Preparation method and application of bimetallic nano-enzyme aptamer hydrogel
By constructing a bimetallic nanoenzyme aptamer hydrogel, the problems of aptamer affinity and metal nanoenzyme catalytic activity regulation are solved, and high sensitivity and selective detection of sulfonamide pollutants are achieved, which is suitable for rapid detection in the environment and food.
Patent Information
- Application Number
- CN202510615348.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-22
AI Technical Summary
The prior art is difficult to effectively regulate the affinity of aptamers and the catalytic activity of metal nanoenzymes in complex environments, and lacks detection methods with high sensitivity and selectivity.
A bimetallic nanoenzyme aptamer hydrogel was constructed, and the precise regulation of aptamer and the catalytic activity of metal nanoenzymes were encapsulated by encapsulating Mn-Zr bimetallic MOF or Pt-Ru bimetallic MOF in a functionalized gel matrix of molecular clamps, combining gap-2A, gap-2B, SA, SB and acrylamide hydrogels were achieved to achieve precise regulation of aptamer and enhance the catalytic activity of metal nanoenzymes.
High specificity detection of sulfonamide pollutants is achieved, with a detection limit of less than 0.24μM, high sensitivity and good selectivity. It is suitable for rapid detection in the environment and food. The detection range covers 5-50μmol/L, and the relative standard deviation is less than 10%.
Smart Images

Figure CN120519463A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of aptamer hydrogels and relates to a preparation method and application of a bimetallic nanozyme aptamer hydrogel. Background Art
[0002] Aptamers are a type of single-stranded DNA or RNA molecule that is screened from a random sequence library using in vitro screening technology (SELEX, Systematic Evolution of Ligands by Exponential Enrichment). Aptamers have high specificity and affinity, allowing them to bind to specific molecules through a highly specific three-dimensional conformation, with an affinity that can be as high as nanomolar (nM) or picomolar (pM) levels. The aptamer dissociation constant (K d ) is an important indicator for judging its binding affinity with the target molecule. The smaller the dissociation constant of the aptamer, the stronger the binding affinity between the aptamer and the target molecule. Nucleic Acid Force Clamp, which can be referred to as molecular clamp, is a nanotechnology tool designed based on the structure of nucleic acid molecules. Its core function is to analyze the dynamic behavior and action mechanism of biological molecules under microscopic force fields through mechanical manipulation and measurement at the single-molecule level. The basic structure of the nucleic acid molecular force clamp usually includes two rigid double-stranded nucleic acid molecules and one flexible single-stranded nucleic acid molecule. The two rigid double-stranded nucleic acid molecules are connected together by a flexible single-stranded nucleic acid molecule to form a pliers-like structure. By controlling the distance between the two rigid double-stranded nucleic acid molecules, tiny forces can be applied and measured on the flexible single-stranded nucleic acid molecule. The basic principle of the action of the nucleic acid molecular force clamp is to exert a force on the flexible single-stranded nucleic acid molecule by changing the distance between the rigid double-stranded nucleic acid molecules.
[0003] Aptamer hydrogel is a new functional material that combines nucleic acid aptamers with hydrogel materials. Hydrogel is a three-dimensional network structure formed by physical or chemical crosslinking of hydrophilic polymers. It has high water content, good biocompatibility and controllable mechanical properties. The core principle of aptamer hydrogel is to utilize the specific binding ability of aptamers and the three-dimensional network structure of hydrogels to achieve high-sensitivity detection, controlled release and functional regulation of target molecules. By introducing aptamers into the hydrogel network, specific recognition and capture of target molecules can be achieved, thereby achieving high-sensitivity detection of target molecules. In addition, by regulating the crosslinking density, pore structure and mechanical properties of the hydrogel, controlled release and functional regulation of target molecules can be achieved. Summary of the Invention
[0004] The present invention solves the key scientific problems of aptamer affinity regulation and the peroxidase-like properties of metal nanozymes. Combined with the functional design of hydrogel carriers, it systematically carries out the precise regulation of aptamer affinity, the study of metal nanozyme catalytic activity, and the construction and application of molecular tweezers-mediated aptamer hydrogels, aiming to improve the application performance of aptamers in complex environments and provide more methods for on-site naked eye rapid detection.
[0005] On the one hand, the present invention relates to a bimetallic nanozyme aptamer hydrogel, wherein the bimetallic nanozyme aptamer hydrogel is a bimetallic nanozyme encapsulated in a molecular tweezers functionalized gel matrix;
[0006] The molecular clamp functionalized gel matrix is composed of gap-2A, gap-2B, SA, SB and acrylamide hydrogel;
[0007] The sequence of gap-2A is shown in SEQ ID NO: 1;
[0008] The sequence of gap-2B is shown in SEQ ID NO: 2;
[0009] The 5′ end of the SA is modified with an acrylate group, and the sequence is shown in SEQ ID NO: 3;
[0010] The 5′ end of the SB is modified with an acrylate group, and the sequence is shown in SEQ ID NO: 4;
[0011] The bimetallic nanozyme is a Mn-Zr bimetallic MOF or a Pt-Ru bimetallic MOF.
[0012] SEQ ID NO: 1 specifically: TGATGCGTAAGGGCAAGGAGGGTTCCTAGATGCTGTGA;
[0013] SEQ ID NO: 2 specifically: ACGCATCATTTCACAGCA;
[0014] SEQ ID NO: 3 specifically: Arcydite-TGACATTCCCG;
[0015] SEQ ID NO: 4 is specifically: Arcydite-CTCGATCTAGG.
[0016] Furthermore, in the bimetallic nanozyme aptamer hydrogel provided by the present invention, the molar ratio of gap-2A, gap-2B, SA, and SB is 1:1:1:1 to 2:2:1:1.
[0017] Furthermore, in the bimetallic nanozyme aptamer hydrogel provided by the present invention, the molar ratio of gap-2A, gap-2B, SA, and SB is 1:2:1:1.
[0018] Furthermore, in the bimetallic nanozyme aptamer hydrogel provided by the present invention, every 2 mg of acrylamide monomer corresponds to 0.5 to 2 μL of 3 to 5 mg / mL Pt-Ru bimetallic nanozyme solution. 。
[0019] On the other hand, the present invention relates to a method for preparing a bimetallic nanozyme aptamer hydrogel, which comprises: dissolving gap-2A, gap-2B, SA, and SB in a solvent, first heating at 90 to 100° C. for 3 to 7 minutes to eliminate the secondary structure, and then cooling to 20 to 30° C. by linear cooling to ensure that the nucleic acid chains form a stable complex through base complementary pairing;
[0020] The complex and acrylamide monomer are placed in a redox initiation system, and the bimetallic nanozyme is added to initiate polymerization and cross-linking of the acrylamide monomer through a free radical reaction. The polymerization of free radicals causes the bimetallic nanozyme to be coated in the entire gel cross-linking system;
[0021] Multiple washings with solvent are performed to remove unreacted impurities.
[0022] Furthermore, in the preparation method of the bimetallic nanozyme aptamer hydrogel provided by the present invention, the linear cooling rate is not higher than 0.1°C / s.
[0023] Furthermore, in the preparation method of the bimetallic nanozyme aptamer hydrogel provided by the present invention, the redox initiation system includes ammonium persulfate and tetramethylethylenediamine.
[0024] Furthermore, in the preparation method of the bimetallic nanozyme aptamer hydrogel provided by the present invention, the Mn-Zr bimetallic MOF is prepared by dissolving ZrCl4, MnCl2·4H2O, NH2-BDC and PVP in a solvent, ultrasonically treating the solution, reacting the solution at 110-130°C for 8-10 hours, and then washing and vacuum drying.
[0025] Furthermore, in the preparation method of the bimetallic nanozyme aptamer hydrogel provided by the present invention, the Pt-Ru bimetallic MOF is prepared by preheating K2PtCl4, RuCl3, glycine, PVP and water at 55-65°C for at least 5 minutes, adding L-ascorbic acid and keeping warm at 55-65°C for sufficient reaction, and then washing and vacuum drying.
[0026] On the other hand, the present invention relates to the use of the bimetallic nanozyme aptamer hydrogel in detecting sulfonamide pollutants.
[0027] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:
[0028] (1) This application successfully constructed a Link-SAM cross-linked hydrogel based on stress aptamer molecules (SAMs) and systematically analyzed its structural characteristics and functional mechanisms. Native-PAGE and circular dichroism (CD) characterization confirmed that Link-SAM had significantly improved mobility (increased structural complexity) compared with SAM monomers, and the red shift and peak intensity enhancement from 293nm to 295nm in the CD spectrum indicated the reconstruction and stabilization of the nucleic acid secondary structure. Fourier transform infrared spectroscopy (FTIR) analysis showed that the C=O stretching vibration peak at 1650cm-1 and the aromatic base peak at 1450-1600cm-1 appeared synergistically, verifying the covalent cross-linking network of acrylamide monomers and Link-SAM. In synthetic optimization studies, the SA / SB ratio significantly modulated the gel topology: At SA / SB = 1:1, symmetrical complementary pairing formed uniform crosslinking sites, resulting in regular polygonal pores (equivalent diameter 12.43 μm) with moderate crosslink spacing (10.32 μm). The asymmetric SA / SB = 1:2 group maintained a polygonal pore structure despite increased local crosslink density. The SA / SB = 2:1 group exhibited a "high porosity-low density" characteristic through spatial reorganization of crosslinking sites. Bimetallic nanozyme performance studies revealed that the specific activity of Mn-Zr MOF (39.5 U·mg⁻¹) was 5.14 times higher than that of pure Zr MOF, attributed to electron transport channels formed by Mn edge enrichment. Pt-Ru MOF, through a uniform alloying effect, modulated the d-band center, achieving a specific activity of 106.83 U·mg⁻¹, a 1.53-fold increase over Zr MOF.
