LAMP primer group for detecting mandarin fish arenavirus, kit and application

By designing a LAMP primer set and detection system for mandarin fish sandworm virus, the shortcomings of existing detection methods have been solved, achieving highly sensitive and specific detection of mandarin fish sandworm virus, which is suitable for grassroots laboratories and field applications.

CN120485433APending Publication Date: 2025-08-15INST OF ZOOLOGY GUANGDONG ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510634987.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-16
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The lack of a rapid and highly sensitive method for detecting mandarin fish sandworm virus in the current technology affects the real-time monitoring and epidemiological investigation of the disease.

Method used

A LAMP primer set for detecting mandarin fish sandworm virus was designed, including outer primer pairs and inner primer pairs. Combined with the LAMP amplification reaction system and kit, it can achieve high sensitivity and high specificity detection within 60 minutes.

Benefits of technology

It achieves highly sensitive detection of mandarin fish sandworm virus, with strong specificity and no reaction with other aquatic-related viruses, making it suitable for grassroots laboratories and on-site testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005406418490000011
    Figure HDA0005406418490000011
  • Figure HDA0005406418490000012
    Figure HDA0005406418490000012
  • Figure HDA0005406418490000021
    Figure HDA0005406418490000021
Patent Text Reader

Abstract

The invention relates to an LAMP (loop-mediated isothermal amplification) primer group for detecting a mandarin fish arenavirus, a kit and application, and relates to the technical field of biological detection. The LAMP primer comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP, high-sensitivity and high-specificity detection on the siniperca chuatsi arenavirus can be achieved on the basis of the LAMP primer group, the detection result is high in specificity, the detection result does not react with other aquatic product related viruses, and the LAMP primer group is suitable for popularization and application of primary laboratories and field detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, in particular to a LAMP primer set, a kit and applications for detecting mandarin fish arenavirus. Background Art

[0002] Mandarin fish arenavirus (MFAV) is a newly discovered, enveloped, segmented, single-stranded, negative-sense RNA virus. It causes congestion and swelling of the spleen, kidneys, and head kidney in farmed mandarin fish, with the liver turning white in the later stages of infection. It has a high mortality rate. However, no detection methods or diagnostic kits are currently available. Developing rapid and accurate MFAV detection technologies will facilitate real-time monitoring and epidemiological investigations, and have significant implications for disease prevention and control.

[0003] Loop-mediated isothermal amplification (LAMP) is a DNA amplification method that operates at a constant temperature and boasts high specificity, speed, and efficiency. It also reduces detection time compared to PCR and requires only a simple small heater, rather than a thermal cycler. However, a LAMP method for detecting MFAV is currently unavailable. Summary of the Invention

[0004] In response to the above problems, the present invention provides a LAMP primer set for detecting mandarin fish arenavirus. Based on this LAMP primer set, high-sensitivity and high-specificity detection of mandarin fish arenavirus can be achieved, and the detection results are highly specific and do not react with other aquatic-related viruses. It is suitable for promotion and application in grassroots laboratories and on-site testing.

[0005] The present invention provides a LAMP primer set for detecting mandarin fish arenavirus, comprising an outer primer pair and an inner primer pair;

[0006] The outer primer pairs are as follows:

[0007] External primer F3: CAGTGAACACAACTTATCTTCT (SEQ ID NO. 1);

[0008] Outer primer B3: ACACACCTCATCTCCCTG (SEQ ID NO. 2);

[0009] The inner primer pairs are as follows:

[0010] Inner primer FIP: AGTAGAATAATGCACACTGTGAACAGTAAGACAAGCAATTAGGAACG (SEQ IDNO.3);

[0011] Internal primer BIP: TGCTCTGAACCTAGCCATTGTGTGAGAATGCTGAAGCCTA (SEQ ID NO. 4).

[0012] The present invention also provides a detection system for detecting mandarin fish arenavirus, comprising a LAMP amplification reaction system, wherein the LAMP amplification reaction system comprises the LAMP primer set.

[0013] The present invention also provides a kit for detecting mandarin fish arenavirus, comprising the LAMP primer set or the detection system.

[0014] The above kit was used to detect the Siniperca chuatsi arenavirus, and the minimum detection limit could reach 2.20×10 3 The whole process can be completed within 60 minutes, with the advantages of strong specificity, high sensitivity, short time consumption, simple operation and visualization.

[0015] In one embodiment, the kit further comprises a positive control and a negative control.

