A brucella typing detection kit and a detection method thereof

Abstract

The application relates to a Brucella typing detection kit and a detection method thereof, and relates to the technical field of biological detection, and comprises the following components: a reaction solution, a detection solution, an enzyme mixed solution, a quantitative standard, a typing standard and a blank control; the reaction solution comprises 5xPCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1ug / muL SSB and 0.1-1mM MnCl2. The kit and the detection method thereof are excellent in signal strength, complex sample tolerance, detection sensitivity and specificity.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, and particularly relates to a Brucella typing detection kit and a detection method thereof. BACKGROUND

[0002] Brucellosis is a zoonosis caused by Brucella, which poses a serious threat to animal husbandry production and human health. There are many species of Brucella, and different species and biotypes differ in pathogenicity, transmission route and treatment method. Therefore, accurate typing detection is crucial for disease prevention and treatment, which not only helps to understand the biological characteristics and pathogenic mechanism, but also provides an important basis for epidemic tracking, clinical diagnosis, epidemiological research and prevention and control.

[0003] Traditional Brucella typing detection methods mainly include bacterial culture method and serological detection method. Although the bacterial culture method is the "gold standard" for diagnosing Brucella, it has a long detection period, high requirements for experimental environment and operating personnel, and is easily contaminated by miscellaneous bacteria, which affects the accuracy of the detection results. Although the serological detection method, such as the rose bengal plate agglutination test and the test tube agglutination test, is relatively simple to operate, it has low specificity and sensitivity, and cannot accurately distinguish different Brucella types, which may result in false positive and false negative results. With the development of molecular biology technology, nucleic acid-based detection methods have been gradually applied to Brucella typing detection, but the existing nucleic acid-based detection technology still has defects in signal strength and adaptability to complex samples.

[0004] In the existing Brucella detection, the performance of the marker has a significant impact on the detection results. Conventional markers have weak signals and are prone to quenching, which makes it difficult to meet the detection needs of trace samples. At the same time, actual detection samples are derived from a wide range of sources and are complex in composition, often containing various inhibitors such as hemoglobin in blood and proteases in tissues, which can interfere with the activity of the detection reagent, resulting in inaccurate detection results. The existing detection kit has poor tolerance to complex samples, which cannot meet the actual detection needs.

[0005] For example, a Chinese invention patent with the authorized publication number CN105624303B discloses a bovine, ovine, porcine and canine Brucella typing fluorescence PCR detection kit and its preparation and application. The kit includes bovine Brucella detection primers and probes, ovine Brucella detection primers and probes, porcine Brucella detection primers and probes, and canine Brucella detection primers and probes. The kit has high detection sensitivity, with a minimum detection limit of 1x10 3 copy / ml, and the accuracy and positive rate are both as high as 100%. However, the signal strength and tolerance to complex samples of the kit and its application method still need to be further improved.

[0006] It can be seen that the Brucella typing detection kit and the detection method thereof, which are superior to the traditional detection method in signal strength, complex sample tolerance, detection sensitivity and specificity, can more accurately and efficiently realize the typing detection of Brucella, meet the market demand, have wide market value and application prospect, and have very important significance for promoting the development of accurate Brucella typing technology. SUMMARY

[0007] The present application aims to overcome the deficiencies of the prior art and provide a Brucella typing detection kit and a detection method thereof, which are superior to the traditional detection method in signal strength, complex sample tolerance, detection sensitivity and specificity, and can more accurately and efficiently realize the typing detection of Brucella.

[0008] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is: a Brucella typing detection kit, comprising the following components: a reaction solution, a detection solution, an enzyme mixture, a quantitative standard, a typing standard, and a blank control; the reaction solution comprises: 5x PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1μg / μL SSB, and 0.1-1mM MnCl2.

[0009] Preferably, the surfactant is Tween-20; and the enhancer is betaine.

[0010] Preferably, the quantitative standard is: a Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, and 10 4 copies / ml of sterile purified water, as a quantitative standard.

[0011] Preferably, the typing standard is: four Brucella amplification product fragments connected to four pUC57 plasmid vectors, respectively, diluted to 10 6 copies / ml of sterile purified water, respectively, as a typing standard.

[0012] Preferably, the blank control is sterile purified water.

[0013] Preferably, the enzyme mixture comprises: 5 U / μl hot start Taq enzyme, 5 U / μl DNA UDG enzyme, 0.1 U / μl ExoIII exonuclease.

[0014] Preferably, the detection solution comprises: Brucella quantitative primer pair and probe P0, B. abortus amplification primer pair and probe P1, B. melitensis amplification primer pair and probe P2, B. suis amplification primer pair and probe P3, B. canis amplification primer pair and probe P4.

