A cassava MeAOX gene and its application
By targeting the MeAOX gene through the MeAOX-VIGS silencing system, efficient and precise regulation of cyanogenic glycoside synthesis was achieved, solving the problem of low efficiency in regulating cassava cyanogenic glycoside content, significantly reducing linamarin content, and improving food safety and processing applicability.
Patent Information
- Application Number
- CN202510996311.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-07-18
AI Technical Summary
The existing technology lacks efficient cassava MeAOX gene silencing tools, resulting in low efficiency in regulating cassava cyanogenic glycoside content, affecting cassava food safety and processing costs. In addition, traditional genetic modification methods have a long cycle, and the virus-induced gene silencing system is inefficient and short-lived.
The MeAOX-VIGS silencing system was developed, using a specific VIGS silencing fragment to target the MeAOX gene. Through infection mediated by Agrobacterium GV3101-pSoup-p19 and combined with efficient real-time fluorescence quantitative PCR detection, efficient and precise regulation of cyanogenic glycoside synthesis was achieved.
Significantly reduce the linamarin content in cassava leaves by 42-57%, shorten the R&D cycle to 22 days, improve food safety and processing applicability, ensure the accuracy and stability of regulation, and provide a reliable basis for variety breeding.
Smart Images

Figure CN120505317B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioengineering technology, and specifically relates to cassava MeAOX Gene, MeAOX -VIGS silencing system and its applications. Background Art
[0002] Cassava ( Manihot esculenta Crantz, the world's sixth-largest food crop, is a staple food and a source of livelihood for nearly one billion people in tropical and subtropical regions. Its tubers contain up to 30% starch and are widely used in food processing, bioethanol production, and livestock feed. However, naturally occurring cyanogenic glycosides in cassava tubers (primarily linamarin and lotaustralin, which account for over 90%) can release highly toxic hydrocyanic acid (HCN) when activated by β-glucosidase. The acute toxicity is as low as 0.5-3.5 mg / kg body weight. This leads to hundreds of cassava food poisoning incidents each year. WHO data indicates that endemic neurological diseases such as "konzo disease" in Africa are directly linked to the long-term consumption of inadequately processed bitter cassava.
[0003] Currently, efforts to reduce the harmful effects of cassava cyanogenic glycosides rely primarily on physical processing (such as soaking and fermentation) and chemical treatments, but these can result in 30-50% nutrient loss and increased processing costs. Breeding low-cyanogenic glycoside varieties is considered a fundamental solution. Cyanogenic glycoside content is the key indicator for distinguishing bitter from sweet cassava. Understanding the molecular regulatory mechanisms of cyanogenic glycoside synthesis and developing low-cyanogenic glycoside varieties are key scientific challenges in breaking through the bottleneck of cassava's edible status. These efforts have significant practical implications for ensuring food security, reducing processing costs, and promoting industrial upgrading.
[0004] In the existing technology, a functional verification system for the cassava MeAOX gene has not yet been established, especially the lack of efficient in vivo gene silencing tools. Conventional transgenic methods have a long cycle (6-8 months for cassava transformation), and the application of the virus-induced gene silencing (VIGS) system in cassava still has problems such as low efficiency (<30% silencing rate) and short duration (<15 days). The cassava genome has a high heterozygosity, and the cyanogenic glycoside content in different cassava germplasms varies greatly. Using resequencing technology, a genome-wide association analysis was performed on the cyanogenic glycoside content of 368 cassava germplasm resources in the National Cassava Germplasm Resource Garden. A ubiquinol oxidase (AOX) was associated with a significant positive correlation with the cassava cyanogenic glycoside content, but its function in cassava cyanogenic glycoside synthesis has not been reported. Therefore, it is necessary to develop a gene targeting MeAOX The specific VIGS silencing system of cassava and its regulatory role in cyanogenic glycoside synthesis will provide new strategies and targets for the molecular design breeding of safe edible cassava varieties. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the main purpose of the present invention is to MeAOX- The VIGS silencing system revealed for the first time the regulatory role of this gene in the synthesis of cyanogenic glycosides in cassava, and provided a set of efficient and precise low-cyanogenic cassava cultivation programs, which is of great significance for ensuring food security and promoting the upgrading of the cassava industry.
[0006] In order to achieve the above purpose, the following technical solutions are adopted: a cassava MeAOX A gene-specific VIGS silencing fragment, the sequence of which is shown in SEQ ID NO: 2; selected from MeAOX A highly efficient silencing region of 300 bp at the 5' end of the gene; the silencing efficiency in cassava is ≥46%.