[0016] In one embodiment, the positive control comprises the glycoprotein gene of mandarin fish arenavirus.

[0017] In one embodiment, the negative control is DEPC-treated ddH2O.

[0018] The present invention also provides a method for detecting mandarin fish arenavirus for non-disease diagnosis purposes, comprising the following steps: extracting RNA from a sample to be tested, reverse transcribing it into cDNA, performing a LAMP amplification reaction using the LAMP primer set, the detection system or the kit to obtain an amplified product, and detecting the amplified product.

[0019] In one embodiment, the reaction conditions of the LAMP amplification reaction include: constant temperature reaction at 60-65° C. for 30-60 min, and constant temperature treatment at 80° C. for 5 min.

[0020] In one embodiment, the reaction conditions of the LAMP amplification reaction include: constant temperature reaction at 65° C. for 50 min, and constant temperature treatment at 80° C. for 5 min.

[0021] In one embodiment, the detection comprises agarose gel electrophoresis detection or neutral red staining detection.

[0022] In one embodiment, the agarose gel electrophoresis detection comprises: separating the amplified product by agarose gel electrophoresis, and when a ladder-like band appears in the electrophoresis result, it is determined that the sample to be tested is infected with mandarin fish arenavirus;

[0023] The neutral red staining test comprises: adding neutral red dye to the amplification product, and when the staining result is red, it is determined that the sample to be tested is infected with mandarin fish arenavirus.

[0024] The present invention also provides use of the LAMP primer set, the detection system or the kit in preparing a product for detecting mandarin fish arenavirus.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention discloses a LAMP primer set, a kit and an application for detecting mandarin fish arenavirus. Based on the LAMP primer set, mandarin fish arenavirus can be detected with high sensitivity and high specificity. The detection result has strong specificity and does not react with other aquatic products-related viruses. The method is suitable for promotion and application in grassroots laboratories and on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure 2 shows the amplification of MFAV by LAMP primer set at 65°C followed by agarose gel electrophoresis. M represents DNAMarker DL2000, - represents negative control, and + represents positive control.

[0028] Figure 2 Neutral red at different final concentrations was added to the LAMP reaction solution to screen for the optimal neutral red concentration for the color development reaction. The results showed that adding neutral red at a final concentration of 1.0 μg / μL had the best effect.

[0029] Figure 3 Figure 1 shows the specific detection of different viral genomes using the LAMP primer set. A shows the neutral red reaction result. The reaction tubes from left to right are cDNA reversed from RNA of healthy mandarin fish liver tissue, RGNNV, SGIV, and MFAV. B shows the agarose gel electrophoresis test result. M is a DNA marker. Lane 1: cDNA reversed from RNA of healthy mandarin fish liver tissue, lane 2: RGNNV, lane 3: SGIV, and lane 4: MFAV.

[0030] Figure 4This figure shows the detection of MFAV amplification using LAMP primer sets at different reaction temperatures. Figure A shows the visualization of the reaction after adding a certain amount of neutral red to the reaction solution. The reaction tubes from left to right are negative and positive samples subjected to reactions at 65°C, 63°C, 62°C, and 60°C, respectively. Figure B shows the results of agarose gel electrophoresis of the reaction solution. The lanes from left to right are negative and positive samples subjected to reactions at 65°C, 63°C, 62°C, and 60°C, respectively. M, DNA marker.

[0031] Figure 5 Figure 2 shows the sensitivity of LAMP primer set for detecting MFAV. A is the neutral red reaction result. The reaction tubes from left to right are negative control, 2.20×10 8 copies / μL, 2.20×10 7 copies / μL, 2.20×10 6 copies / μL, 2.20×10 5 copies / μL, 2.20×10 4 copies / μL, 2.20×10 3 copies / μL, 2.20×10 2 copies / μL and 2.20×10 1 copies / μL; B is the result of electrophoresis separation of the reaction products in agarose gel, M is DNA marker, lanes 1-9 are negative control, 2.20×10 8 copies / μL, 2.20×10 7 copies / μL, 2.20×10 6 copies / μL, 2.20×10 5 copies / μL, 2.20×10 4 copies / μL, 2.20×10 3 copies / μL, 2.20×10 2 copies / μL and 2.20×10 1 copies / μL;

[0032] Figure 6The optimization of the optimal reaction time of the LAMP primer set for MFAV; A is the visual image after adding a certain amount of neutral red to the reaction solution. From left to right, the reaction tubes show the reaction results of negative and positive samples at 65°C for 10, 20, 30, 40, 50, and 60 min, respectively; B is the result of agarose gel electrophoresis of the reaction solution. M is a DNA marker, and the lanes show the reaction results of negative and positive samples at 65°C for 10, 20, 30, 40, 50, and 60 min, respectively. DETAILED DESCRIPTION

[0033] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the accompanying drawings. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the present disclosure.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0035] source:

[0036] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; and the experimental methods, unless otherwise specified, are all conventional experimental methods in the art.