[0015] Preferably, the Brucella quantitative primer pair comprises upstream primer F0 and downstream primer R0; the B. abortus amplification primer pair comprises upstream primer F1 and downstream primer R1; the B. melitensis amplification primer pair comprises upstream primer F2 and downstream primer R2; the B. suis amplification primer pair comprises upstream primer F3 and downstream primer R3; the B. canis amplification primer pair comprises upstream primer F4 and downstream primer R4.

[0016] Preferably, the sequence of F0 is GATATTGGCAACCGAGCCAT, and the concentration is 400 nM.

[0017] Preferably, the sequence of R0 is TATTATCCGATTGGTGGTCT, and the concentration is 400 nM.

[0018] Preferably, the sequence of P0 is 5'-fluorescent reporter group-GAAATCGCGTTCGCGAT-fluorescent quencher group-3', the 5' end labeled fluorescent reporter group is ROX PLUS, the 3' end labeled fluorescent quencher group is BHQ1, and the concentration is 80 nM.

[0019] Preferably, the sequence of F1 is CACACTCACCTTCCACAACA, and the concentration is 100 nM.

[0020] Preferably, the sequence of R1 is CCCGTTC TGCACCAGAC, and the concentration is 500 nM.

[0021] Preferably, the sequence of P1 is 5'-fluorescent reporter group-ACAAGGGTGGAACGACCTTTGCAGGC-fluorescent quencher group-3', the 5' end labeled fluorescent reporter group is ROX PLUS, the 3' end labeled fluorescent quencher group is BHQ1, and the concentration is 500 nM.

[0022] Preferably, the sequence of F2 is TCGYATCGGCAGTTTCAA, and the concentration is 120 nM.

[0023] Preferably, the sequence of R2 is CAGCTTTTGGCCTTTTCC, and the concentration is 500 nM.

[0024] Preferably, the sequence of P2 is 5'-fluorescent reporter group-CATGGCCCGCAATCTGGAAAAGG-fluorescent quencher group-3', the 5' end labeled fluorescent reporter group is ROX PLUS, the 3' end labeled fluorescent quencher group is BHQ1, and the concentration is 500 nM.

[0025] Preferably, the sequence of F3 is CAAATATCCATGCGGGAAG, and the concentration is 120 nM.

[0026] Preferably, the sequence of R3 is TGGGCATTCTCTACGGTG, and the concentration is 650 nM.

[0027] Preferably, the sequence of P3 is 5'-fluorescent reporter group-CCATAAAGCGCAAAGATCACACCGTAGAGA-fluorescent quencher group-3', the 5' end labeled fluorescent reporter group is ROX PLUS, the 3' end labeled fluorescent quencher group is MGB, and the concentration is 650 nM.

[0028] Preferably, the sequence of F4 is GCACAGGCAGGCGA, and the concentration is 100 nM.

[0029] Preferably, the sequence of R4 is GACATCACCGTTCACGC, and the concentration is 500 nM.

[0030] Preferably, the sequence of P4 is 5'-fluorescent reporter group-TCTATCTGGCCAAATATCGCGTGAACGGTGAT-fluorescent quencher group-3', the 5' end labeled fluorescent reporter group is ROX PLUS, the 3' end labeled fluorescent quencher group is BHQ1, and the concentration is 500 nM.

[0031] Preferably, the detection target sequence of the Brucella quantitative primer pair and probe P0 is: GATATTGGCAACCGAGCCATTCGACGAAACGGCCGTCGCGACGAGACCCGGCACGCCCTTTTCGCCTGCGCCGGAAATCGCGTTCGCGATCAGACCACCAATCGGATAATA.

[0032] Preferably, the detection target sequence of the Brucella abortus amplification primer pair and probe P1 is: TTGCGAGCGGCAGCACGCTGCAGCTTGGCGATGGCAGCACGGATGGCAGGCTTGCGGGCAATGTGGCCA ATGCGGGCACACTCACCTTCCACAACAAGGGTGGAACGACCTTTGCAGGCGAGATCTCCGGCACTGGCAG TCTGGTGCAGAACGGGGCGGGTGCACTGACGCTGAGCGGTGACAGCCAAGGTTTTGCCGGT.

[0033] Preferably, the detection target sequence of the Brucella melitensis amplification primer pair and probe P2 is: GGCGCGGTGTTGCCGAAAACGTGAAAGAAGCGGCGAAATGGTATCAGCTTGCCGCCGATCAGGGCTTTGCGCCTGCGCAATATCGCATCGGCAGTTTCAATGAAAAGGGCCTCGGCATGGCCCGCAATCTGGAAAAGGCCAAAAGCTGGTATCAGCTTGCCGCAGATCAGGGCAATGCAAGCGCCATGCACAATCTTGCCGTGCTTTTTGCCACAGGTACAAACGGCACGCCGGATAATGCTGCCGCTGT.

