A vector based on uaug-ds combined with sgp183 gradient reduces protein expression in plants, construction method and application
By constructing a vector combining uAUG-ds and sGP183, and tandemly using different types of uAUG-ds to reduce the expression of the target protein, the problem of high protein expression interfering with plant growth after viral infection was solved, thus enabling precise regulation and functional analysis.
Patent Information
- Application Number
- CN202510722706.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-05-30
AI Technical Summary
Existing technologies struggle to precisely regulate the expression levels of virus-induced proteins without affecting plant growth and yield, especially addressing the problem of high protein expression interfering with plant growth and development after PepMV infection of tomatoes.
A vector based on uAUG-ds combined with the PepMV subgene promoter sGP183 was constructed. By tandemly using different types of uAUG-ds, the accumulation of the target protein was reduced, thereby achieving gradient regulation of protein expression.
This technology enables precise regulation of target protein expression levels in plants, solves the problem of high-expression proteins interfering with plant growth and development, and provides assistance in studying the functional analysis of different expression levels.
Smart Images

Figure CN120505358B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, in particular to a vector for reducing protein expression in plants by using a uAUG-ds combined with a subgenomic promoter sGP183 of Pepino mosaic virus (PepMV), a construction method and application. BACKGROUND
[0002] Pepino mosaic virus (PepMV) is a positive-sense single-stranded RNA virus with a genome length of about 6.4 kb, belonging to the genus of Potexvirus. The genomic RNA encodes an RNA-dependent RNA polymerase (RdRP), which plays a key role in virus replication and transcription; the subgenomic sgRNA1 and sgRNA2 encode three gene block proteins (TGB1, TGB2 and TGB3), which are responsible for intercellular movement of the virus; the RdRP recognizes the subgenomic sgRNA3 encoded by the subgenomic promoter sGP183 to encode the coat protein (CP), which forms a virus particle with protective function by wrapping the viral RNA. The virus mainly infects Solanaceae crops such as tomatoes, peppers and eggplants, and is particularly harmful to tomato production. After PepMV infects tomatoes, the tomato leaves show symptoms of mottling, wrinkling or deformation, and the tomato fruits show symptoms of yellowing or green fading spots, fruit skin indentation or "tiger skin" patterns.
[0003] The "TBF1 regulatory cassette" regulates pathogen-responsive translation through two upstream open reading frames (uORFs), thereby regulating the expression of the immune gene NPR1, so that Arabidopsis thaliana and rice obtain broad-spectrum disease resistance without affecting growth and yield. Subsequent studies have found that the double-stranded RNA structure (uAUG-ds) upstream of the start codon uAUG of the TBF1 mRNA inhibits protein translation, while the immune-induced RNA helicase can unwind the uAUG-ds to promote the translation of defense proteins. SUMMARY
[0004] The purpose of the present application is to provide a vector for reducing protein expression in plants based on uAUG-ds combined with sGP183 and a construction method and application.
[0005] The 5' UTR region of TUB7 and TBF1 both contain uAUG-ds, which are named as A-uAUG-ds (containing 144 nucleotides) and B-uAUG-ds (containing 105 nucleotides), respectively. The Class1 uAUG-ds is named as C-uAUG-ds (containing 54 nucleotides). The sequences are shown in SEQ ID NO: 4-6; the sequence of sGP183 of PepMV is shown in SEQ ID NO: 7.
[0006] The vector constructed in the application can reduce the accumulation of the target protein under the condition of not changing the promoter, and the single uAUG-ds and sGP183 in series can reduce the accumulation of the target protein. On the basis of uAUG-ds-sGP183, the C-uAUG-ds in series can further reduce the accumulation of the target protein, so as to realize the gradient reduction of the expression of the target protein in plants. The application provides help for the functional analysis of different expression amounts of the target gene in plants. For the problem of transgene caused by the interference of high expression protein on the growth and development of plants, the application can accurately regulate the expression amount of the target protein, so as to effectively solve the problem.
[0007] Specifically, the technical scheme adopted by the application is as follows:
[0008] The vector for gradient reduction of protein expression in plants based on uAUG-ds combined with sGP183 is a pCAMBIA1300 vector skeleton, which uses the translation inhibition element uAUG-ds combined with the subgenomic promoter sGP183 of PepMV to construct a single uAUG-ds combined with sGP183 vector and / or a double uAUG-ds combined with sGP183 vector.