[0037] Example 1

[0038] Establishment of LAMP detection method.

[0039] 1. LAMP primer set.

[0040] 1.1LAMP primer design.

[0041] Primers were designed based on the glycoprotein gene sequence of MFAV obtained by sequencing. After screening, a suitable LAMP primer set was obtained and primer synthesis was performed. The concentration of the synthesized outer primers F3 and B3 was 10 μM, and the concentration of the inner primers FIP and BIP was 40 μM.

[0042] In preliminary experiments, the concentrations used were: 1.0 μM for outer primers F3 and B3, and 1.0 μM for inner primers FIP and BIP. Different volumes of primers were mixed and then used for MFAV detection. The sequences of the LAMP primer set are as follows:

[0043] External primer F3: CAGTGAACACAACTTATCTTCT (SEQ ID NO. 1);

[0044] Outer primer B3: ACACACCTCATCTCCCTG (SEQ ID NO. 2);

[0045] Inner primer FIP: AGTAGAATAATGCACACTGTGAACAGTAAGACAAGCAATTAGGAACG (SEQ IDNO.3);

[0046] Internal primer BIP: TGCTCTGAACCTAGCCATTGTGTGAGAATGCTGAAGCCTA (SEQ ID NO. 4).

[0047] 1.2 Preparation of RNA template.

[0048] 1.2.1 Preparation of plasmid RNA template.

[0049] LAMP reaction solution: The MFAV pcDNA3.1-MFAV-glycoprotein recombinant plasmid was synthesized and constructed by Wuhan Jinkairui Bioengineering Co., Ltd. by ligating the target fragment of the glycoprotein gene of the mandarin fish arenavirus to pcDNA3.1. It contains a T7 promoter. The RNA transcript of this plasmid was prepared using the T7 in vitro transcription kit. The specific reagent components and amounts are shown in Table 1.

[0050] The reaction procedure was as follows: incubate at 37°C for 2 h, add 2 μL of RNase-free DNase I after incubation was complete, and digest at 37°C for 30 min to remove residual DNA.

[0051] Table 1 In vitro transcription reaction system

[0052] Serial number Reagent components Usage amount / μL 1 10×Transcription Buffer 2.0 2 dNTP 2.0 3 RNase inhibitor (40U / μL) 0.5 4 T7 RNA polymerase 2.0 5 Template (recombinant plasmid) 0.5-1.0 μg 6 Betaine 2.5 7 RNase-free water Make up to 20

[0053] 1.2.2 Preparation of RNA template for the sample to be tested.

[0054] The FastPure Viral DNA / RNA Mini Kit (Novozymes) was used to extract the sample genomic RNA. The specific method is as follows:

[0055] (1) Add 200 μL of sample to an RNase-free centrifuge tube (if the sample volume is insufficient, use PBS or 0.9% NaCl to make up), add 500 μL of Buffer VL, vortex mix for 15-30 seconds, and centrifuge the mixture to collect it at the bottom of the tube.

[0056] (2) Place FastPure RNA Columns in a 2 mL collection tube, transfer the above mixture to FastPure RNA Columns, centrifuge at 12,000 × g for 1 min, and discard the filtrate.

[0057] (3) Add 600 μL of Buffer RW to FastPure RNA Columns, centrifuge at 12,000 × g for 30 seconds, and discard the filtrate. Repeat step 3. Centrifuge the empty column at 12,000 × g for 2 minutes.

[0058] (4) Carefully transfer the FastPure RNA Columns to a new 1.5 mL RNase-free collection tube (provided in the kit), add 30-50 μL of RNase-free ddH2O to the center of the membrane, let it stand at room temperature for 1 min, and centrifuge at 12,000 × g for 1 min.

[0059] (5) Discard the FastPure RNA Columns. The RNA can be used directly for subsequent testing or stored at -30 to -15°C for short-term storage or at -85 to -65°C for long-term storage.