[0034] Preferably, the detection target sequence of the Brucella suis amplification primer pair and probe P3 is: TCCAAGGCCCGGTTGCAGCAGGAACCAGCCAGCCGCAATGGTCAATATGCCAAATATCCATGCGGGAAGGA AGATTGGGTTCGCAAACCATGCCGCGCCGCCATAAAGCGCAAAGATCACAAAAGCGCAAAGATCACACCGT AGAGAATGCCCACTGCATAGTGGCCGATCCAGCCCAGCGCCACTTCATGACGACAGGG.

[0035] Preferably, the detection target sequence of the canine Brucella amplification primer pair and the probe P4 is: GATGAATTTCCGCAGGGCCGTAATGTTCACGGTGGCGGCCATCGGCCTTGCCGCCTCCCCGCTTTTCACTGCGCCGGCACAGGCAGGCGAGGCTCGCAAATCCAGAGAGGTCTATCTGGCCAAATATCGCGTGAACGGTGATGTCCGCTATTCCAAGCAGCCGAGAGGCAAACTGATGCGAGTTTCGGTCTCACAATATAGGACCAGCAATTCCTATGTCTGTACGCCAAGCGGCTTCGGCCAGAAATCG.

[0036] Another object of the present application is to provide a detection method for detecting Brucella by using the above-mentioned Brucella typing detection kit, comprising the following steps:

[0037] Step S1, using the DNA sample extracted from whole blood as the DNA sample to be tested, using positive control and blank control, and using the Brucella typing detection kit to perform PCR detection;

[0038] S2, data processing: after the reaction is completed, the results are determined by the melting curve of the sample.

[0039] Preferably, the amplification system of the fluorescent quantitative PCR in the PCR detection in step S1 is as follows: 15 μL of reaction solution, 4 μL of detection solution, 1 μL of enzyme mixture, and 5 μL of DNA sample to be tested.

[0040] Preferably, the DNA sample to be tested is any one of the quantitative standard, the typing standard, the blank control, and the sample DNA.

[0041] Preferably, the reaction conditions of the fluorescent quantitative PCR in the PCR detection in step S1 are as follows: 95°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 60°C annealing and extension for 30 s, and 72°C extension for 30 s, for a total of 50 cycles; then melting curve scanning is performed, 95°C for 1 min, 45°C for 3 min, scanning from 45°C to 85°C at an interval of 1°C, and the fluorescence channel is selected as the detection channel corresponding to the ROX PLUS dye.

[0042] Preferably, in the PCR detection in step S1, a segmented temperature strategy is used in the PCR reaction process, the annealing temperature is appropriately increased to 62°C in the early stage of 1-20 cycles to promote specific binding, and the annealing temperature is reduced to 58°C in the later stage of 21-50 cycles to improve the amplification efficiency and further enhance the detection signal strength.

[0043] The present application relates to a Brucella quantitative and typing detection kit, the principle of quantitative detection is based on fluorescence quantitative PCR technology. Fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR) is a high sensitivity molecular biology technology which can monitor the fluorescence signal change in the PCR amplification process, and thus can quantitatively analyze the target nucleic acid. Its core principle is to combine the fluorescence marker with the amplification product, and through detecting the dynamic change of fluorescence intensity with the number of amplification cycles, combined with the standard curve or relative quantitative method, the concentration of the initial template can be accurately calculated. The key of the technology is to realize the combination of "real-time monitoring" and "quantitative analysis": after each cycle of PCR reaction, the fluorescence signal in the reaction system is collected by the fluorescence detection system, and its intensity is proportional to the accumulation of the amplification product. According to the generation mode of fluorescence signal, qPCR is mainly divided into two types: non-specific fluorescent dye method (such as SYBR Green I) and specific probe method (such as TaqMan probe, molecular beacon). SYBR Green I emits fluorescence by embedding into the small groove of double-stranded DNA, and its advantage is low cost and simple operation, but it may be interfered by non-specific amplification products (such as primer dimers); the probe method depends on the nucleic acid probe labeled with fluorescence group and quencher group, and after the probe is specifically combined with the target sequence, the fluorescence group and the quencher group are separated by hydrolysis or conformation change, and the fluorescence signal is released, so as to ensure the specificity of detection. The basis of quantitative analysis is Ct value (threshold cycle number), that is, the amplification cycle number required for the fluorescence signal to reach the preset threshold, and the more the initial template amount, the smaller the Ct value. Through the gradient dilution of the standard sample with known concentration, the logarithmic linear relationship (standard curve) between Ct value and template concentration can be established, so as to calculate the absolute copy number of unknown sample; relative quantification is to correct the difference between samples by internal reference gene (such as housekeeping gene), and to calculate the expression fold change of target gene.

