB1 are shown in SEQ ID NO.3 to SEQ ID NO.5; the KASP primer sequences for qSB5 are shown in SEQ ID NO.6 to SEQ ID NO.8. The provided markers closely linked to maize resistance to corn smut and the related KASP primers can be used for breeding maize varieties resistant to corn smut and for identifying resistance performance to corn smut, which is of great significance for saving breeding costs, improving breeding efficiency, and shortening the breeding cycle.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. The application of markers closely linked to maize smut resistance in maize variety breeding, characterized by: The maize variety is highly resistant to head smut; the markers closely linked to maize head smut resistance are qSB1 and qSB5; qSB1 is located at locus 24428166 on chromosome 1; qSB5 is located at locus 220156746 on chromosome 5; the marker qSB1 locus and its upstream and downstream 100bp sequences are shown in SEQ ID NO.1; The sequence marking the qSB5 site and its upstream and downstream 100bp is shown in SEQ ID NO.2; When the bases of qSB1 and qSB5 are labeled with T and C respectively, maize exhibits high resistance to maize smut.

2. The application of a kit for detecting maize head smut resistance in maize variety breeding, characterized in that: The maize variety is a highly resistant variety to head smut; the kit includes primers with markers closely linked to maize resistance to head smut as described in claim 1; The primers are KASP primers or other primers that can amplify markers closely linked to maize smut resistance; the sequences of qSB1-labeled KASP primers are shown in SEQ ID NO.3 to SEQ ID NO.5; the sequences of qSB5-labeled KASP primers are shown in SEQ ID NO.6 to SEQ ID NO.

8.

3. The application of the markers closely linked to maize smut resistance as described in claim 1 in the identification of maize smut resistance.

4. The application of the kit for detecting resistance to corn smut as described in claim 2 in the identification of resistance to corn smut.

Images