[0029] (2) This application systematically investigated the effect of sulfadimethoxine (SDM) concentration on the response performance of the smart hydrogel sensing platform, revealing its nonlinear dynamic characteristics. The experiment showed that in the low concentration region (0.01-1 μM), due to the low binding rate of the aptamer (<30%) and the background release of the nanozyme, the signal fluctuated significantly (RSD = 12.4%-18.7%); in the medium and high concentration region (10-70 μM), an excellent linear response (R 2=0.997, sensitivity 0.018 Abs / μM), attributed to the efficient release of nanozymes (>60%) triggered by the cascade collapse of the cross-linked network; catalytic efficiency declined in the high concentration range (>70 μM) due to nanozyme aggregation. Based on this, 10-70 μM was determined to be the optimal detection window, with a limit of detection (LOD) of 0.24 μM and a linear range of 1.5 orders of magnitude that met practical requirements. Specificity experiments showed that the hydrogel's response to SDM (ΔOD = 0.22) was significantly higher than that of sulfamethoxazole (0.027), sulfamethoxazole (0.038), and kanamycin (0.007), with a cross-reactivity rate of less than 12.3%. Its high selectivity is attributed to the synergistic mechanism of steric hindrance and electrostatic screening of the hydrogel. Stability assessment showed that the signal retention rate reached 92.3% after 7 days of storage at 4°C. The two-stage decay mechanism (segment relaxation and aptamer degradation) can partially restore performance through the self-healing properties of the dynamic cross-linked network. Through molecular design and structural optimization, the sensing platform constructed in this application showed good applicability in the detection of simulated water samples. The spiked recovery rate of SDM in a concentration gradient of 5 to 50 μmol / L was 90.74% to 96.48%, and the relative standard deviation was 4.48% to 7.32%, which met the requirements of trace analysis and provided a new method with high specificity and wide detection range for the rapid detection of sulfonamide pollutants in the environment and food. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0031] Figure 1 The construction and detection mechanism of magnetic bead sensors based on stress aptamer molecules.
[0032] Figure 2 Schematic diagram of the construction principle of stress aptamer molecules (SAMs), where a is the construction of stress aptamer molecules SAMs: chain A contains the M5 aptamer (yellow part) in the middle, and the random sequences on both sides (blue and green parts) are complementary to chain B; b is time-lapse gel electrophoresis: determining the critical molecular clamp length Nc; c is introducing a flexible single chain and changing the width of the molecular clamp gap: keeping chain A unchanged, adding a non-complementary base T in the middle region of chain B to increase the width of the SAMs gap; keeping chain B unchanged, shortening the bases on both sides of chain A, and extending the flexible single chain.
[0033] Figure 3 Stress aptamer molecule SAM 16-18 (Gap=2) and circular dichroism spectra of M5 and SDM.
[0034] Figure 4 The sensitivity and selectivity of the sensors SAM-MC and M5-MC are shown in Figure 1. (a) shows the standard curve for the dissolution of sulfadimethoxine (SAM); (b) shows the sensitivity of the stress aptamer-based magnetic bead sensor; and (c) shows the selectivity of the stress aptamer-based magnetic bead sensor.
[0035] Figure 5 Verify the construction of Link-SAM modules by polyacrylamide gel.
[0036] Figure 6 The secondary structure analysis was performed by circular dichroism spectroscopy. a is the UV absorption of SA+SB, SAM, and Link-SAM; b is the circular dichroism absorption of SA+SB, SAM, and Link-SAM.
[0037] Figure 7 Figures a through d are scanning electron microscopy images of hydrogels cross-linked with different ratios of stress aptamer molecules (without SDM), corresponding to groups a through d, respectively; and e through f are the corresponding gel fiber chain diameter distributions.
[0038] Figure 8 Construction of a molecular tweezers-mediated aptamer gel sensing platform.
[0039] Figure 9 is the UV absorption at 450 nm for different SDM concentrations.
[0040] Figure 10 It is the UV absorption when the SDM concentration is in the range of 0.1 to 1 μM.
[0041] Figure 11 It is the UV absorption when the SDM concentration is in the range of 10 to 100 μM.
[0042] Figure 12 Figure 2 is the color change of SDM. (a) shows the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) by hydrogen peroxide (H2O2) in the presence of Pt-Ru NCs to form colored products; (b) shows the UV absorption of the supernatant of different targets; and (c) shows the color change after adding different targets to the hydrogel system.
[0043] Figure 13 The stability of Link-SAM cross-linked hydrogel.
[0044] Figure 14 For the detection of simulated environmental water samples, a is the UV absorption at different spiked concentrations; b is the standard curve of the simulated water sample; and c is the color change at different spiked concentrations. DETAILED DESCRIPTION
[0045] The technical solutions of the present invention are described below with reference to the following examples. However, the present invention is not limited to the following examples. The experimental and detection methods described in each example are conventional methods unless otherwise specified. The reagents and materials described are commercially available unless otherwise specified. The percentages in the following examples are percentages by mass unless otherwise specified. The ratios in the following examples are ratios by mass unless otherwise specified.
[0046] Example 1
[0047] This embodiment provides a method for regulating the affinity of nucleic acid aptamers.
[0048] The nucleic acid sequences used in this experiment are shown in Tables 1-3. All were synthesized by Shanghai Bioengineering Co., Ltd. and purified by high-performance liquid chromatography. The synthesized DNA powder was dissolved in deionized water to prepare a 100 μM stock solution and stored at 4°C. As shown in Table 1, two types of nucleic acid sequences were designed for this experiment: chain A and chain B. Chain A consists of the M5 aptamer sequence (in bold) and complementary sequences at both ends. Chain B can completely hybridize with the complementary sequences in chain A to form a circular internal stress molecule. In the first group, the sequences at both ends of chain A were randomly generated with a GC content of 54.3%. Based on the first group, one base was removed from each of the left and right ends to form the second to fourth groups of sequences. The sequences listed in Table 2 are based on the sequences designed in Table 1, with one base removed from each of the left and right ends of chain B, while the corresponding chain A sequences remained unchanged. The sequences listed in Table 3 are based on the sequences designed in Table 1, with a T base added to the middle region of chain B to increase the gap width. The thermodynamic properties of all sequences were analyzed using Primer Premier 5 and DINAMelt software to ensure successful hybridization of double-stranded DNA.
[0049] Table 1 Oligonucleotide chains used to construct stress aptamer molecules
[0050]
[0051] Table 2 Nucleotide sequences for constructing SAMs by introducing flexible single chains
[0052]
[0053] Table 3 Nucleotide sequences of SAMs constructed by changing gap width
[0054]
[0055] The synthesized chains A and B were centrifuged separately at 5000 rpm for 30-60 seconds. Dissolve the mixture in an appropriate amount of enzyme-free deionized water, vortex for a few seconds, and then centrifuge again at 5000 rpm for 30-60 seconds. Chain A was mixed with an equimolar amount of chain B and diluted to a final concentration of 5 μM in hybridization buffer (10 mM Tris, 5 mM MgCl2, 100 mM NaCl, pH 7.9) in a final volume of 100 μL. The mixture was then incubated in a BIORADT100™ Thermal Cycler (95°C for 10 minutes) and then cooled linearly (~0.1°C / min) to room temperature to ensure proper conformation.
[0056] Prepare 10x hybridization buffer. Ingredients: 100mM Tris, 50mM MgCl2, 1M NaCl, pH 7.9. First, add 5mL of 1M MgCl2 to a beaker, followed by 10mL of 5M NaCl, then 5mL of pH 7.9 Tris solution, and finally 30mL of deionized water. Vortex to mix thoroughly. 10% ammonium persulfate solution. Ingredients: 10% (w / v) ammonium persulfate. First, accurately weigh 100mg of ammonium persulfate powder into a 1.5mL centrifuge tube. Then, add 0.9mL of deionized water and vortex until completely dissolved. Finally, make up to 1mL with deionized water and vortex again for 30 seconds. Prepare a 0.16M sulfadimethoxine stock solution. Accurately weigh 0.05g of sulfadimethoxine standard and dissolve thoroughly in 1mL of 1M NH3·H2O to prepare the stock solution.
[0057] The previously prepared sulfadimethoxine stock solution was diluted with hybridization buffer to obtain sulfadimethoxine preparative solutions with concentrations of 1.5 mM, 3 mM, 4.5 mM, 6 mM, 7.5 mM, and 9 mM, respectively, and ultrasonicated at 37°C for 2 h to ensure that no sulfadimethoxine was precipitated.