[0009] (I) Construction of single uAUG-ds combined with sGP183 vector
[0010] A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR are artificially synthesized, and the 3'UTR is the 3'UTR of PepMV, and the sequences are shown in SEQ ID NO: 1-3. The sequences of A-uAUG-ds, B-uAUG-ds and C-uAUG-ds are shown in SEQ ID NO: 4-6. The sequences of sGP183 and 3'UTR of PepMV are shown in SEQ ID NO: 7-8.
[0011] A synthetic A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR as a template, using primers F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI to obtain a specific PCR band, and then the PCR target band is constructed into a linearized pCAMBIA1300 vector with SacI and BamHI, to obtain pCAMBIA1300-A, B and C-sGP183 vectors. The sequences of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI are shown in SEQ ID NO: 13-16;
[0012] F-A: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC
[0013] F-B: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC
[0014] F-C: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG
[0015] R-BamHI: TACGAACGAAAGCTCGGATCC TTTTTTTTTTTTTTTTTAAATTACAAAAG
[0016] The primers are identified as F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM. The correct clones are cultured in large quantities, the plasmid is extracted, and sequenced with R-pCAM primers, and the sequence is shown in SEQ ID NO: 17;
[0017] R-pCAM: CACAGTAAATTACAAGCACAAC.
[0018] GFP is used as a candidate protein to evaluate the effect of the vector:
[0019] (1) Using F-GFP / R-GFP primers, GFP was constructed into Kpnl linearized pCAMBIA1300-A-uAUG-ds-sGP183, pCAMBIA1300-B-uAUG-ds-sGP183 and pCAMBIA1300-C-uAUG-ds-sGP183 using UV irradiation to emit green fluorescence, named pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP and pCAMBIA1300-C-sGP183-GFP. The GFP sequence is shown in SEQ ID NO: 9. The sequence of F-GFP / R-GFP is shown in SEQ ID NO: 18-19:
[0020] F-GFP: CAGTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC
[0021] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA
[0022] The primer F-GFP / R-pCAM was identified, and the sequence is shown in SEQ ID NO: 18 and 17.
[0023] (2) The correct pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP and pCAMBIA1300-C-sGP183-GFP were transformed into Agrobacterium to obtain positive Agrobacterium. Subsequently, the Agrobacterium was inoculated into the leaves of Nicotiana benthamiana. Two days after injection, UV irradiation was used to observe GFP fluorescence, followed by Western blot and qRT-PCR to detect the accumulation of GFP protein and the mRNA level of GFP. The degree of reduction of GFP protein was evaluated according to the fluorescence intensity of GFP protein and the accumulation of GFP protein.
[0024] (B) Construction of vectors combining double uAUG-ds with sGP183
[0025] AC-uAUG-ds-sGP183-Kpnl-3'UTR, BC-uAUG-ds-sGP183-Kpnl-3'UTR and 2C-uAUG-ds-sGP183-Kpnl-3'UTR were artificially synthesized. The sequences are shown in SEQ ID NO: 10-12.
[0026] A specific PCR band was obtained using primers F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI with AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR as templates, and then the PCR target band was constructed into the pCAMBIA1300 vector linearized by SacI and BamHI to obtain pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 vectors. The sequences of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI are shown in SEQ ID NO: 13-16;
[0027] Primers F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM were identified. The correct clones were cultured in large scale, plasmids were extracted, and sequenced with R-pCAM primers, and the sequence is shown in SEQ ID NO: 17;
[0028] GFP was used as a candidate protein to evaluate the effect of the vector:
[0029] (1) UV irradiation was used to emit green fluorescence of GFP to construct pCAMBIA1300-AC-uAUG-ds-sGP183, pCAMBIA1300-BC-uAUG-ds-sGP183 and pCAMBIA1300-2C-uAUG-ds-sGP183 linearized by KpnI, named as pCAMBIA1300-AC-sGP183-GFP, pCAMBIA1300-BC-sGP183-GFP and pCAMBIA1300-2C-sGP183-GFP. The sequence of GFP is shown in SEQ ID NO: 9. The sequences of F-GFP / R-GFP are shown in SEQ ID NO: 18-19:
[0030] Primers F-GFP / R-pCAM were identified, and the sequences are shown in SEQ ID NO: 18 and 17.