[0060] 1.3 Preparation of cDNA template

[0061] Using the RNA template prepared in 1.21 or 1.2.2, reverse transcription reaction is performed as a cDNA template. The reaction system is shown in Table 2. The reaction procedure is: 30℃ for 10 min, 42℃ for 40 min, and then inactivated at 95℃ for 5 min. The product is stored at -20℃ until use.

[0062] Table 2 Reverse transcription reaction system

[0063] Serial number Reagent components Usage amount / μL 1 5×PrimeScriptBuffer 4.0 2 RNase inhibitor (40U / μL) 0.5 3 PrimeScript RTase (200 U / μL) 1.0 4 RNA template 10 5 RNase-free water Make up to 20

[0064] 1.4 LAMP reaction amplification

[0065] The LAMP reaction system is shown in Table 3. The cDNA template, the positive control was the MFAV-derived pcDNA3.1-MFAV-glycoprotein recombinant plasmid, and the negative control was DEPC-treated ddH2O.

[0066] Table 3 LAMP reaction system

[0067] Serial number Reagent components Usage amount / μL 1 2×BcaBEST Buffer 12.5 2 BcaBEST DNA Polymerase ver.2.0(8U / μl) 1.0 3 10 μM outer primer F3 1.0 4 10 μM outer primer B3 1.0 5 40 μM inner primer FIP 1.0 6 40 μM inner primer BiP 1.0 7 cDNA template 1.0 8 Nuclease-free water Make up to 25

[0068] The LAMP reaction procedure is as follows: set the reaction temperature of the thermostatic amplification PCR instrument to 65°C for 50 minutes; then react at 80°C for 5 minutes.

[0069] 1.5 Determine the results.

[0070] Scheme 1: The LAMP reaction mixture (10 μL) was separated by 2.5% agarose gel electrophoresis and observed under ultraviolet light by ethidium bromide staining. The results were determined by agarose gel electrophoresis analysis to see if ladder bands appeared; the amplification reaction system solution was tested by agarose gel electrophoresis. If ladder bands appeared, it was positive; if no ladder bands appeared, it was negative ( Figure 1 ).

[0071] Solution 2: Add different final concentrations of neutral red dye to the LAMP reaction mixture and then observe the product directly with the naked eye. If the solution turns red, it is positive; if the solution remains orange-yellow, it is negative. Results ( Figure 2 ) showed that adding neutral red at a final concentration of 1.0 μg / μL had the best effect.

[0072] Example 2

[0073] LAMP-specific detection of MFAV using the LAMP primer set.

[0074] The specificity test evaluates whether the LAMP primer set can specifically detect MFAV and analyzes whether the primer set has cross-reactivity with viruses other than MFAV.

[0075] The experiment uses pathogen genomes that can infect mandarin fish, including the Mandarin fisharenavirus (MFAV) genome, the Red-grouper nervous necrosis virus (RGNNV) genome, the Singapore grouper iridovirus (SGIV) genome, and cDNA reversed from RNA of healthy mandarin fish liver tissue as detection objects. The MFAV LAMP primer set designed and screened in 1.1 of Example 1 is used. The recombinant plasmid (pcDNA3.1-MFAV-glycoprotein) containing the MFAV glycoprotein gene is constructed and the cDNA template is prepared using the reaction systems 1.2.1 and 1.3 of Example 1. The reaction system in 1.4 is then used to react at 65°C for 50 minutes and then at 80°C for 5 minutes. The LAMP primer set is used for isothermal amplification reaction, and the amplified product is detected by gel electrophoresis.

[0076] The results are as follows Figure 3 As shown in the figure, this LAMP primer set specifically amplified only MFAV; other viruses and healthy tissue samples were negative, with no amplification product. This indicates that the LAMP primer set has good specificity.

[0077] Example 3

[0078] Optimal temperature for LAMP reaction of MFAV.

[0079] LAMP reaction was carried out at 65°C, 63°C, 62°C and 60°C, respectively. The optimal temperature for LAMP amplification was detected by adding neutral red and agarose gel electrophoresis.

[0080] The results are as follows Figure 4 As shown in the figure, the amplification efficiency did not differ significantly when amplified at 65°C, 63°C, 62°C, and 60°C for 60 min, indicating that the LAMP reaction can be stably performed at 60-65°C.

[0081] Example 4

[0082] Sensitive detection of MFAV using the LAMP primer set.

[0083] This study preliminarily analyzed the detection ability (sensitivity) of the primer set designed by MFAV.