[0058] In the process of constructing stress aptamer molecules, the intervention of molecular tweezers precisely regulates the conformation of the aptamer, making it present in the unfolded and folded states. When chain A and chain B undergo hybridization reaction, since the polymerization inevitably reduces the entropy of the system, a dynamic conversion balance is always maintained between the monomer and the dimer. And this delicate balance state is still maintained during the subsequent gel electrophoresis analysis. In order to intuitively demonstrate this conversion balance phenomenon, a series of experiments were designed to construct a clamp length N d Stress aptamer molecules (SAMs) of 18 to 24 base pairs (bp) 18-18 、SAM 20-20 、SAM 22-22 、SAM 24-24). Subsequently, 5% polyacrylamide gel electrophoresis (PAGE) was used to perform delayed gel electrophoresis analysis under non-denaturing conditions in order to accurately determine the critical molecular clamp length that enables the effective unfolding of the sulfadimethoxine aptamer. The specific operation is: at a constant voltage of 80V, the samples are sequentially loaded into different lanes of the gel every 10 minutes, ensuring that samples with the same clamp length are electrophoresed for 55 minutes, 45 minutes, 35 minutes, 25 minutes, and 15 minutes respectively. Observe the delayed gel spectrum, and the clamp length of the stress aptamer molecule corresponding to the group of monomer band splitting is the critical clamp length N. c .
[0059] In order to verify the allosteric regulation of DNA molecular clamp on the affinity of SDM aptamer, isothermal titration calorimetry was used to determine the K of stress aptamer molecules SAMs. d Value. The experiment chose to titrate stress aptamer molecules SAMs with activated SDM. 15μM stress aptamer molecule solution and SDM solutions of different concentrations were prepared using 1× hybridization buffer solution. Then 300μl of 15μM stress aptamer molecules were titrated with 50μl of SDM of different concentrations, and 300μl of hybridization buffer was titrated with 50μl of corresponding SDM as background heat subtraction. 300μl of 15μM activated M5 aptamer was titrated with 50μl of SDM of the same concentration as a control. Point-to-point model was used for fitting, with a stirring rate of 250RPM and a temperature setting of 25°C.
[0060] The application of the molecular clamp will cause the Sulfamethoxazole aptamer to change its conformation, and this change will change with the change of the molecular clamp length. In the construction, it is expected that two single chains will extend from both ends of the aptamer. The two single chains will act as flexible single chains to fine-tune the conversion of the aptamer conformation caused by the molecular clamp. The specific operation is: sequentially delete the bases at both ends of chain B, keep the length of chain A unchanged, and construct stress aptamer molecules SAM with flexible single chains of different lengths. 22-20 、SAM 22-18 、SAM 22-16 、SAM 20-18 、SAM 20-16 、SAM 18-16 Isothermal titration calorimetry experiments were performed to compare the changes in binding affinity of stress aptamer molecules (SAMs) with flexible single chains of different lengths.
[0061] When constructing stress aptamer molecules SAMs, a gap will appear in the double-stranded region of the molecular clamp due to the hybridization of chain A and chain B. DNA gaps play a key role in the bending and release of mechanical stress of double-stranded DNA, which means that the change in mechanical stress caused by the change in gap width cannot be ignored. Molecular clamps put the aptamer in an unfolded or folded state by applying mechanical stress to both ends of the aptamer. Therefore, changes in the gap width will affect the conformational equilibrium of the sulfadimethoxine aptamer, thereby causing changes in target binding affinity. Experiments on stress aptamer molecules SAMs 16-16 On the basis of the molecular clamp, the gap width was gradually increased from 0 to 3 nt, and the SAM was constructed. 16-17 、SAM 16-18 、SAM 16-19 Then, the K of each stress aptamer SAMs was determined by isothermal titration calorimetry. d value.
[0062] The stability of the stress aptamer molecule (SAM) constructed based on the molecular tweezers was verified by circular dichroism experiments. The specific operation was as follows: First, 100 μM M5 stock solution was diluted with hybridization buffer solution to prepare 10 μM M5 aptamer solution and stress aptamer molecule SAM. 16-18 Then, 100 μL of 10 μM sulfadimethoxine standard solution was mixed with 100 μL of 10 μM SAM 16-1 The solution was mixed with the M5 aptamer solution to obtain M5-SDM and SAM 16-18 -SDM two groups of mixed samples, and then the two mixed samples were placed at room temperature for 30 minutes. After the incubation, the M5-SDM, SAM 16-18 -SDM two groups of mixed samples were tested, and the scanning wavelength range was set at 200-300nm.
[0063] In order to demonstrate the practical application of the affinity regulation mechanism based on molecular tweezers in biosensing, two magnetic bead sensors were constructed. Figure 1 As shown, the magnetic bead-based sensing system is based on the "competitive displacement-signal release" principle. Binding of SDM to the aptamer M5 disrupts the hybridization stability of the complementary SA strand. Dissociated SA single strands enter the solution phase, and their A260 values are positively correlated with target concentration. A branched hybrid structure is introduced by the gap2-SA complex, allowing a single target binding event to trigger the release of multiple strands. Based on this principle, the stress aptamer-based magnetic bead sensors SAM-MC and M5-MC were constructed.
[0064] (1) Construction of molecular hybridization system
[0065] Through precise sequence design, two functionalized complexes were constructed.
[0066] M5-SA complex: The 5'-end biotin-modified SA complementary chain (10 μM, 5 μL) and the aptamer M5 (10 μM, 5 μL) were mixed in 1× hybridization buffer (10 mM Tris-HCl, 50 mM NaCl, 1 mM EDTA, pH 7.4) to a final volume of 50 μL.
[0067] Gap2-SA complex: SA complementary chain (5 μL) was mixed with Gap-2-A and Gap-2-B (5 μL each, 10 μM) at a molar ratio of 1:1:1 to a final volume of 50 μL.
[0068] (2) Optimization of hybridization conditions
[0069] A gradient annealing program (95°C for 10 min, followed by a linear temperature decrease of 0.1°C / min) was used to promote specific hybridization, and the purity of the complex was verified by native PAGE (band mobility RSD < 5%).
[0070] (3) Magnetic bead immobilization and target capture
[0071] Take 100 μL Dynabeads TM M-270 magnetic beads (10 mg / mL, Thermo Fisher) were washed three times with 1× binding buffer (0.1 M sodium phosphate, 0.15 M NaCl, pH 7.4) and resuspended to a final concentration of 5 mg / mL.
[0072] The M5-SA and gap2-SA complexes were mixed with pretreated magnetic beads at a molar ratio of 1:20 (final volume 200 μL) and incubated with shaking at 25°C for 30 min. Unbound complexes were removed by magnetic separation and washed three times with wash buffer (0.01% Tween-20 in PBS) to obtain immobilized magnetic bead probes.
[0073] SDM standards (0-100 nM) were added to the immobilized magnetic bead system in a gradient manner and incubated at 37°C for 45 min. Specific binding of the target molecule to the aptamer resulted in the dissociation of the complementary chain SA (competitive displacement efficiency >85%).
[0074] (4) Signal detection and quantitative analysis
[0075] The supernatant was collected by magnetic separation (2 min, 10,000×g), and the ultraviolet absorbance (A260) of free SA was measured at 260 nm using NanoDrop OneC (ThermoScientific).
[0076] (5) Quality control
[0077] Negative control: absorbance fluctuation of the buffer system without SDM is <5%;
[0078] Repeatability: Each experiment was performed with three biological replicates (CV < 8%).
[0079] Specificity verification: Cross-testing of structural analogues such as sulfamethoxazole, sulfachlorpromazine, and kanamycin (cross-reaction rate <3%).
[0080] The construction of molecular clamps requires the design of two types of oligonucleotide sequences: chain A and chain B. The bold part in chain A is the sequence of the M5 aptamer, and the two ends are complementary sequences to chain B. Therefore, the hybridization of chain A and chain B will produce a partially double-stranded circular molecule, which is called a "stress aptamer molecule" (SAM). Its structure is as follows Figure 2 As shown in Figure a. In this experiment, the sulfadimethoxine aptamer (M5) was used as the research target. The M5 aptamer is a 22-nt single-stranded nucleic acid with the sequence 5′-AAGGGC AAG GAG GGT TCC TAG A-3′. Its structure contains a double strand and a stem-loop structure, and it has a strong affinity for the target. Figure 2 b is time-lapse gel electrophoresis: determining the critical molecular clamp length Nc; c is introducing a flexible single chain and changing the molecular clamp gap width
[0081] In order to further explore the affinity regulation mechanism based on molecular tweezers, the experiment introduced flexible single chains and changed the gap width on the basis of constructing stress aptamer molecules (SAM) to achieve allosteric regulation of the affinity of the M5 aptamer. Specifically, the sequence length of chain A is kept unchanged, and the bases on both sides of chain B are deleted in sequence. In this way, as chains A and B hybridize, two oligonucleotide single chains will appear between the molecular tweezers and the M5 aptamer. These two oligonucleotide single chains will act as "hinges", thereby allosterically regulating the M5 aptamer. Similarly, the sequence length of chain A is kept unchanged, and the base T is added or subtracted in the middle region of chain B. In this way, the hybridization of chain A and chain B will expand the gap in the double-stranded region of the molecular tweezers, thereby affecting the mechanical stress stored in the double-stranded region. Its structure is as shown below. Figure 2 As shown in c.