[0031] (2) Transform the correct pCAMBIA1300-AC, BC and 2C-sGP183-GFP into Agrobacterium to obtain positive Agrobacterium. Then Agrobacterium is inoculated into Nicotiana benthamiana leaves. The next day after injection, UV irradiation is observed for GFP fluorescence, followed by Western blot and qRT-PCR to detect the accumulation of GFP protein and the mRNA level of GFP. The degree of reduction of GFP protein is evaluated according to the fluorescence intensity of GFP protein and the accumulation of GFP protein.
[0032] Compared with the prior art, the outstanding effects of the present application are:
[0033] (1) The present application is based on a large number of experiments. It is found that the expression amount of the target protein in plants can be reduced by connecting different types of uAUG-ds and sGP183 in series, so as to control the expression amount of the target protein at a suitable level according to the characteristics of the target protein, and promote the functional research of the target protein.
[0034] (2) The present application provides help for the functional analysis of different expression amounts of the target protein in plants. For the problem of transgenic difficulty caused by high expression protein interfering with plant growth and development, the present application can precisely regulate the expression amount of the target protein, thereby effectively solving the problem.
[0035] The vector for reducing the expression of protein in plants based on uAUG-ds combined with sGP183, the construction method and application thereof described in the present application will be further described in combination with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figures 1-3 It is a vector map of single uAUG-ds combined with sGP183. Among them, Figure 4 It is a vector map of A-uAUG-ds-sGP183. KpnI is used for inserting the target gene. It is a vector map of B-uAUG-ds-sGP183.
[0038] It is a vector map of C-uAUG-ds-sGP183.
[0039] It is the accumulation of GFP protein reduced by single uAUG-ds combined with sGP183. Among them,
[0040] (A) Schematic diagram of single uAUG-ds, sGP183 and GFP tandem structure. The expression of GFP is controlled by 35S promoter. The 5'UTR regions of TUB7 and TBF1 contain uAUG-ds, named as A-uAUG-ds (144 nt) and B-uAUG-ds (105 nt), respectively. The Class 1 uAUG-ds containing 54 nt is named as C-uAUG-ds. The blue line represents the 3'UTR sequence of sGP183 and PepMV, in which sGP183 is the subgenomic promoter of PepMV CP. The pink box indicates the first 36 nucleotides (nt) of the N-terminal of CP protein.
[0039] (B) The effect of single uAUG-ds combined with sGP183 on GFP accumulation was demonstrated by GFP fluorescence intensity. Agrobacterium (OD 600 = 0.5) carrying GFP, sGP183-GFP or uAUG-ds-sGP183-GFP vectors were infiltrated to inoculate N. benthamiana leaves. Two days after inoculation, the infiltrated leaves were photographed under UV light equipped with a yellow filter. pCAMBIA1300 empty vector (EV) was used as a negative control.
[0040] (C) The effect of single uAUG-ds combined with sGP183 on GFP accumulation was analyzed by Western blot. GFP protein was detected using anti-GFP antibody, with Actin as an internal reference. This experiment was repeated independently three times, and the representative results are shown. The amount of GFP protein accumulation shown in the left image was quantitatively analyzed by IMAGEJ software and expressed as mean ± standard error (SEM, n = 3). Significant differences were determined according to Duncan's multiple range test (P < 0.05, using IBM SPSS STATISTICS software).
[0041] (D) The effect of single uAUG-ds combined with sGP183 on GFP mRNA level was analyzed by qRT-PCR. Error bars represent the mean ± standard deviation (SD) (n = 3 biological replicates).
[0042] Figures 5-7 Vector map of double uAUG-ds combined with sGP183. Figure 5 Vector map of AC-uAUG-ds-sGP183, Kpnl was used for inserting the gene of interest. Figure 6 Vector map of BC-uAUG-ds-sGP183. Figure 7 Vector map of 2C-uAUG-ds-sGP183.
[0043] Figure 8 Double uAUG-ds combined with sGP183 reduced the accumulation of GFP protein.
[0044] (A) Schematic diagram of double uAUG-ds, sGP183 and GFP tandem structure. A, B and C-uAUG-ds are connected with C-uAUG-ds in series, respectively, and are named as AC-, BC- and 2C-uAUG-ds, respectively.
[0045] (B) Effect of double uAUG-ds combined with sGP183 on GFP accumulation by GFP fluorescence intensity.
[0046] (C) Effect of double uAUG-ds combined with SGP183 on GFP accumulation by Western blot analysis.