[0007] The present invention provides a cassava MeAOX -VIGS silencing vector containing cassava MeAOX A gene-specific VIGS silencing fragment is inserted into the pCsCMV vector through the Xba I / EcoR I site. After the vector is transformed into Agrobacterium GV3101-pSoup-p19, the infection efficiency OD600 is 0.8-1.0.
[0008] The present invention provides a cassava MeAOX The primer pair for full-length amplification of the gene consists of the following sequences:
[0009] Forward primer F: ATGGCTGTGAGTCTTTCCCC,
[0010] The reverse primer R is TCAGCTAAGTTCCTTGCTTT.
[0011] The present invention provides a cassava MeAOX Gene subcellular localization primer pair, consisting of the following sequences:
[0012] Forward primer F: agtggtctctgtccagtcct ATGGCTGTGAGTCTTTCCCC,
[0013] Reverse primer R: ggtctcagcagaccacaagt GCTAAGTTCCTTGCTTTTAC.
[0014] The present invention provides a cassava MeAOX The primer pair for real-time fluorescence quantitative PCR of the gene consists of the following sequences:
[0015] Forward primer F: TATTGCTAGAGTGCCATA,
[0016] Reverse primer R: AGATGATTGCTATATGTTGA.
[0017] The present invention provides a method for reducing the cyanogenic glycoside content in cassava, comprising: using the vector according to claim 3 to infect cassava leaves, culturing for 22 days, and detecting that the linamarin content is reduced by 42-57%.
[0018] Preferably, the Agrobacterium culture solution contains 10 mM MES, 10 mM MgCl2 and 100 μM acetosyringone; after infection, the silencing efficiency is verified using the primer pair described in claim 6.
[0019] The present invention provides cassava MeAOX- Application of VIGS silencing system in breeding low-cyanogenic cassava varieties.
[0020] Preferably, the linamarin content in the leaves of the target variety is ≤500 μg / g, and the cyanogenic glycoside reduction effect is stable.
[0021] The present invention has the following beneficial effects:
[0022] 1. The present invention uses VIGS silencing technology to target MeAOX The gene reduces the linamarin content in cassava leaves by 42-57% (836.75 μg / g for the control and 362.44-485.60 μg / g for the silenced strain), significantly reducing the risk of hydrocyanic acid (HCN) release; since the cyanogenic glycoside synthesis pathway is inhibited, this technology can further reduce the cyanogenic glycoside content in the tubers, thereby improving the safety and processing suitability of cassava food.
[0023] 2. 300 bp screened by the present invention MeAOX The specific fragment is located in the 5'-end efficient silencing region, with a silencing efficiency of 46-63%, and does not cross-react with other cassava genes, ensuring the accuracy and stability of regulation; the matching designed qPCR primers can quickly detect the expression level of MeAOX, facilitating real-time monitoring of the silencing effect.
[0024] 3. This invention uses the Agrobacterium GV3101-pSoup-p19-mediated VIGS system, which has a high infection efficiency (OD600 = 0.8-1.0) and can observe significant phenotypic changes in just 22 days, significantly shortening the R&D cycle compared to traditional transgenic technology (6-8 months).
[0025] 4. The present invention uses liquid chromatography-tandem mass spectrometry (NY / T 3607-2020) to accurately determine the content of cyanogenic glycosides. This method has high sensitivity and good repeatability, providing a reliable basis for variety selection and food safety assessment. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 for MeAOX PCR electrophoresis results of the gene in SC9 cassava variety.
[0027] Figure 2 for MeAOX Subcellular localization results.
[0028] Figure 3 for MeAOX Phenotype of silent strains.
[0029] Figure 4 For silenced strains MeAOX The relative expression of .
[0030] Figure 5 For cassava MeAOX Gene nucleotide sequence SEQ ID No: 1.
[0031] Figure 6 300 bp for virus-induced gene silencing system MeAOX DNA fragment sequence SEQ ID NO: 2. DETAILED DESCRIPTION
[0032] The features and advantages of the present invention can be further understood by the following detailed description in conjunction with the accompanying drawings. The examples provided are merely illustrative of the present invention and are not intended to limit the remainder of the present invention in any way. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.
[0033] Example 1 Cassava MeAOX Gene( Manes.16G002000 )
[0034] Using the cDNA of cassava leaves of Huanan 9 (SC9) as a template and the primers listed in Table 1, a 1080 bp fragment was obtained by PCR amplification (electrophoresis diagram as shown in Figure 1). Figure 1 The sequence of the cDNA fragment in cassava variety SC9 is shown in SEQ ID No: 1. Amplification system: Mix 25 μl of cDNA (1 μl), 1 μl of 10 μM primer F, 1 μl of 10 μM primer R, and 22 μl of ddH2O. The reaction procedure was: 95°C for 5 min; 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 60 s; and 72°C for 10 min.