[0044] The principle of the kit for typing detection is based on the probe melting curve technology. The probe melting curve analysis is a high-sensitivity molecular detection technology based on the specific binding of a fluorescent probe to a target DNA sequence. The core principle is to monitor the change of fluorescence signal during the dissociation of the probe and the target sequence, and to realize the verification of the PCR product, the mutation detection or the single nucleotide polymorphism (SNP) typing by combining with the melting temperature (Tm value) analysis. The technology relies on a double-labeled fluorescent probe (such as TaqMan probe or molecular beacon), which is labeled with a fluorescent group (such as ROX-Plus) at the 5' end and a quencher group (such as TAMRA) at the 3' end. In the free state, the probe is close to the quencher group due to the stem-loop structure or spatial folding of itself, and the fluorescence is quenched; when the probe is specifically combined with the single-stranded target DNA, the conformation of the probe is unfolded, the fluorescent group and the quencher group are separated, and the fluorescence signal is released. After the PCR amplification is completed, the system is slowly heated (such as from 60℃ to 95℃), and the change of fluorescence intensity is monitored in real time: at low temperature, the probe is stably combined with the target sequence, and the fluorescence signal is high; as the temperature approaches the melting temperature (Tm value) of the probe-target sequence complex, the double-stranded gradually dissociates, the probe is separated from the target sequence, and the fluorescence signal sharply decreases; at high temperature, the probe is completely free, and the fluorescence signal returns to the baseline. By plotting the curve of fluorescence intensity versus temperature (melting curve), and calculating the negative derivative (-dF / dT), the characteristic melting peak can be obtained, and the temperature at the peak top is the Tm value. The Tm value is determined by factors such as the complementarity of the probe and the target sequence, the GC content, the probe length and the salt ion concentration: the Tm value of the perfectly matched probe is higher, and a single base mismatch can significantly reduce the Tm value. Therefore, by analyzing the number of melting peaks and the Tm value difference, the product specificity (single peak for specific amplification, multiple peaks indicating the presence of non-specific products or mutations), the detection of point mutations (such as wild type and mutant Tm value difference) or the SNP typing (different alleles of the probe design can produce different Tm values) can be judged.

[0045] Due to the use of the above technical scheme, the present application has the following beneficial effects:

[0046] (1) The Brucella typing detection kit and the detection method disclosed by the present application complete the quantitative detection and typing detection in a single tube reagent. The Brucella in the sample is quantitatively detected by the Taqman probe method. After the PCR amplification is completed, the product is analyzed by the probe melting curve method, so that accurate quantification can be realized, and the sample can be accurately typed and detected without cross reaction.

[0047] (2) The Brucella typing detection kit disclosed by the application is a single-tube single-channel 5-reaction PCR detection reagent. The single-channel fluorescent PCR reagent completes multi-index detection through the innovation of the detection method, reduces the comprehensive cost, and provides an efficient and reliable molecular detection solution for remote areas. The multi-channel interpretation is not required, the result is accurate, and the application is convenient.

[0048] (3) The Brucella typing detection kit and the detection method thereof disclosed by the application, the reaction solution comprises: 5x PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1ug / ul SSB, 0.1-1mM MnCl2. Trehalose can protect the structure and activity of enzymes and nucleic acids under extreme conditions such as high temperature, maintain the structure of biological macromolecules by forming hydrogen bonds with enzyme and nucleic acid molecules, prevent Taq DNA polymerase from denaturation and inactivation, stabilize the structure of nucleic acid molecules, ensure the smooth progress of PCR reaction, and improve the detection stability; BSA can block the sites that may non-specifically adsorb nucleic acids or antibodies in the reaction system, the surfactant can reduce the non-specific interaction between molecules, and the two can synergistically reduce the background signal, make the detection signal more prominent, and improve the detection accuracy; SSB can tightly bind to single-stranded DNA, prevent single-stranded DNA from reannealing to form double-stranded DNA, and avoid degradation by nucleases, thereby improving the accessibility of template DNA in PCR reaction, accelerating the binding of primers to the template, significantly improving the amplification efficiency, and shortening the reaction time; MnCl2 can change the activity and specificity of Taq DNA polymerase, and in some cases can enhance the amplification ability of the enzyme to difficult templates (such as GC-rich sequences), which helps to detect complex sequence regions in Brucella and improves the comprehensiveness of detection. Through reasonable selection of the composition formula of the reaction solution, the components cooperate with each other, and the kit can maintain stable performance in complex samples containing high concentrations of proteins, polysaccharides and other interfering substances, effectively improving the detection accuracy.