[0047] (D) Effect of double uAUG-ds combined with sGP183 on GFP mRNA level by qRT-PCR. DETAILED DESCRIPTION
[0048] A vector for reducing protein expression based on the combination of translation inhibition element uAUG-ds and PepMV subgenomic promoter sGP183, the construction method comprising the following steps:
[0049] (I) Artificially synthesizing A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR, and the 3'UTR is the 3'UTR of PepMV. The sequences of A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NO: 1-3. The sequences of A-uAUG-ds, B-uAUG-ds and C-uAUG-ds are shown in SEQ ID NO: 4-6. The sequences of sGP183 and 3'UTR of PepMV are shown in SEQ ID NO: 7-8.
[0050] A synthetic A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR as a template, using primer F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI to obtain a specific PCR band; after agarose gel electrophoresis, and gel recovery and purification of specific PCR target band. The sequence of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI is shown in SEQ ID NO: 13-16;
[0051] F-A: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC
[0052] F-B: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC
[0053] F-C: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG
[0054] R-BamHI: TACGAACGAAAGCTCGGATCC TTTTTTTTTTTTTTTTTAAATTACAAAAG
[0055] PCR target band was constructed into SacI and BamHI linearized pCAMBIA1300 vector, and transformed into DH5α E. coli competent. The primer was identified as F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM. The correct clone was cultured, the plasmid was extracted, and sequenced with R-pCAM primer, and the sequence is shown in SEQ ID NO: 17;
[0056] R-pCAM: CACAGTAAATTACAAGCACAAC
[0057] Thus, pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183 and pCAMBIA1300-C-sGP183 vectors were obtained, as shown in SEQ ID NO: 18-20. Figures 1-3
[0058] (ii) In order to clarify the effect of A-sGP183, B-sGP183 and C-sGP183 on the accumulation of target protein. The GFP which can emit green fluorescent protein under ultraviolet irradiation was used as a candidate protein to evaluate the effect of the vector.
[0059] 1, TMV-GFP as a template, using primer F-GFP / R-GFP amplified GFP nucleotide sequence, get a specific PCR band; after agarose gel electrophoresis, and cut the gel recovery and purification of specific PCR band; GFP sequence as SEQ ID NO: 9. F-GFP / R-GFP sequence as SEQ ID NO: 18-19:
[0060] F-GFP: CAGTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC
[0061] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA
[0062] 2, 600ng pCAMBIA1300-A, B and C-sGP183 plasmid, KpnI 1 μL, 10 x FastDigest Green Buffer 2 μL; the rest of the system with ddH2O to 20 μL; 37℃ enzyme cutting 4h, then 80℃ 10min, -20℃ freezing preservation;
[0063] 3, KpnI enzyme cutting pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183 and pCAMBIA1300-C-sGP183 plasmid 1 μL, F-GFP / R-GFP amplified fragments 2 μL, 2 x Master Assembly Mix 5 μL, ddH2O to 10 μL, 50℃ reaction 15min;
[0064] 4, 10 μL ligation product into E. coli DH5α, using kanamycin as resistance screening, single clone colony PCR identification and sequencing, to confirm whether the fragment is connected into the vector;
[0065] F-GFP / R-pCAM identification primer sequence as SEQ ID NO: 18 and 17; the correct clone to expand culture, extraction of plasmid, and R-pCAM primer sequencing.
[0066] Thus obtained containing pCAMBIA1300-A-sGP183-GFP, pCAMBIA1300-B-sGP183-GFP and pCAMBIA1300-C-sGP183-GFP vector, as Figure 4 A shown.
[0067] (iii) The vectors of pCAMBIA1300-A-sGP183-GFP, B-sGP183-GFP and C-sGP183-GFP were transformed into EHA105 Agrobacterium competence, and the positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM, the sequences of which are shown in SEQ ID NO: 18 and 17. Agrobacterium containing pCAMBIA1300-A, B and C-sGP183-GFP were infiltrated into N. benthamiana leaf pieces. Two days after injection, the GFP fluorescence of the sGP183-GFP region was weaker than that of the GFP-expressing region of the leaf (Fig. 2B-D). Western blot and qRT-PCR both detected weaker GFP protein bands and lower GFP mRNA levels in the sGP183-GFP region than in the GFP-expressing region of the leaf (Fig. 2B-D). This indicates that sGP183 can reduce the accumulation of GFP protein by reducing the level of GFP mRNA. Figure 4 B-D). This indicates that sGP183 can reduce the accumulation of GFP protein by reducing the level of GFP mRNA. Figure 4 B-D). C-uAUG-ds only slightly reduced the accumulation of GFP protein. A-uAUG, although it increased the level of GFP mRNA, significantly reduced the GFP fluorescence intensity and protein accumulation (Fig. 2B-D). These results show that a single uAUG-ds combined with sGP183 can effectively reduce the accumulation of GFP protein, and the ability of different types of uAUG-ds-sGP183 to affect GFP protein accumulation is in the order of B-sGP183 > A-sGP183 > C-sGP183. Figure 4 B-D). This indicates that sGP183 can reduce the accumulation of GFP protein by reducing the level of GFP mRNA. Figure 4 B-D). This indicates that sGP183 can reduce the accumulation of GFP protein by reducing the level of GFP mRNA.