[0082] In the process of precise regulation of the affinity of the sulfadimethoxine aptamer based on molecular tweezers, the binding of the aptamer to the target is mainly determined by the length of the double-stranded molecular tweezers and the flexible single chain. When the length of the molecular tweezers is in the range of 24 to 18 bp, the binding of the stress aptamer molecule to the target weakens as the length of the molecular tweezers decreases. In this range, the introduction of the flexible single chain flexibly adjusts the binding of the stress aptamer molecule to the target. However, when the length of the molecular tweezers is shortened to 16 bp, the double-stranded molecular tweezers dominates, that is, at this time, the binding of the stress aptamer molecule to the target is mainly restricted by the double-stranded molecular tweezers. In addition, the present application also releases the elastic energy stored in the double-stranded region of the molecular tweezers to a great extent by changing the width of the gap in the double-stranded region, resulting in a reduction in the mechanical stress acting on the aptamer, enhancing the binding of the aptamer to the target sulfadimethoxine, and improving the binding affinity. It is worth noting that although the binding affinity of the aptamer M5 was slightly reduced under the combined action of the double-stranded molecular tweezers and the flexible single chain, the binding affinity of the aptamer M5 was slightly reduced. However, this application believes that this situation will not affect the practicality of the corresponding strategy. Because the molecular clamp structure is adjustable, this adjustability can make the precise regulation of aptamer affinity more flexible, and the affinity can be appropriately adjusted according to actual needs. At the same time, the special double-stranded structure of the molecular clamp further improves the stability of the binding between the aptamer and the target, which overall ensures the effectiveness of this strategy in practical applications.
[0083] Figure 3 The results of the circular dichroism spectrum clearly show that the complex formed by the M5 aptamer and SDM presents an obvious absorption peak at 216nm. 16–18 After (Gap=2), the intensity of the CD peak increased significantly, accompanied by a red shift, indicating that the application of the molecular clamp stabilized the binding of the M5 aptamer to the target SDM.
[0084] The effectiveness of the two sensors in detecting different concentrations of SDM was compared. By comparing the ultraviolet absorption of the supernatant at 260nm, it was found that the ultraviolet absorption of the supernatant of the molecular tweezers SAM-MC sensor was significantly higher than that of the aptamer-based M5-MC sensor. This means that the complementary chain SA replaced in the supernatant of the SAM-MC sensor is more than that of the M5-MC sensor, which further proves that the SAM-MC sensor is more sensitive to the target SDM than the M5-MC sensor. In addition, when the concentration of the target SDM dropped to 10μM, the supernatant of the molecular tweezers SAM-MC sensor can still detect a relatively obvious ultraviolet absorption ( Figure 4 b).
[0085] At the same time, the present application also explored the selectivity of the sensor SAM-MC for different targets. By comparing the ultraviolet absorption of the supernatants of different targets at 260nm, the results showed that only the target sulfadimethoxine group showed obvious signal detection, while the other groups had only weak signals or no obvious signal output, which shows that the sensor of the present application has good selectivity ( Figure 4 c).
[0086] This application focuses on the sulfadimethoxine (SDM) aptamer and achieves precise control of its affinity through DNA molecular clamp technology. The study first determined the critical molecular clamp length N by time-lapse gel electrophoresis. c It was found that when the length of the molecular clamp was in the range of 24 to 18 bp, the binding constant K d It gradually increases with the shortening of the molecular clamp, but the change range is small (2.107~4.023μM). However, when the length of the molecular clamp is reduced to 16bp, K d The value increased significantly to 54.55 μM, indicating that the elastic energy of the molecular tweezers reached a threshold, leading to a significant change in the aptamer conformation. This nonlinear change reveals the threshold effect of mechanical stress on the aptamer conformation.
[0087] To ease the rigid constraints of the molecular clamp, the study introduced 2-6 nt flexible single chains at both ends of the aptamer. The results showed that the introduction of flexible single chains can partially release mechanical stress and reduce the system entropy. For example, in the 22 bp molecular clamp system, when the flexible chain increases from 0 to 6 nt, K d The K value increased from 2.62 μM to 20.89 μM, and ΔS decreased from -102.1 to -245.8 J / mol·K. Similarly, in the 20 / 18 bp system, the introduction of the flexible chain also significantly reduced the K value. d This suggests that the flexible single chain can act as a "molecular spring" to fine-tune the affinity by adjusting the relationship between mechanical stress and conformational flexibility.
[0088] In addition, the affinity of the aptamer was further regulated by changing the gap width in the double-stranded region of the molecular clamp. The results showed that increasing the gap width significantly improved the binding ability of the aptamer to the target. For example, when the gap width increased from 0 to 2 nt, K d The kinetics of the aptamer were significantly decreased from 54.55 μM to 0.602 μM, and ΔS decreased from 29.92 to -254.6 J / mol·K. This magnitude change was attributed to the fact that the gap released the elastic energy stored in the double-stranded region, reducing the conformational tension of the aptamer. However, when the gap width increased to 3 nt, K d It rebounded to 2.654 μM, suggesting that there is an optimal gap size (2 nt in this application). A gap that is too large may destroy the structural stability of the molecular tweezers.
[0089] This application successfully constructed a multi-dimensional regulatory system based on DNA molecular clamps, realizing the SDM aptamer K d Precise regulation within the range of 0.602 to 66.08 μM was achieved. To verify that this regulatory mechanism is superior to sensing mechanisms relying solely on aptamers, this application developed a molecular tweezer-mediated magnetic bead biosensor. Experimental results demonstrated that the detection sensitivity of the molecular tweezer-mediated magnetic bead biosensor was superior to that of traditional strand-displacement magnetic bead biosensors.
[0090] Example 2
[0091] This example provides nucleic acid molecular tweezers-mediated polyacrylamide hydrogel construction and metal nanozyme catalytic performance.
[0092] Prepare 10 mL of a 20 mM K2PtCl4 solution. Accurately weigh 83.0 mg of K2PtCl4 solid using an analytical balance. Transfer 8.30 mg of the weighed K2PtCl4 standard to a clean 10 mL volumetric flask. Add an appropriate amount of deionized water and shake gently to promote dissolution. Once the K2PtCl4 is completely dissolved, dilute to the mark with solvent. Prepare 10 mL of a 38.62 mM RuCl3 solution. Accurately weigh 80.09 mg of RuCl3 solid using an analytical balance. Transfer the weighed RuCl3 standard to a clean 10 mL volumetric flask. Add an appropriate amount of deionized water and shake gently to promote dissolution. Once the K2PtCl4 is completely dissolved, dilute to the mark with solvent. Prepare 1 mL of a 1.3 M L-ascorbic acid solution. Accurately weigh 0.228 g of L-ascorbic acid using an analytical balance. Transfer the weighed L-ascorbic acid standard to a 2ml centrifuge tube and accurately transfer 1ml of deionized water using a 1ml pipette. Vortex for 1min until completely dissolved. Prepare 100ml of a 0.23mM ZrCl4 solution. Accurately weigh 5.36mg of ZrCl4 solid using an analytical balance. Transfer the weighed ZrCl4 standard to a clean 100ml volumetric flask. Add an appropriate amount of deionized water and shake gently to promote dissolution. After the ZrCl4 is completely dissolved, dilute to the mark with solvent. Prepare 1L of a 0.046mM MnCl2·4H2O solution. Accurately weigh 9.2mg of MnCl2·4H2O using an analytical balance. Transfer the weighed MnCl2·4H2O standard to a 1L volumetric flask, add an appropriate amount of deionized water, and shake gently to promote dissolution. After the MnCl2·4H2O is completely dissolved, dilute to the mark with solvent. Prepare 100 ml of a 0.23 mM NH2-BDC solution. Accurately weigh 4.17 mg of NH2-BDC using an analytical balance. Transfer the weighed NH2-BDC standard to a 100 ml volumetric flask, add an appropriate amount of deionized water, and gently shake to promote dissolution. After the NH2-BDC is completely dissolved, dilute to the mark with solvent.
[0093] The nucleic acid sequences used in this experiment are shown in Table 4. All were synthesized by Shanghai Bioengineering Co., Ltd. and purified using conventional HPLC. The synthesized DNA powder was dissolved in enzyme-free water to a 100 μM stock solution and stored at 4°C. The complementary strands SA and SB are partially complementary to gap-2A and gap-2B. SA and SB were modified with acrylates at the 5′ ends of SA′ and SB′ for subsequent hydrogel construction.
[0094] Table 4 Nucleic acid sequences used to construct hydrogel cross-linking modules
[0095] SsDNA 5′-3′ gap-2A TGATGCGTAAGGGCAAGGAGGGTTCCTAGATGCTGTGA gap-2B ACGCATCATTTCACAGCA SA Arcydite-TGACATTCCCG SA′ GCCCTTACAGT SB Arcydite-CTCGATCTAGG SB′ GGATCTAGCTC
[0096] The construction of the hydrogel cross-linking module (Link-SAM) is based on the principle of complementary base pairing of nucleic acid chains, forming a cross-linked network with a molecular clamp structure through self-assembly. The module is composed of four nucleic acid chains: SA, SB, gap-2A, and gap-2B. The 5' ends of SA and SB are modified with acrylate groups, which endow them with copolymerization activity with acrylamide monomers, thereby participating in the subsequent chemical cross-linking reaction of the hydrogel. Gap-2A and gap-2B hybridize through precisely designed complementary sequences to form a stress aptamer molecule (SAM) with a molecular clamp structure. The core aptamer sequence region of the gap-2A and gap-2B is complementary to the middle segment of SA and SB, ultimately forming a stable Link-SAM cross-linking module through four-chain cooperative self-assembly.