[0049] (4) The Brucella typing detection kit and the detection method thereof disclosed by the application, the 5' end of the P0 / P1 / P2 / P3 / P4 probe is labeled with a reporter fluorescent dye ROX-Plus to improve the fluorescent labeling efficiency, and the segmented temperature strategy and the elimination effect of ExoIII exonuclease on non-specific products are combined to effectively reduce the background signal and improve the detection signal intensity; through the optimized reaction system and detection process, combined with high-sensitivity fluorescent labeling, the detection sensitivity can be effectively improved.

[0050] (5) The Brucella typing detection kit and the detection method thereof, the degradation of ExoIII exonuclease to non-specific products, and the promotion of the segmented variable temperature strategy to the specific binding of primers, effectively avoid the cross-reaction between primers, and the specificity reaches 100% in the detection of mixed samples of various microorganisms. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1 Melting curve effect diagram for Brucella melitensis typing detection;

[0052] Figure 2 Melting curve effect diagram for Brucella abortus typing detection;

[0053] Figure 3 Melting curve effect diagram for Brucella canis typing detection;

[0054] Figure 4 Melting curve effect diagram for Brucella suis typing detection;

[0055] Figure 5 Brucella quantitative standard detection result diagram;

[0056] Figure 6 Brucella quantitative standard curve, fitting formula and correlation coefficient. DETAILED DESCRIPTION

[0057] The following description is used to disclose the present application so that those skilled in the art can implement the present application. The preferred embodiments in the following description are only as examples, and other obvious modifications can be thought of by those skilled in the art.

[0058] Example 1: A Brucella typing detection kit

[0059] A Brucella typing detection kit comprises the following components: reaction solution, detection solution, enzyme mixture, quantitative standard, typing standard, blank control; the reaction solution comprises: 5x PCR buffer, 50mM MgCl2, 0.5MmdNTP, 0.2% (v / v) surfactant, 1mol / L enhancer, 3% (w / v) trehalose, 0.5% (w / v) BSA, 0.5μg / μL SSB, 0.3mM MnCl2; the surfactant is Tween-20; the enhancer is betaine.

[0060] Table 1 primer and probe sequence

[0061]

[0062] The quantitative standard is: a Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml, as a quantitative standard; the typing standard is: four Brucella amplification product fragments connected to four pUC57 plasmid vectors, respectively, diluted to 10 6 copies / ml, as a typing standard; the blank control is sterile purified water; the enzyme mixture includes: 5U / μl hot start Taq enzyme, 5U / μl DNA UDG enzyme, 0.1U / μl ExoIII exonuclease.

[0063] The detection solution contains: Brucella quantitative primers F0, R0 and probe P0, with concentrations of 400nM, 400nM and 80nM, respectively; bovine Brucella amplification primers F1, R1 and probe P1, with concentrations of 100nM, 500nM and 500nM, respectively; sheep Brucella amplification primers F2, R2 and probe P2, with concentrations of 120nM, 500nM and 500nM, respectively; pig Brucella amplification primers F3, R3 and probe P3, with concentrations of 120nM, 650nM and 650nM, respectively; canine Brucella amplification primers F4, R4 and probe P4, with concentrations of 100nM, 500nM and 500nM, respectively. The 5' end of the P0 / P1 / P2 / P3 / P4 probe is labeled with the reporter fluorescent dye ROX-Plus, and the 3' end of the P0 / P1 / P2 / P3 / P4 probe is labeled with the quenching group BHQ1 / BHQ1 / BHQ1 / MGB / BHQ1, respectively. The primer probe sequences are shown in Table 1.

[0064] Example 2: A Brucella typing detection method

[0065] A detection method for typing detection of Brucella using the Brucella typing detection kit prepared in Example 1, comprising the following experimental steps:

[0066] (1) Main reagents and instruments: the kit reagents in Example 1; the fluorescent quantitative PCR instrument is a Shanghai Hongshi SLAN-96 type fluorescent quantitative PCR instrument.

[0067] (2) Sample requirements: the DNA solution obtained after extraction of whole blood positive for Brucella.

[0068] (3) PCR amplification and result interpretation:

[0069] A. Design of primers and probes: The primers and probes for quantitative detection were designed according to the Brucella BCSP31 gene; the primers for typing detection were designed according to the specific sequences of B. abortus, B. melitensis, B. suis and B. canis. The primer and probe sequences are shown in Table 1.