[0084] The pcDNA3.1-MFAV-glycoprotein recombinant plasmid was added at a rate of 2.20×10 8 copies / μL, 2.20×10 7 copies / μL, 2.20×10 6 copies / μL, 2.20×10 5 copies / μL, 2.20×10 4 copies / μL, 2.20×10 3 copies / μL, 2.20×10 2 copies / μL, 2.20×10 1 The reaction template was prepared by diluting the mixture into 8 gradients, and the cDNA template was prepared according to the methods of 1.2.1 and 1.3 in Example 1 using the LAMP primer set of 1.1 in Example 1, and then amplified using the method of 1.4, and repeated three times.

[0085] The results obtained in this example are as follows Figure 5 As shown in the figure, after gradient dilution of the pcDNA3.1-MFAV-glycoprotein recombinant plasmid, the sensitivity of the established MFAVLAMP detection system can reach 2.20×10 3 copies / μL.

[0086] Example 5

[0087] Optimization of LAMP reaction time of MFAV.

[0088] The LAMP reaction was set up in a 25 μL reaction system containing 2.5 μL 2× BcaBEST Buffer, 1.0 μL BcaBEST DNA Polymerase ver. 2.0 (8 U / μL), 1.0 μL each of 10 μM outer primers F3 and B3, 1.0 μL each of 40 μM inner primers FIP and BIP, and 1.0 μL of the cDNA template sample to be tested. The volume was then made up to 25 μL with ddH2O. The reaction was performed at 65°C for 10, 20, 30, 40, 50, and 60 minutes to determine the optimal reaction time. After the reaction was completed, the reaction solution was evaluated according to Scheme 1 and Scheme 2 in Example 1. Figure 6 The results showed that LAMP amplification products could be clearly seen at 30, 40, 50 or 60 minutes of reaction, with the optimal LAMP reaction time being 30-60 minutes.

[0089] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0090] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A LAMP primer set for detecting mandarin fish arenavirus, characterized in that: Including outer primer pairs and inner primer pairs; The outer primer pairs are as follows: External primer F3: CAGTGAACACAACTTATCTTCT (SEQ ID NO. 1); Outer primer B3: ACACACCTCATCTCCCTG (SEQ ID NO. 2); The inner primer pairs are as follows: Inner primer FIP: AGTAGAATAATGCACACTGTGAACAGTAAGACAAGCAATTAGGAACG (SEQ ID NO.3); Internal primer BIP: TGCTCTGAACCTAGCCATTGTGTGAGAATGCTGAAGCCTA (SEQ ID NO. 4).

2. A detection system for detecting mandarin fish arenavirus, characterized in that: It comprises a LAMP amplification reaction system, wherein the LAMP amplification reaction system comprises the LAMP primer set according to claim 1.

3. A kit for detecting mandarin fish arenavirus, characterized in that: The method comprises the LAMP primer set according to claim 1, or the detection system according to claim 2.

4. The kit according to claim 3, wherein The kit also includes a positive control substance and a negative control substance.

5. The kit according to claim 4, characterized in that The positive control substance includes the glycoprotein gene of mandarin fish arenavirus.

6. A method for detecting mandarin fish arenavirus for non-disease diagnosis purposes, characterized in that: The following steps are involved: RNA of the sample to be tested is extracted and reverse transcribed into cDNA. LAMP amplification reaction is performed using the LAMP primer set of claim 1, the detection system of claim 2, or the kit of any one of claims 3-5 to obtain an amplified product, which is then detected.

7. The detection method according to claim 6, characterized in that The reaction conditions of the LAMP amplification reaction include: constant temperature reaction at 60-65° C. for 30-60 minutes, and constant temperature treatment at 80° C. for 5 minutes.

8. The detection method according to claim 6, characterized in that The detection includes agarose gel electrophoresis detection or neutral red staining detection.

9. The detection method according to claim 8, characterized in that The agarose gel electrophoresis detection comprises: separating the amplified product by agarose gel electrophoresis, and when a ladder-like band appears in the electrophoresis result, it is determined that the sample to be tested is infected with mandarin fish arenavirus; The neutral red staining test comprises: adding neutral red dye to the amplification product, and when the staining result is red, it is determined that the sample to be tested is infected with mandarin fish arenavirus.

10. Use of the LAMP primer set according to claim 1, the detection system according to claim 2, or the kit according to claims 3-5 in the preparation of a product for detecting mandarin fish arenavirus.