[0097] Initial stock solutions (100 μM) of gap-2A, gap-2B, SA, and SB were diluted to 10 μM using 1× hybridization buffer (pH 7.4, containing 10 mM Tris-HCl, 50 mM NaCl, and 5 mM MgCl2) to prevent nonspecific binding. The four nucleic acid strands were mixed in a PCR tube at a predetermined molar ratio, resulting in a total reaction volume of 50 μL (any deficiency was made up with 1× hybridization buffer). A PCR thermocycler was used for programmed incubation: first, heating at 95°C for 5 minutes to eliminate secondary structure, followed by slow cooling to 25°C in a linear ramp (at a rate of ~0.1°C / s) to ensure that the nucleic acid strands formed a stable Link-SAM complex through base pairing. To identify optimal crosslinking module assembly conditions, four parallel experiments were conducted to investigate the effect of the SA:SB ratio on Link-SAM structural integrity. The design is shown in Table 5.
[0098] Table 5 Ratio setting of each cross-linking module
[0099] Type / proportion 1:1:1:1 2:1:1:1 1:2:1:1 2:2:1:1 gap2A 5 10 5 10 gap2B 5 5 10 10 SA 5 5 5 5 SB 5 5 5 5 1× hybridization buffer 30 25 25 20 Total volume 50 50 50 50
[0100] (1) Polyacrylamide gel electrophoresis
[0101] To verify the successful construction of Link-SAM, the present application analyzed the conformational changes of the hybridization complex by native polyacrylamide gel electrophoresis (Native-PAGE), and selected the group with single band and matching mobility as the cross-linker for subsequent gel synthesis.
[0102] The experiment used 15% PAGE (acrylamide: methylene bisacrylamide = 29:1, pH 8.8), and the electrophoresis buffer was 1×TBE (89mM Tris-base, 89mM boric acid, 2mM EDTA). All samples were mixed with 6× non-denaturing loading buffer (containing 15% Ficoll 400, 0.25% xylene cyanol) at a volume ratio of 5:1, and each lane was accurately loaded with 10μL. The four lanes were loaded with 10μl, 10μM SA, SB, M5, and Link-SAM in sequence, and then electrophoresed at a constant voltage of 120V for 45min (ice bath), followed by staining with GelRed nucleic acid dye (diluted with 1×PBS) for 20min. Fluorescence images were collected using the ChemiDoc MP imaging system (Bio-Rad), and the band mobility (R f = target migration distance / xylene cyanol front distance).
[0103] (2) Circular dichroism experiment
[0104] To establish a multi-dimensional structure verification system, this application conducted circular dichroism (CD) analysis on complementary single-chain SA / SB, M5 aptamer and Link-SAM. The experiment used a J-1500 spectropolarimeter (JASCO) to scan the wavelength range of 200-320nm. By analyzing the characteristic absorption region (λ max =265±5 nm) and the peak position shift (Δλ≥3 nm was considered a significant shift) characterize the reorganization of the nucleic acid secondary structure induced by stress response.
[0105] In this experiment, a chemical cross-linking method was used to prepare Link-SAM cross-linked acrylamide hydrogels. The specific steps are as follows: First, 20 μL of Link-SAM cross-linking modules (10 μM) prepared by hybridization incubation in a PCR thermal cycler were taken as the cross-linker base. Then, 2 mg of acrylamide monomer, 1 μL of 10% ammonium persulfate (APS) solution, and 2 μL of 5% tetramethylethylenediamine (TEMED) solution were added to the system in sequence. Among them, APS and TEMED constitute a redox initiation system, which triggers the polymerization and cross-linking of acrylamide monomers through free radical reactions. The above mixture was kept at a constant temperature of 37°C in a vacuum drying oven for 15 minutes to promote the full polymerization of the monomers to form a three-dimensional network structure hydrogel.
[0106] After the polymerization reaction is completed, the PCR tube containing the gel is taken out for post-processing. The hydrogel is washed three times in a gradient manner (5 mL each time, oscillation for 10 minutes) at room temperature using the same 1× hybridization buffer (10mM Tris, 5mM MgCl2, 100mM NaCl, pH = 7.9) as the Link-SAM cross-linking module incubation process. This step is intended to remove impurities such as unreacted acrylamide monomers, residual initiators, and nanozymes that do not participate in cross-linking in the system, while maintaining the swelling state of the hydrogel and the stability of the cross-linked structure. The Link-SAM cross-linked hydrogel finally obtained can be used for subsequent characterization analysis after freeze-drying.
[0107] (1) Synthesis of Mn-Zr bimetallic MOF
[0108] ZrCl₄ (54 mg, 0.233 mmol), MnCl₂·4H₂O (9 mg, 0.045 mmol), NH₂-BDC (42 mg, 0.232 mmol), and PVP (30 mg) were dissolved in 50 mL of N,N-dimethylformamide (DMF). The mixed solution was sonicated for 15 minutes and then transferred to a Teflon stainless steel autoclave for reaction at 120°C for 10 hours. The solid product was then washed three times with DMF and methanol, followed by vacuum drying at 60°C overnight. UiO-66-NH₂(Zr) was synthesized using a similar method, except that ZrCl₄ (53.6 mg, 0.230 mmol) was used as the metal source.
[0109] (2) Synthesis of Pt-Ru bimetallic MOF
[0110] In a 1.5 mL centrifuge tube, 63.6 μL (20 mM) K2PtCl4, 44 μL (38.62 mM) RuCl3, 5.9 mg glycine, 14.5 mg PVP (Mw = 58,000), and 899 μL ultrapure water were added and centrifuged for 10 min. After preheating at 60 ° C for 5 min, 89.7 μL freshly prepared L-ascorbic acid (1.3 M) was added, vortexed for 1 min, and incubated at 60 ° C for 2 h. The synthesized Pt-Ru Nc was collected, centrifuged at 12,000 rpm for 10 min, and washed three times with ultrapure water to remove unreduced RuCl3. The Pt nanozyme for comparison was also synthesized according to a similar method, using only K2PtCl4 (63.6 μL, 20 mM) as the metal source.
[0111] This application uses UV-visible spectrophotometry to systematically investigate the peroxidase-like activity of Mn-Zr MOF and Pt-Ru MOF nanozymes. First, the morphology and size of the two MOF materials were characterized by scanning electron microscopy (SEM) to ensure their structural uniformity. The enzyme kinetics experiment was carried out in an acetate buffer system at pH 4.0 using hydrogen peroxide (H2O2) as a substrate and 3,3',5,5'-tetramethylbenzidine (TMB) as a color developer. During the reaction, the characteristic absorption peak intensity change of the TMB oxidation product (xTMB) was monitored in real time at 652nm using a UV-visible spectrophotometer, and the reaction progress curve was recorded. By measuring the initial reaction rate at different H2O2 concentrations (0.1~10mM), the Lineweaver-Burk double reciprocal plot was drawn, and the Michaelis constant (K m ) and the maximum reaction rate (V max All experiments were performed at 25°C, and each experiment was repeated three times.
[0112] This application uses 15% native polyacrylamide gel electrophoresis (Native-PAGE) to analyze the stress aptamer molecule SAM 16-18 The assembly effect of its cross-linking module Link-SAM was verified. The experiment set up four key samples: SA (11nt), SB (11nt), SAM 16-18 (gap2A+gap2B hybrid) and Link-SAM complex. SA and SB are 11nt short oligonucleotides ( Figure 5 ), whose electrophoretic bands are all located below the 25bp standard reference band, showing diffuse weak signals. This phenomenon can be attributed to the structural differences between single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA): Compared with dsDNA with a rigid double helix structure, ssDNA has a smaller hydrodynamic radius due to the lack of this structure, resulting in a faster migration rate in the gel. The stress aptamer molecule SAM in the third lane and the cross-linking module (Link-SAM) in the fourth lane structurally contain both double-stranded and single-stranded regions, and therefore appear as brighter bands in gel electrophoresis. It is worth noting that the mobility of the cross-linking module in the fourth lane is significantly higher than that of the stress aptamer molecule SAM in the third lane. This result strongly confirms the successful construction of the cross-linking module.
[0113] In order to further verify the structural characteristics of the cross-linking module, this application uses circular dichroism spectroscopy to analyze the SA+SB and SAM 16-18 (gap2) and cross-linking module (Link-SAM) were analyzed for secondary structure. The experimental results showed that ( Figure 6 b), SA+SB has a characteristic CD absorption peak at 293nm, while SAM 16-18The absorption peak of (gap2) red-shifts to 295nm, and the peak intensity is significantly enhanced. This change can be attributed to the following two factors: First, SAM 16-18 The molecular weight of (gap2) is significantly higher than that of SA+SB, which leads to the enhancement of CD signal. 16-18 The special double-stranded structure formed in (gap2) changes the electronic distribution of nucleic acid, causing the red shift of the absorption peak. It is worth noting that the CD spectrum of Link-SAM shows more significant characteristic changes: compared with SA+SB and SAM 16-18 (gap2), its absorption peak intensity is further enhanced, and the maximum absorption wavelength is further red-shifted. These characteristic changes indicate that a more complex secondary structure has been formed in Link-SAM, which fully confirms the successful construction of the cross-linking module. Through circular dichroism analysis, this application not only verifies the successful construction of the cross-linking module, but also obtains important information on its secondary structural characteristics, providing a theoretical basis for subsequent functional studies. In order to obtain hydrogels at the optimal ratio, four hydrogels at different ratios were experimentally constructed. Link-SAM based on oligonucleotide self-assembly is the core structure for realizing the intelligent response of hydrogels. Through the multi-level base complementary pairing of SA / SB and gap2A / gap2B, the hairpin structure formed has both dynamic reversibility and structural stability. It is worth noting that the 5'-end acrylate modification of SA / SB realizes the covalent connection between the nucleic acid structure and the acrylamide monomer. This "soft-hard combination" strategy not only retains the molecular recognition function of the DNA aptamer, but also gives the hydrogel good mechanical strength.