[0070] B. The quantitative standard was: the Brucella BCSP31 gene fragment was connected to a pUC57 plasmid vector, and diluted to 10 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml as the quantitative standard.

[0071] C. The typing standard was: the four Brucella amplification product fragments were respectively connected to four pUC57 plasmid vectors, and diluted to 10 6 copies / ml as the typing standard.

[0072] C. Blank control: the blank control was sterile purified water without any DNA fragment.

[0073] D. Detection on machine: 15 μl of reaction solution, 4 μl of detection solution, 1 μl of enzyme mixture, and 5 μl of nucleic acid sample were added to a total volume of 25 μl of fluorescent PCR amplification system. The reaction conditions for PCR amplification were: 95°C pre-denaturation for 3 min; 98°C denaturation for 10 s, annealing and extension for 30 s using a stepwise temperature strategy, 72°C extension for 30 s, a total of 50 cycles; then melt curve scanning was performed, 95°C for 1 min, 45°C for 3 min, scanning from 45°C to 85°C at an interval of 1°C, and the fluorescence channel was selected as the detection channel corresponding to the ROX PLUS dye; using a stepwise temperature strategy, the annealing temperature was 62°C in the early stage of 1-20 cycles, and the annealing temperature was 58°C in the later stage of 21-50 cycles.

[0074] E. Effectiveness judgment: the positive control and blank control must meet the standards in Table 2, otherwise the experimental results are invalid.

[0075] Table 2 Effectiveness judgment standard

[0076]

[0077] F. Brucella quantitative result interpretation: the concentration logarithm of the four standard samples was taken as the abscissa, and the Ct value of the corresponding standard sample was taken as the ordinate to make a labeled curve, obtain the fitting formula and the correlation coefficient. The Ct value of the unknown sample was substituted into the formula to calculate the DNA content of Brucella in the sample.

[0078] G. Interpretation of Brucella typing results: The specific type of the sample is interpreted by the melting peak temperature of the melting curve.

[0079] Table 3 Typing interpretation criteria

[0080] Melting peak typing decision 65.5 ± 1 degree single peak Ovine Brucella 68 ± 1 degree single peak Bovine Brucella 71 ± 1 degree single peak Canine Brucella 63 ± 1 degree, 68 ± 1 degree double peak Porcine Brucella No melting peak Sample concentration too low to type

[0081] (4) Experimental results:

[0082] A. The target sequences of the four detection targets of porcine Brucella, bovine Brucella, ovine Brucella and canine Brucella were synthesized into plasmids, and the positive plasmid sample was diluted to 10 7 , 10 6 , 10 5 , 10 4 , 10 3 copies / ml, and the plasmid sample was detected. It can be seen from the final melting peak type that the peak type of the four Brucella is good Figures 1-4 ), and samples as low as 10 3 copies / ml can be detected.

[0083] B. Specificity experiment: Select samples of 4 Brucella, 13 bacteria or virus DNA and 5 species DNA (pig, cow, sheep, dog and human), and the concentration of sample DNA is 1x10 6 copies / mL. The detection results are shown in Table 4. The target bacteria show good PCR amplification signal, which is a positive result; the four target bacteria can be judged by the melting peak. The Ct value of non-target bacteria is greater than 38, which is a negative result. This experiment shows that the four detection targets of the project have good analysis specificity and good exclusivity to other non-target bacteria. The specificity of the primer and the probe avoids the false positive results that may occur in the experiment, ensuring the accuracy and high specificity of the experiment.

[0084] Table 4 Specificity test

[0085]

[0086] C. Sensitivity test results: The four Brucella (porcine Brucella, bovine Brucella, ovine Brucella, canine Brucella) strains with known concentration were diluted with negative serum samples to 1000, 500, 250 CFU / ml, and each concentration sample was detected 20 times. The results show that the minimum detection limit of the established Brucella typing detection system is 1000 CFU copies / ml.

[0087] D. Quantitative standard curve: The concentrations are 10 7 , 106 5 4 The standard curve was made by taking the logarithm of the four standard concentrations as the abscissa and the Ct value of the corresponding standard as the ordinate. Figure 5 The amplification curve of the standard was an S-shaped amplification curve as indicated. The standard curve was made by taking the logarithm of the four standard concentrations as the abscissa and the Ct value of the corresponding standard as the ordinate, as shown in Figure 6 The correlation coefficient R 2 was 0.9999, and the linear relationship of the standard curve was good.

[0088] Table 5 Sensitivity test

[0089]

[0090] In summary, the detection results in the present embodiment show that the method of the present application has good sensitivity, high specificity, good repeatability, and accurate and reliable typing results.

[0091] Comparative example

[0092] The present example is basically the same as example 1, except that the reaction solution comprises 5x PCR buffer, 50 mM MgCl2, and 0.5 mM dNTP.