[0068] (iv) AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR were artificially synthesized. The sequences of AC, BC and 2C-uAUG-ds-sGP183-KpnI-3'UTR are shown in SEQ ID NO: 10-12.
[0069] A specific PCR band was obtained using primers F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI with AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR as templates; the specific PCR band was recovered and purified by agarose gel electrophoresis. The sequences of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI are shown in SEQ ID NO: 13-16;
[0070] The PCR band was constructed into a SacI and BamHI linearized pCAMBIA1300 vector, and transformed into DH5α E. coli competent cells. The primers were identified as F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM. The correct clones were cultured, the plasmid was extracted, and sequenced with R-pCAM primers, and the sequence is shown in SEQ ID NO: 17;
[0071] The vectors containing pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 were obtained, as shown in SEQ ID NO: 18. Figures 5-7
[0072] (Five) In order to clarify the effect of AC-sGP183, BC-sGP183 and 2C-sGP183 on the accumulation of target protein, GFP which can emit green fluorescence under ultraviolet irradiation was used as a candidate protein to evaluate the effect of the vector.
[0073] 1. Using TMV-GFP as a template, the nucleotide sequence of GFP was amplified using primers F-GFP / R-GFP to obtain a specific PCR band; the specific PCR band was recovered and purified by agarose gel electrophoresis; the sequence of GFP is shown in SEQ ID NO: 9. The sequences of F-GFP / R-GFP are shown in SEQ ID NO: 18-19:
[0074] 2. 600 ng of pCAMBIA1300-AC, pCAMBIA1300-BC and pCAMBIA1300-2C-sGP183 plasmids, KpnI 1 μL, 10×FastDigest Green Buffer 2 μL; the rest of the system was supplemented with ddH2O to 20 μL; 37°C for 4 h, then 80°C for 10 min, and stored at -20°C;
[0075] 3, 1 μL of the backbone of pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 plasmids digested by Kpnl, 2 μL of the amplified fragment of F-GFP / R-GFP, 5 μL of 2x Master Assembly Mix from MBI Fermentas, and ddH2O to make up to 10 μL, 50°C for 15 min;
[0076] 4, 10 μL of the ligation product was transformed into E. coli DH5α, kanamycin was used as the resistance screening, single colonies were selected for colony PCR identification and sequencing to confirm whether the fragment was connected to the vector;
[0077] The primer F-GFP / R-pCAM was identified, and the sequence is shown in SEQ ID NO: 18 and 17; the correct clone was cultured, the plasmid was extracted, and sequencing was performed using the R-pCAM primer.
[0078] Thus, the vectors containing pCAMBIA1300-ACsGP183-GFP, pCAMBIA1300-BC-sGP183-GFP and pCAMBIA1300-2C-sGP183-GFP were obtained, as shown in Figure 8 A.
[0079] (VI) The pCAMBIA1300-AC, BC and 2C-sGP183-GFP vectors were transformed into EHA105 Agrobacterium competent cells, and the primer F-GFP / R-pCAM was used to identify positive Agrobacterium colonies, and the sequence is shown in SEQ ID NO: 18 and 17. The Agrobacterium containing pCAMBIA1300-AC, BC and 2C-sGP183-GFP was infiltrated into the leaves of Nicotiana benthamiana. Two days after injection, as shown in Figure 8 B, compared with single uAUG-ds, double uAUG-ds further reduced the GFP fluorescence intensity and the accumulation of GFP protein Figure 8 B-C), BC-sGP183-GFP showed the weakest protein band. qRT-PCR detection found that BC-uAUG-ds did not affect the mRNA level of GFP compared with sGP183-GFP and B-sGP183-GFP, while 2C and AC could reduce the mRNA level of GFP Figure 8 D).