[0114] Scanning electron microscopy (SEM) results showed that ( Figure 7 ), first of all, from the microscopic morphology analysis, group a, group b, and group c with SA / SB ratios of 1:1, 1:2, and 2:1 all showed regular polygonal pore structures, while group d with the SA / SB ratio increased to 2:2 formed circular / elliptical pores. This phenomenon may be related to the spatial arrangement of the cross-linked network: when the SA / SB concentration increases synchronously, the density of base complementary pairing between oligonucleotide chains increases, resulting in a homogenized distribution of cross-linked sites, thereby weakening the orientation characteristics of the polygonal structure. Image J Version 1.54p was further used to analyze the Figure 7 The structural parameters of the gel electron micrographs shown in the figure were analyzed, and the calculation results show (Table 6): When SA / SB = 1:1 (group a), the symmetrical complementary pairing promotes the uniform distribution of cross-linking sites, forming regular polygonal pores (equivalent diameter 12.43μm) and moderate cross-linking point spacing (10.32μm). This symmetrical network exhibits high structural stability. The synergistic effect of its fiber chain diameter (2.36μm) and pore geometric characteristics not only maintains the skeleton rigidity, but also provides structural compliance through the stress dispersion mechanism at the polygonal vertices ( Figure 7e). The introduction of an asymmetric ratio significantly changed the network topology. The excess SB in SA / SB = 1:2 (group b) caused the cross-linking sites to shift toward the gap-B-rich region, and the distance between cross-linking points expanded to 15.06 μm (an increase of 45.9% compared to group a), but the fiber diameter increased simultaneously to 2.47 μm ( Figure 7 f). Scanning electron microscopy shows that its pores still maintain a polygonal structure, indicating that although asymmetric crosslinking increases the local crosslinking density, it does not destroy the overall ductility of the network. It is worth noting that SA / SB = 2:1 (c group) shows unique structural advantages under asymmetric conditions: the equivalent pore size increases to 14.76μm (an increase of 18.7% compared with a group), the crosslinking spacing is maintained at 13.17μm, and the fiber diameter is reduced to 1.86μm ( Figure 7 g) This “high porosity and low density” characteristic may be due to the spatial reorganization of cross-linking sites induced by excess SA: SA preferentially occupies the binding sites on the left side of gap-A, forcing gap-B to form loose cross-links on the right side, thereby reducing the fiber packing density while maintaining polygonal pores.
[0115] Table 6 Structural parameters of Link-SAM cross-linked gel
[0116] type a b c d Equivalent diameter (single pore) 12.43 12.48 14.76 7.51 Cross-link distance (chain length) 10.32 15.06 13.17 8.79 Fiber / chain diameter 2.36 2.47 1.86 3.81
[0117] The structural characteristics of the extreme ratio group (group d) are significantly different from the first three groups. Its equivalent pore size is sharply reduced to 7.51μm (only 50.8% of group c), and the pore morphology is transformed into an elliptical shape. The distance between crosslinking points is shortened to 8.79μm, and the fiber diameter is increased to 3.81μm ( Figure 7 h). This "densification-fiber thickening" phenomenon suggests that when the SA / SB ratio is severely unbalanced, site competition may occur during the assembly of the four-chain complex, leading to localized collapse of the cross-linked network. The formation of elliptical pores suggests that the cross-link density is unevenly distributed in three dimensions, and that high-density cross-links along the long axis may inhibit stress release at the polygonal vertices, while low-density regions along the short axis compensate for mechanical strength through fiber thickening. This finding confirms the importance of cross-link module symmetry for network homogenization. Moderate asymmetric ratios (such as group c) can optimize performance by dynamically regulating the spatial arrangement of cross-linking sites, while extreme ratios (such as group d) lead to structural degradation due to unbalanced cross-link density distribution.
[0118] Fourier transform infrared spectroscopy (FTIR) analysis revealed that all samples exhibited characteristic peaks at 1650 cm-1 (C=O stretching vibration), 1540 cm-1 (NH bending vibration), and 1120 cm-1 (S=O vibration), confirming the successful cross-linking and polymerization of the acrylamide monomers. Notably, the intensity of the characteristic benzene ring peak (C6H6, 1450-1600 cm-1) in the Link-SAM-introduced group was significantly higher than that in the pure polyacrylamide control group, which may be directly related to the contribution of the aromatic bases in the oligonucleotide, providing key evidence for the successful integration of the cross-linking module.
[0119] SEM images after SDM treatment showed that all hydrogels exhibited varying degrees of skeleton fracture, but the failure modes varied: Group a exhibited randomly distributed localized collapse with a rough fracture surface, while Group d exhibited global disintegration along the grain boundaries with a smooth fracture surface.
[0120] This application systematically constructs a Link-SAM cross-linked hydrogel based on stress adaptor molecules (SAM), and verifies its structural characteristics, detection performance and stability in multiple dimensions. The successful assembly of the cross-linking module Link-SAM was confirmed by native polyacrylamide gel electrophoresis (Native-PAGE) and circular dichroism (CD) analysis: the electrophoresis results show that the mobility of Link-SAM is significantly higher than that of the SAM monomer, indicating that its structural complexity has increased; the red shift of the absorption peak in the CD spectrum (293nm→295nm) and the enhancement of the peak intensity reveal the reconstruction and stabilization of the nucleic acid secondary structure in the cross-linking module. Further Fourier transform infrared spectroscopy (FTIR) analysis confirmed the covalent cross-linking of the acrylamide monomer and the Link-SAM module, in which the synergistic appearance of the C=O stretching vibration peak at 1650cm-1 and the characteristic peak of the aromatic base at 1450-1600cm-1 provided direct evidence for the chemical integration of the hybrid network.
[0121] In the synthesis and optimization of Link-SAM crosslinked gels, the symmetry of the SA / SB ratio significantly influenced the pore morphology and network topology. When SA / SB = 1:1 (group a), the symmetrical complementary pairing promoted a uniform distribution of crosslinking sites, forming regular polygonal pores (equivalent diameter 12.43 μm) and a moderate crosslink spacing (10.32 μm). The introduction of an asymmetric ratio of SA / SB = 1:2 (group c) significantly altered the network topology. Scanning electron microscopy revealed that the pores retained a polygonal structure, indicating that while asymmetric crosslinking increased local crosslink density, it did not compromise the overall ductility of the network. In particular, SA / SB = 2:1 (group c) exhibited a unique structural advantage under asymmetric conditions—a "high porosity-low density" characteristic. This characteristic may be due to the spatial reorganization of crosslinking sites induced by the excess SA.
[0122] Studies of the morphology and catalytic performance of bimetallic nanozymes show that, compared to a single-metal nanozyme (ZrMOF), the cubic structure of Mn-ZrMOF, through the doping of metallic Mn, increases its specific activity (SA = 39.5 U·mg-1) by 5.14 times compared to pure ZrMOF. Meanwhile, the Pt-Ru MOF (SA = 106.83 U·mg-1) increases its specific activity by 1.53 times compared to ZrMOF (69.58 U·mg-1). Elemental distribution analysis reveals that Mn enrichment at the edges of the Mn-ZrMOF forms electron transport channels, while the uniform alloying effect of the Pt-RuMOF modulates the center position of the d-band, synergistically enhancing catalytic efficiency.
[0123] Example 3
[0124] This example provides the detection of sulfadimethoxine using molecular tweezers-mediated aptamer-polyacrylamide gel.
[0125] The primer sequences used to construct the biosensor in this example are shown in Table 9.
[0126] Table 9 Primer sequences used to construct biosensors
[0127] ssDNA ssDNA (5′-3′) gap-2A TGATGCGTAAGGGCAAGGAGGGTTCCTAGATGCTGTGA gap-2A′ Biotin-TGATGCGTAAGGGCAAGGAGGGTTCCTAGATGCTGTGA gap-2B ACGCATCATTTCACAGCA gap-2B′ Biotin-ACGCATCATTTCACAGCA M5 AAGGGCAAGGAGGGTTCCTAGA M5′ Biotin-AAGGGCAAGGAGGGTTCCTAGA SA TTCTAGGAACC
[0128] The principle of constructing the biosensor in this embodiment is as follows Figure 8 shown.
[0129] The synthesis steps of Link-SAM cross-linked gel are as follows: First, take 20 μL of Link-SAM (10 μM) prepared by hybridization incubation in a PCR thermal cycler as a cross-linker substrate. Then, 2 mg of acrylamide monomer, 1.5 μL of 4 mg / mL Pt-Ru bimetallic nanozyme solution, 1 μL of 10% ammonium persulfate (APS) solution and 2 μL of 5% tetramethylethylenediamine (TEMED) solution are added to the system in sequence. Among them, APS and TEMED constitute a redox initiation system, which initiates the polymerization and cross-linking of acrylamide monomers through free radical reactions. The above mixture is then placed in a vacuum drying oven (constant temperature of 37°C for 15 minutes) to promote the full polymerization of acrylamide monomers and cross-linker Link-SAM.