[0093] Experimental verification

[0094] Experimental materials

[0095] Select 200 known Brucella samples (60 bovine species, 70 ovine species, 50 porcine species, and 20 canine species), 100 negative samples (healthy animal whole blood samples) containing no Brucella, and 50 complex samples (add high-concentration protein, polysaccharide, and other interfering substances to the healthy animal whole blood samples). The Brucella typing detection kit of example 1 of the present application, and the Brucella typing detection kit of the comparative example (as a control).

[0096] Experimental method

[0097] According to the detection method described in example 2 of the present application, the above-mentioned samples were detected using the kit of the present application and the control kit, respectively. Each sample was detected repeatedly for 3 times, and the detection results were recorded. The fluorescence signal intensity was recorded using a fluorescence quantitative PCR instrument equipped with a ROX-Plus detection channel, and after each detection was completed, the instrument was calibrated and blank control detection was performed to ensure data accuracy.

[0098] Experimental results

[0099] ​​The kit can correctly type 200 samples of known Brucella species, the accuracy rate is 100%; 100 negative samples are all detected as negative, the specificity is 100%; in the detection of 50 complex samples, 50 samples are correctly detected, the accuracy rate of complex sample detection is 100%. The detection sensitivity reaches 10 3 copies / ml, the average fluorescence signal intensity is 8200±400 (relative unit). The control kit can correctly type 180 samples of 200 known Brucella species, the accuracy rate is 90%; 10 of 100 negative samples are detected as positive, the specificity is 90%; in the detection of complex samples, 35 samples are correctly detected, the accuracy rate of complex sample detection is 70%, the detection sensitivity is 10 3 copies / ml, the average fluorescence signal intensity is 4000±300 (relative unit).

[0100] From the above results, it can be seen that the combined surfactant, enhancer, trehalose, BSA, SSB and MnCl2 in the reaction solution can cooperate with other components to improve the signal intensity, complex sample tolerance, detection sensitivity and specificity.

[0101] The above examples are only for illustrating the technical concept and characteristics of the present application, the purpose is to enable the person skilled in the art to understand the content of the present application and to implement it, and cannot limit the protection scope of the present application, any equivalent changes or modifications made according to the spirit and essence of the present application should be covered within the protection scope of the present application.