[0080] RNA was extracted by Trizol method, cDNA was obtained by reverse transcription, qRT-PCR detection of GFP mRNA was performed using primer qPCR-GFP-F / R as a template, and the primer qPCR-GFP-F / R is shown in SEQ ID NO: 20-21.
[0081] qPCR-GFP-F: CAATGTATACATCACGGCAGAC
[0082] qPCR-GFP-R: TTTCGAAAGGGCAGATTGTG
[0083] Total protein was extracted by urea method, and Western blot was used to detect GFP protein.
[0084] The above experimental results show that the accumulation amount of GFP protein can be gradiently reduced by using single and double uAUG-ds combined with sGP183.
[0085] The above-described embodiments are merely preferred embodiments of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the claims of the present application.
Claims
1. A vector for reducing expression of a protein in a plant based on a combination of uAUG-ds and sGP183 gradient, characterized in that: Using pCAMBIA1300 as a vector skeleton, a single uAUG-ds combined with sGP183 vector is constructed by using the translation inhibiting element uAUG-ds combined with the subgene promoter sGP183 of PepMV; A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR are artificially synthesized and constructed into pCAMBIA1300 to obtain pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183 and pCAMBIA1300-C-sGP183 vectors; wherein the sequences of A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR are shown as SEQ ID NO:1-3.
2. The method for constructing the vector for expressing the protein based on the uAUG-ds combined sGP183 gradient reduction in plants according to claim 1, characterized in that: A-uAUG-ds-sGP183-KpnI-3'UTR, B-uAUG-ds-sGP183-KpnI-3'UTR and C-uAUG-ds-sGP183-KpnI-3'UTR are artificially synthesized and constructed into pCAMBIA1300 to obtain pCAMBIA1300-A-sGP183, pCAMBIA1300-B-sGP183 and pCAMBIA1300-C-sGP183 vectors; wherein the sequences of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI are shown as SEQ ID NO:13-16; F-A: GAGAGAACACGGGGGACGAGCTCATGGTCTCTGCTTCTGACGTC F-B: GAGAGAACACGGGGGACGAGCTC ATGGAAGAAACCAAACGAAACTC F-C: GAGAGAACACGGGGGACGAGCTC ATGTGGATGAGGAGTTCGATTG R-BamHI: TACGAACGAAAGCTCGGATCC TTTTTTTTTTTTTTTTTAAATTACAAAAG The primers are identified as F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM; the correct clones are cultured in large scale, the plasmids are extracted, and the sequences are sequenced by using R-pCAM primers, and the sequences are shown as SEQ ID NO:17; R-pCAM: CACAGTAAATTACAAGCACAAC. 3. A vector for reducing expression of a protein in a plant based on a combination of uAUG-ds and sGP183 gradient, characterized in that: Using pCAMBIA1300 as a vector skeleton, a double uAUG-ds combined with sGP183 vector is constructed by using the translation inhibitory element uAUG-ds combined with the subgene promoter sGP183 of PepMV; AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR are artificially synthesized and constructed into pCAMBIA1300 to obtain pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 vectors; wherein the sequences of AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR are shown as SEQ ID NO: 10-12.
4. The method for constructing a vector for expressing a reduced protein based on uAUG-ds combined sGP183 gradient according to claim 3, characterized in that: Using AC-uAUG-ds-sGP183-KpnI-3'UTR, BC-uAUG-ds-sGP183-KpnI-3'UTR and 2C-uAUG-ds-sGP183-KpnI-3'UTR artificially synthesized as templates, a specific PCR band is obtained by using primers F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI, and then the PCR target band is constructed into the linearized pCAMBIA1300 vector with SacI and BamHI to obtain pCAMBIA1300-AC-sGP183, pCAMBIA1300-BC-sGP183 and pCAMBIA1300-2C-sGP183 vectors; wherein the sequences of F-A / R-BamHI, F-B / R-BamHI and F-C / R-BamHI are shown as SEQ ID NO: 13-16; The primers are identified as F-A / R-pCAM, F-B / R-pCAM and F-C / R-pCAM; the correct clones are cultured in large scale, the plasmids are extracted, and the sequences are sequenced by using R-pCAM primers, and the sequences are shown as SEQ ID NO:
17.
5. The application of the uAUG-ds combined with sGP183 gradient reducing protein expression vector in claim 1 or 3 in regulating the expression amount of the target protein.
Citation Information
Patent Citations
PCAMBIA1300-miniRNA3-BC-NLPPya vector, construction method and application of vector in high cucumber mosaic virus resistance
CN120505357A