[0130] After the polymerization reaction is completed, the PCR tube containing the hydrogel is taken out for post-processing. The hydrogel is washed three times in a gradient manner (5 mL each time, oscillation for 10 minutes) at room temperature using the same 1× hybridization buffer (10mM Tris, 5mM MgCl2, 100mM NaCl, pH = 7.9) as the Link-SAM incubation process. This step is intended to remove impurities such as unreacted acrylamide monomers, residual initiators, and incompletely coated nanozymes in the system, while maintaining the swelling state of the hydrogel and the stability of the cross-linked structure. Finally, the obtained Link-SAM cross-linked gel is placed in a 4°C refrigerator for use.
[0131] 100μM Sulfamethoxazole Stock Solution: Accurately weigh 3.103mg of Sulfamethoxazole (molecular weight 310.33g / mol) and dissolve in an appropriate amount of ultrapure water. Transfer to a 100mL volumetric flask, dilute to the mark, and shake well. Prepare 1ml of a 10mg / ml TMB solution. Accurately weigh 10mg of TMB standard and dissolve in 1ml of DMSO. Vortex until completely dissolved. Prepare immediately before use. 3% H2O2: Take 10mL of a 30% H2O2 solution and dilute to 100mL with water to obtain a 3% H2O2 solution.
[0132] 500 mL of surface and bottom water samples were collected from the lake center using pre-cleaned brown glass bottles (1 L), avoiding disturbing the sediment. Water temperature, pH, and sampling time were recorded on-site. Samples were transported in a 4°C refrigerator protected from light and processed within 24 hours. The water samples were filtered under reduced pressure (vacuum ≤ 0.05 MPa) through a 0.22 μm cellulose acetate filter (pre-treated by soaking in ultrapure water for 2 hours). The filtrate was transferred to a polyethylene bottle, and the filter membrane was removed with forceps, folded in half, and stored in a sterile centrifuge tube. The filtrate and filter membrane were frozen at -20°C until testing. The processing time and filter membrane number were recorded. The simulated sulfadimethoxine-spiked environmental contaminated water sample was prepared by diluting the sulfadimethoxine standard stock solution (100 μM, H2O) with a treated environmental blank lake water sample.
[0133] In order to clarify the optimal detection range of Link-SAM cross-linked hydrogel for sulfamethoxazole (SDM), this application evaluates its response characteristics through a multi-stage concentration gradient experimental system. First, the SDM concentration gradient was set to 0.01–100μM, covering three characteristic response ranges: low concentration (0.01~1μM), medium concentration (10~50μM) and high concentration (70~100μM). Different concentrations of SDM solution (20μL) were incubated with Link-SAM hydrogel (containing nanozyme) at 37°C for 1h, then centrifuged to obtain the supernatant, mixed with TMB-H2O2 color development system (50μL) for 15min, and the absorbance (OD value) at 450nm was measured. Preliminary experiments showed that the OD value increased nonlinearly with the SDM concentration, and there were significant inflection points at 10μM and 70μM, suggesting a response threshold effect. To further refine the detection range, gradient experiments were performed in the range of 0.1-1 μM and 10-100 μM (with intervals of 0.1 μM and 5 μM), with three parallel samples in each group. The relationship between OD value and concentration was analyzed by nonlinear fitting.
[0134] The specific response of Link-SAM cross-linked gel to sulfadimethoxine (SDM) was verified, and non-specific interference from other sulfonamide compounds (sulfamethoxazole SMX, sulfachlorpromazine SCP) and non-sulfonamide antibiotics (kanamycin KAN) was excluded. 10 μM SDM, SMX, SCP and KAN solutions (10 μL each) were added to the centrifuge tube containing Link-SAM hydrogel, and the total volume was supplemented with 1× PBS buffer to 100 μL. An equal volume of 1× PBS buffer was added to the hydrogel system as a negative control. An empty gel system without nanozyme was added with 10 μM SDM solution as a positive control. Three parallel samples were set up for all groups. After incubation at 37°C for 1 hour, the samples were centrifuged at 12,000 rpm for 5 minutes, and the supernatant was collected for detection. Then, 50 μL of the supernatant was mixed with an equal volume of TMB colorimetric solution (containing 0.1 mg / mL TMB, 0.01% H2O2, pH 4.5 acetate buffer) and reacted at 25°C in the dark for 15 minutes. 50 μL of 2M H2SO4 was added to terminate the reaction, and the absorbance (OD value) at 450 nm was measured using a microplate reader. The difference in OD values between the experimental group and the control group was calculated, and the ΔOD of the SDM group (experimental group OD-negative control OD) was used as the specific response benchmark. A one-way analysis of variance (ANOVA) was used to evaluate the significant difference between the SDM group and other drug groups (p<0.01) to verify the specificity. The possibility of nonspecific release of nanozymes was excluded by positive control.
[0135] The long-term stability of Link-SAM cross-linked hydrogels stored at 4°C was evaluated to reveal their performance degradation mechanism and shelf life, providing a theoretical basis for practical applications. Ten batches of Link-SAM cross-linked hydrogels (containing nanozymes) were prepared and dispensed into 1.5 mL centrifuge tubes, with a volume of 100 μL per tube. The samples were stored in a 4°C constant temperature refrigerator and sampled and tested on days 1, 3, 5, 7, 9, 11, and 13. A 1 μM sulfadimethoxine (SDM) solution (20 μL) was added to the stored samples, incubated at 37°C for 1 hour, and then centrifuged (12,000 rpm for 5 minutes) to collect the supernatant. TMB colorimetric solution (50 μL) was added and reacted for 15 minutes. After terminating the reaction with 2 M H2SO4, the absorbance at 450 nm (OD value) was measured. The rate of change of OD values of samples with different storage times was calculated, the decay curve was plotted, and a decay kinetic model was fitted. The correlation between gap-2A degradation rate and OD value change was analyzed by Pearson correlation analysis (p<0.01). The performance advantages of this system were evaluated by comparing the DNA hydrogel stability data reported in the literature.
[0136] The effect of SDM concentration (0.01–100 μM) on the response behavior of hydrogels was systematically investigated, and a curve of the relationship between UV absorption (450 nm) and SDM concentration was constructed ( Figure 9 Experimental data showed that the absorption value increased nonlinearly with the increase of SDM concentration, and could be divided into three characteristic intervals: Low concentration area (0.01–1 μM): The absorption value increased slowly from 0.015 to 0.14, with an increase of only 0.125, showing an approximately linear relationship (R 2 =0.983). In the medium concentration range (10–50 μM), the absorbance value jumped from 0.26 to 0.705, with an increase of 0.445, showing an exponential growth trend (fitting equation: y = 0.24e 0.03x , R 2 =0.974). High concentration region (70–100 μM): The absorbance value increased sharply to 1.85, with an increase of 1.12, showing a superlinear response (slope k = 0.035 μM). -1). Notably, clear inflection points were observed at 10μM and 70μM, indicating a threshold effect in the hydrogel's response to SDM. This nonlinear kinetic characteristic is closely related to the destruction mechanism of the Link-SAM cross-linked network: in the low concentration region: after the SDM molecules bind to the gap2A aptamer, only local cross-linking nodes are broken, and the nanozyme release efficiency is low (<15%). At this time, the absorption signal mainly comes from the catalytic oxidation of TMB by a small amount of free enzyme. In the medium concentration region: after the SDM concentration exceeds the critical threshold (~10μM), the chain displacement reaction triggered by the aptamer binding produces a cascade effect, leading to the overall collapse of the cross-linked network. The amount of nanozyme released increases significantly (release rate >60%), and the catalytic activity is exponentially amplified. In the high concentration region: excessive SDM (>70μM) causes the hydrogel skeleton to completely disintegrate, and the nanozyme is released explosively (release rate >95%). At this time, the free enzyme concentration in the solution is close to saturation, the TMB oxidation reaction rate is limited by substrate diffusion, and the absorption value growth rate slows down.
[0137] To further determine the optimal detection range, we conducted a concentration gradient experiment in the range of 0.1-1μM and 10-100μM: in the low concentration range (0.1-1μM), the absorption value gradually increased from 0.063 (0.1μM) to 0.097 (0.9μM), with an increase of only 0.034, and the signal-to-noise ratio (S / N) was between 2.1 and 3.8. Although there was a weak correlation between the absorption value and the concentration in this range (R 2 =0.891), but the detection signal fluctuated greatly (RSD = 12.4-18.7%). This suggests that at submicromolar concentrations, the response of the hydrogel may be limited by the following factors: Thermodynamic constraints: The binding constant (K d =8.7nM) determines that the binding rate at low concentration is low (<30%), which is not enough to trigger significant structural damage. Nanozyme background release: Incompletely cross-linked MOF particles may remain on the hydrogel surface through physical adsorption, resulting in a high background absorption value (0.015-0.02). Instrument detection limit: The detection limit of the UV spectrophotometer (~0.01Abs) limits the accurate capture of ultra-low concentration signals ( Figure 10 ).
[0138] The linear response analysis of the high concentration range (10-100 μM) showed that ( Figure 11 ), in the range of 10 to 70 μM, the absorption value showed an excellent linear relationship with the concentration (y = 0.018x + 0.07, R 2 =0.997), and the detection sensitivity reached 0.018Abs / μM. When the concentration exceeded 70μM, the absorption value growth rate increased significantly (the slope increased to 0.028Abs / μM), but the linearity decreased (R 2=0.952), which may be related to the following mechanisms: 1. Synergistic effect of cross-linking network collapse: When the SDM concentration reaches a critical threshold, multiple cross-linking nodes simultaneously break, resulting in a synergistic effect and accelerating the release of the nanozyme. 2. MOF aggregation effect: High-concentration nanozymes (>50 μg / mL) partially aggregate in solution, resulting in insufficient exposure of catalytic active sites and inhibiting the efficiency of the color reaction.