[0035] Table 1 Cassava MeAOX Full-length gene amplification primers
[0036]
[0037] Example 2 Cassava MeAOX Subcellular localization of genes
[0038] according to MeAOXPrimers with adapters were designed based on the gene CDS sequence (Table 2). The positive clone plasmid was used as a template for amplification. The amplified product was purified by gel extraction and then ligated into the pNC-Green-SubN expression vector using Nimble Cloning Mix reagent to construct the plant expression vector pNC-Green-SubN. -MeAOX , and then transformed into E. coli competent cells and cultured at 37℃ overnight. Single clones were picked for bacterial liquid PCR identification, and the positive bacterial liquid was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. After sequencing and comparison analysis, the correct positive clone plasmid was selected to transform Agrobacterium GV3101-psoup competent cells, and pNC-Green-SubN- AOX The empty pNC-Green-SubN vector (control) was transformed into tobacco leaves. After 3 days, the distribution of fluorescence signals in tobacco leaf cells was observed using a laser confocal microscope (TCS SP8, Leica). Figure 2 As shown, MeAOX is localized in chloroplasts, which is consistent with the website prediction results.
[0039] Table 2 MeAOX Subcellular localization primers
[0040]
[0041] Example 3 Virus-induced gene silencing (VIGS) and qRT-PCR verification
[0042] Screening of 300 bp using VIGS-Tool online software MeAOX Specific fragment, 300 bp MeAOX The DNA fragment is shown in SEQ ID NO: 2. Use Primer5.0 to design specific amplification primers, and add 20bp universal linker sequences of NC vector at both ends of the primers. The amplification primers are used for sequence amplification and recovery. Use Nimble Cloing Mix reagent to connect it to the pCsCMV-NC vector. First, mix the PCR recovery product with the pCsCMV-NC empty plasmid, add 5 μl Mix, pipette 10-20 times, mix thoroughly, react at 50 ℃ for 50 minutes, and then transform 5ul reaction product into Escherichia coli competent TOP10. Then, pick a single clone for culture, bacterial liquid PCR identification, and positive clone sequencing. If the final sequencing result is correctly aligned, it means that the vector construction is complete and the vector containing MeAOX fragment pCsCMV- MeAOX Recombinant vector.
[0043] The constructed recombinant vector needs to be transformed into GV3101-pSoup-p19 competent Agrobacterium. After the PCR test is correct, the bacterial solution is expanded and cultured in a 28°C incubator. The OD 600 After the value reached 0.8-1.0, the cells were collected by centrifugation at 5000 rpm for 10 min, washed twice with a solution containing 10 mM MES, 10 mM MgCl2 and 100 μM acetosyringone, and the cells were collected by centrifugation. The Agrobacterium was resuspended in a solution containing 10 mM MES, 10 mM MgCl2 and 100 μM acetosyringone to an OD of 600 To about 0.8, and then stand in the dark for 2-3 hours. Use a syringe to inject the bacterial solution into the back of SC9 cassava leaves and grow them at room temperature for 22 days (the phenotype is as follows Figure 3 Total RNA was extracted from leaves and cDNA was obtained after reverse transcription. Sequencing primers CsCMV-F: TGGGCGCTAATTAGTTTACTGCA, CsCMV-R: GGTCAAGACGGCTCAACTCT TCA were used to detect the correct sequence. MeActin As the internal reference gene, use MeAOX Quantitative primers (Table 3) were used to detect the silenced lines by real-time fluorescence quantitative PCR. MeAOX qRT-PCR was performed using the SYBR kit (RR820A) produced by TaKaRa, Inc., on a Real-time Thermal Cycler produced by Thermo Fisher Scientific, Inc., according to the manufacturer's instructions. The reaction procedure was as follows: pre-denaturation at 95°C for 30 s; 40 cycles of 95°C for 10 s, 55°C for 10 s, and 72°C for 20 s. Each sample was repeated three times, and relative expression levels were calculated using the ΔΔC T Calculation was performed by the silencing method. MeAOX The relative expression of Figure 4 The specific silencing efficiency is shown in Table 4. MeAOX The gene silencing effect was more significant. MeAOX The relative expression of the gene in the silenced strain was 0.54, 0.37, and 0.47 compared with the control, and the silencing efficiency was 46%, 63%, and 53%, respectively.