Claims

1. A Brucella typing test kit, characterized by, The kit comprises the following components: reaction solution, detection solution, enzyme mixture, quantitative standard, typing standard, and blank control; the reaction solution comprises 5×PCR buffer, 50mM MgCl2, 0.5Mm dNTP, 0.1-0.3% (v / v) surfactant, 0.5-2mol / L enhancer, 1-5% (w / v) trehalose, 0.1-1% (w / v) BSA, 0.1-1μg / μL SSB, and 0.1-1mM MnCl2; the surfactant is Tween-20; and the enhancer is betaine; the detection solution comprises Brucella quantitative primer pair and probe P0, B. abortus amplification primer pair and probe P1, B. melitensis amplification primer pair and probe P2, B. suis amplification primer pair and probe P3, and B. canis amplification primer pair and probe P4; the Brucella quantitative primer pair comprises upstream primer F0 and downstream primer R0; the B. abortus amplification primer pair comprises upstream primer F1 and downstream primer R1; the B. melitensis amplification primer pair comprises upstream primer F2 and downstream primer R2; the B. suis amplification primer pair comprises upstream primer F3 and downstream primer R3; and the B. canis amplification primer pair comprises upstream primer F4 and downstream primer R4; the sequence of F0 is GATATTGGCAACCGAGCCAT, and the concentration is 400nM; the sequence of R0 is TATTATCCGATTGGTGGTCT, and the concentration is 400nM; the sequence of P0 is 5'-fluorescent reporter group-GAAATCGCGTTCGCGAT-fluorescent quencher group-3', the 5' end-labeled fluorescent reporter group is ROX PLUS, the 3' end-labeled fluorescent quencher group is BHQ1, and the concentration is 80nM; the sequence of F1 is CACACTCACCTTCCACAACA, and the concentration is 100nM; the sequence of R1 is CCCGTTCTGCACCAGAC, and the concentration is 500nM; the sequence of P1 is 5'-fluorescent reporter group-ACAAGGGTGGAACGACCTTTGCAGGC-fluorescent quencher group-3', the 5' end-labeled fluorescent reporter group is ROX PLUS, the 3' end-labeled fluorescent quencher group is BHQ1, and the concentration is 500nM; the sequence of F2 is TCGYATCGGCAGTTTCAA, and the concentration is 120nM; the sequence of R2 is CAGCTTTTGGCCTTTTCC, and the concentration is 500nM; the sequence of P2 is 5'-fluorescent reporter group-CATGGCCCGCAATCTGGAAAAGG-fluorescent quencher group-3', the 5' end-labeled fluorescent reporter group is ROX PLUS, the 3' end-labeled fluorescent quencher group is BHQ1, and the concentration is 500nM; The sequence of F3 is CAAATATCCATGCGGGAAG, the concentration is 120 nM; the sequence of R3 is TGGGCATTCTCTACGGTG, the concentration is 650 nM; the sequence of P3 is 5'-fluorescent reporter group-CCATAAAGCGCAAAGATCACACCGTAGAGA-fluorescent quenching group-3', the fluorescent reporter group labeled at 5' end is ROX PLUS, the fluorescent quenching group labeled at 3' end is MGB, the concentration is 650 nM; The sequence of F4 is GCACAGGCAGGCGA, the concentration is 100 nM; the sequence of R4 is GACATCACCGTTCACGC, the concentration is 500 nM; the sequence of P4 is 5'-fluorescent reporter group-TCTATCTGGCCAAATATCGCGTGAACGGTGAT-fluorescent quenching group-3', the fluorescent reporter group labeled at 5' end is ROX PLUS, the fluorescent quenching group labeled at 3' end is BHQ1, the concentration is 500 nM; The target sequence for quantitative detection of Brucella is GATATTGGCAACCGAGCCATTCGACGAAACGGCCGTCGCGACGAGACCCGGCACGCCCTTTTCGCCTGCGCCGGAAATCGCGTTCGCGATCAGACCACCAATCGGATAATA; The target sequence for detection of Brucella abortus is TTGCGAGCGGCAGCACGCTGCAGCTTGGCGATGGCAGCACGGATGGCAGGCTTGCGGGCAATGTGGCCAATGCGGGCACACTCACCTTCCACAACAAGGGTGGAACGACCTTTGCAGGCGAGATCTCCGGCACTGGCAGTCTGGTGCAGAACGGGGCGGGTGCACTGACGCTGAGCGGTGACAGCCAAGGTTTTGCCGGT; The target sequence for detection of Brucella melitensis is GGCGCGGTGTTGCCGAAAACGTGAAAGAAGCGGCGAAATGGTATCAGCTTGCCGCCGATCAGGGCTTTGCGCCTGCGCAATATCGCATCGGCAGTTTCAATGAAAAGGGCCTCGGCATGGCCCGCAATCTGGAAAAGGCCAAAAGCTGGTATCAGCTTGCCGCAGATCAGGGCAATGCAAGCGCCATGCACAATCTTGCCGTGCTTTTTGCCACAGGTACAAACGGCACGCCGGATAATGCTGCCGCTGT; The target sequence for detecting Brucella suis is: TCCAAGGCCCGGTTGCAGCAGGAACCAGCCAGCCGCAATGGTCAATATGCCAAATATCCATGCGGGAAGGAAGATTGGGTTCGCAAACCATGCCGCGCCGCCATAAAGCGCAAAGATCACAAAAGCGCAAAGATCACACCGTAGAGAATGCCCACTGCATAGTGGCCGATCCAGCCCAGCGCCACTTCATGACGACAGGG; The target sequence for detecting Brucella canis is: GATGAATTTCCGCAGGGCCGTAATGTTCACGGTGGCGGCCATCGGCCTTGCCGCCTCCCCGCTTTTCACTGCGCCGGCACAGGCAGGCGAGGCTCGCAAATCCAGAGAGGTCTATCTGGCCAAATATCGCGTGAACGGTGATGTCCGCTATTCCAAGCAGCCGAGAGGCAAACTGATGCGAGTTTCGGTCTCACAATATAGGACCAGCAATTCCTATGTCTGTACGCCAAGCGGCTTCGGCCAGAAATCG.

2. The Brucella typing test kit according to claim 1, characterized by, The quantitative standard is: Brucella BCSP31 gene fragment connected to a pUC57 plasmid vector, diluted to 10 7 copies / ml, 10 6 copies / ml, 10 5 copies / ml, 10 4 copies / ml as a quantitative standard.

3. The Brucella typing test kit according to claim 1, characterized by, The typing standard is: 4 Brucella amplification product fragments are respectively connected to 4 pUC57 plasmid vectors, and respectively diluted to 10 6 copies / ml as a typing standard; the blank control is sterile purified water.

4. The Brucella typing test kit according to claim 1, characterized by, The enzyme mixture includes: 5U / μl hot start Taq enzyme, 5U / μl DNA UDG enzyme, 0.1U / μl ExoIII exonuclease.

Images