[0044] Table 3 Cassava MeAOX Real-time fluorescence quantitative PCR primers
[0045]
[0046] Table 4 Cassava MeAOX Relative expression of target genes in silenced strains
[0047]
[0048] Example 4 Determination of cyanogenic glycoside content in leaves of silenced plants
[0049] The cyanogenic glycoside content in cassava leaves was determined using liquid chromatography-tandem mass spectrometry (LC-MS / MS) according to the industry standard (NY / T 3607-2020). The procedure is as follows: 1.0 g of leaves were weighed and added to 3 mL of 80% methanol-water solution (containing 0.1% formic acid). Vortex-mixed, the solution was then ultrasonically extracted for 15 minutes (at room temperature and protected from light). The supernatant was then clarified and reconstituted with 1 mL of methanol-water. The solution was then filtered through a 0.22 μm organic filter membrane for analysis by liquid chromatography-tandem mass spectrometry. Chromatographic conditions included a C18 column (50 mm × 2.1 mm, 1.8 μm), mobile phases: phase A: 0.1% formic acid-water solution, phase B: acetonitrile, flow rate: 0.2 mL / min, column temperature: 30°C, and injection volume: 10 μL. Mass spectrometry conditions included an electrospray ionization source in positive ion scan mode, a drying gas temperature of 325°C, a drying gas flow rate of 5 L / min, and a sheath gas temperature of 350°C. The samples and mixed standard working solution were measured by liquid chromatography-tandem mass spectrometry, and the chromatographic peak area was used for quantification according to the external standard method. The cyanogenic glycoside content in the leaves was calculated according to the formula. The cyanogenic glycoside content in the leaves of the plants is shown in Table 5. MeAOX After that, the linamarin content in the leaves decreased significantly.
[0050] Table 5 Cassava MeAOX Cyanogenic glycoside content in leaves of silenced strains
[0051]
[0052] The above disclosure is merely a preferred embodiment of the present invention, which certainly cannot be used to limit the scope of the present invention. Therefore, equivalent changes made according to the claims of the present invention still fall within the scope of the present invention.
Claims
1. A type of cassava MeAOX The application of gene-specific VIGS silencing fragments in cultivating low-cyanogenic cassava varieties is characterized by: The cyanogenic glycoside is linamarin, cassava MeAOX Gene-specific VIGS silencing fragment, the sequence of which is shown in SEQ ID NO: 2; Selected from MeAOX A highly efficient silencing region of 300bp at the 5' end of the gene; silencing efficiency in cassava is ≥46%; the linamarin content in leaves of the target variety is ≤500μg / g, and the cyanogenic glycoside reduction effect is stable.
2. A method for reducing the content of cyanogenic glycosides in tapioca, characterized in that include: The cyanogenic glycoside is linamarin, using cassava MeAOX -VIGS silencing vector infected cassava leaves, and detection after 22 days of culture, reduced the linamarin content by 42-57%; The cassava MeAOX -VIGS silencing vector comprises the cassava described in claim 1 MeAOX Gene-specific VIGS silencing fragments; The fragment is inserted into the pCsCMV vector through the SfiI site, and the vector is transformed into Agrobacterium GV3101-pSoup-p19, and the infection efficiency OD600 is 0.8-1.
0.
3. The method for reducing the content of cassava cyanogenic glycosides according to claim 2, wherein: The Agrobacterium culture solution contained 10 mM MES, 10 mM MgCl2, and 100 μM acetosyringone; after infection, the silencing efficiency was verified by real-time fluorescence quantitative PCR primer pairs.
4. The method for reducing the content of cassava cyanogenic glycosides according to claim 2, wherein: Cassava MeAOX The primer pair for full-length amplification of the gene consists of the following sequences: Forward primer F: ATGGCTGTGAGTCTTTCCCC; Reverse primer R: TCAGCTAAGTTCCTTGCTTT.
5. The method for reducing the content of cassava cyanogenic glycosides according to claim 2, wherein: Cassava MeAOX Gene subcellular localization primer pair, consisting of the following sequences: Forward primer F: agtggtctctgtccagtcct ATGGCTGTGAGTCTTTCCCC; Reverse primer R: ggtctcagcagaccacaagt GCTAAGTTCCTTGCTTTTAC.
6. The method for reducing the content of cassava cyanogenic glycosides according to claim 3, wherein: The real-time fluorescence quantitative PCR primer pair consists of the following sequences: Forward primer F: TATTGCTAGAGTGCCATA; Reverse primer R: AGATGATTGCTATATGTTGA.
Citation Information
Patent Citations
Cassava transcription factors MebHLH72 and MebHLH114 and application thereof in inhibition of synthesis of linamarin
CN114717247A