[0139] Based on the above results, 10-70 μM was determined to be the optimal detection range, which has the following advantages: a wide linear range (spanning 1.5 orders of magnitude), suitable for wide-spectrum detection of SDM in actual samples; sensitivity that meets trace detection requirements (LOD = 0.24 μM, S / N = 3); high signal stability (RSD < 5%) and excellent repeatability.
[0140] In this application, the selectivity of the hydrogel detection system was verified by comparing the response behavior of sulfamethoxazole (SDM) and its structural analogs (sulfamethoxazole, sulfachlorpromazine) and non-related antibiotics (kanamycin). The experimental results showed that the ultraviolet absorption value of the SDM group (0.22) was significantly higher than that of other interferents (<0.04), and the color reaction only occurred in the presence of SDM (the solution changed from colorless to blue), which fully demonstrated the high specificity of the system. The specificity of the system was further verified by observing the color change of the solution in the PCR tube with the naked eye. Among them, the solution of the SDM group changed from colorless to dark blue, indicating that the nanozyme was released in large quantities and catalyzed the oxidation of TMB. The other groups of solutions remained colorless, indicating that the cross-linked network was not destroyed and the nanozyme was still effectively encapsulated ( Figure 12 This intuitive color change is highly consistent with the UV absorption data, making it possible for rapid on-site detection. It is worth noting that the color intensity of the SDM group is linearly related to the absorption value (R 2 =0.986), indicating that semi-quantitative detection can be achieved by colorimetric card.
[0141] This specificity stems from the precise recognition of the stress aptamer molecule (SAM). Simultaneously, the hydrogel's steric hindrance, or cross-linked network, restricts the diffusion of larger molecules (such as kanamycin, MW = 484 Da), reducing their nonspecific contact with the aptamer. Furthermore, electrostatic repulsion, through the negatively charged DNA backbone, reduces the adsorption of anionic interferents (such as sulfamethoxazole).
[0142] The experimental results show that ( Figure 12), the UV absorption value of the SDM group (0.22) was 8.1 times, 5.8 times and 31.4 times that of sulfamethoxazole, sulfachlorpromazine and kanamycin, respectively, and significantly higher than the blank group (0.002). This significant signal difference indicates that the hydrogel based on stress aptamer molecules exhibits excellent selectivity. Among them, sulfamethoxazole and sulfachlorpromazine also showed weak responses (0.027 and 0.038), which may be due to the fact that sulfamethoxazole and sulfachlorpromazine have the same sulfonamide core structure as SDM, that is, the cross-reactivity of structural analogs. The UV absorption value of kanamycin (0.007) is close to that of the blank group, indicating that it hardly binds to the aptamer. This high selectivity is due to: the aminoglycoside structure of kanamycin is significantly different from the sulfonamide structure of SDM, and it cannot form an effective hydrogen bond network; its larger molecular size (diameter ~1.2nm) is effectively blocked by the hydrogel network. The hydrogel network is not destroyed, and the nanozyme is still effectively encapsulated.
[0143] This application demonstrates the excellent selectivity of a SDM detection system based on a stress aptamer-based cross-linked hydrogel through systematic specificity validation experiments. Experimental data and theoretical analysis indicate that this high specificity stems from the precise molecular recognition of the aptamers and the multiple screening effects of the hydrogel network. This system has broad application prospects in areas such as environmental monitoring and food safety.
[0144] In order to reveal the shelf life and performance degradation mechanism of Link-SAM cross-linked gel in practical applications, this application evaluated the stability of the hydrogel through long-term storage experiments. The experimental results showed that ( Figure 13 ). When stored at 4°C, the hydrogel's response signal (UV absorption at 450 nm) to 1 μM SDM exhibited a nonlinear decay over time: Initially (day 1), the absorbance value was 0.158, consistent with that of the freshly prepared sample (0.160 ± 0.005), indicating no significant performance loss during the initial storage period. During the rapid decay period (days 1–7), the absorbance value decreased from 0.158 to 0.146 (a decrease of 7.59%), with an average daily decay rate of 1.12%. During the plateau period (days 9–13), the absorbance value remained stable between 0.135 and 0.138.
[0145] Comparing the stability of this system with DNA hydrogels reported in the literature (Table 10), the system demonstrated a 94.1% signal retention rate over 7 days, surpassing both polyacrylamide / DNA hybrid gels (88.76%) and sodium alginate / DNA composites (90%). The average daily decay rate was 0.85% (days 1-7), significantly lower than that of sodium alginate / DNA composite gels (~3.2%). LinkSAM gels entered a stable phase after 9 days, similar to the behavior of covalently cross-linked systems (such as methacrylated DNA gels), indicating that the Link-SAM module achieves structural self-healing through dynamic cross-linking. Notably, the signal recovery on day 13 is rare in existing studies and may be due to the unique "relaxation-reequilibration" mechanism of this system: when the cross-linked network relaxes excessively, temporary π-π crosslinks in the SA / SB single-stranded regions are reestablished, partially restoring the nanozyme's encapsulation capacity.
[0146] Table 10 Comparison of signal retention rates
[0147] Gel type Daily attenuation rate % / day Signal retention rate% Polyacrylamide / DNA hybrid hydrogel 1.71 88.76 Sodium alginate / DNA composite hydrogel 3.2 90 Link-SAM Gel 0.85 94.1
[0148] The simulated surface water samples containing sulfadimethoxine were prepared using the spiked method. The target concentrations were set at 50.0, 25.0, 10.0, 5.0, and 1.0 μmol / L, respectively. Water (v / v) was used as the solvent system and the samples were prepared and used immediately to ensure stability. The constructed hydrogel sensor was used to detect the simulated contaminated water samples. As shown in the figure, the OD value at 450 nm was linearly correlated with the concentration of the simulated water sample in the range of 1 to 100 μM. The standard curve was: y = 0.01699x + 0.09555 (R 2 =0.992).
[0149] Spike recovery experiments revealed recoveries of 90.74% to 96.48% over a concentration gradient of 5 to 50 μmol / L, with relative standard deviations ranging from 4.48% to 7.32%, meeting the requirements for trace analysis (recovery 85% to 115%, RSD ≤ 10%) (Table 11). Notably, while the recovery of the 1.0 μmol / L spiked sample (85.36%) approached the method validation limit, its RSD (9.86%) still met the ISO 17025 precision requirements for low-concentration detection, demonstrating that the sensor maintains qualitative identification capabilities near the detection limit.
[0150] Further analysis revealed that as the spike concentration increased (10-50 μmol / L), the recovery stability significantly improved (RSD decreased from 7.01% to 4.48%), which was closely related to the enhanced signal-to-noise ratio of high-concentration signals and the improved kinetic stability of the color development reaction (TMB-H2O2 system). In the low concentration range (1-5 μmol / L), the absolute value of absorbance was small (0.09-0.25 AU), which may be due to competitive interference from trace reducing substances in environmental water samples, resulting in systematically low measurement values. Compared with similar studies, this method exhibits better precision over a wide concentration range, which is due to the stable encapsulation of the color development reagent by the hydrogel matrix.
[0151] Table 11 Actual water sample testing
[0152]
[0153] By systematically investigating the effect of SDM concentration (0.01-100 μM) on the hydrogel response, its nonlinear dynamic characteristics were clarified: in the low concentration region (0.01-1 μM), the signal fluctuation was large (RSD=12.4-18.7%) due to the low aptamer binding rate (<30%) and the background release of nanozymes; in the medium and high concentration region (10-70 μM), an excellent linear response (R 2 =0.997, sensitivity 0.018 Abs / μM), attributed to efficient nanozyme release (>60%) triggered by cascade collapse of the cross-linking network. However, at high concentrations (>70 μM), nanozyme aggregation led to decreased catalytic efficiency. Ultimately, the optimal detection window of 10-70 μM was determined, with a limit of detection (LOD) of 0.24 μM and a linear range of 1.5 orders of magnitude that meet practical application requirements.
[0154] Specificity experiments confirmed that the hydrogel's response to sulfamethoxazole (SDM) (ΔOD = 0.22) was significantly higher than that to sulfamethoxazole (0.027), sulfachlorpromazine (0.038), and kanamycin (0.007), with a cross-reactivity rate of less than 12.3%. The combined steric hindrance and electrostatic screening effects of the hydrogel ensured the high selectivity of the detection system. Stability assessments showed that the hydrogel retained 92.3% of its signal after seven days of storage at 4°C. Its two-stage decay mechanism (segment relaxation and aptamer degradation) partially restored performance through the self-healing properties of the dynamic cross-linked network.
[0155] This work, through molecular design, structural optimization, and performance control, has constructed a highly specific and wide-range SDM intelligent sensing platform, providing a new method for the rapid detection of sulfonamide contaminants in the environment and food. In simulated water samples, the recoveries of the target compounds ranged from 90.74% to 96.48% over a concentration gradient of 5 to 50 μmol / L, with relative standard deviations ranging from 4.48% to 7.32%, meeting the requirements for trace analysis.
[0156] The embodiments described above are only some of the embodiments of the present invention, rather than all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but merely represents the preferred embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concept of the present invention are within the scope of protection of the present invention.
Claims
1. A bimetallic nanozyme aptamer hydrogel, characterized in that: The bimetallic nanozyme aptamer hydrogel is a bimetallic nanozyme encapsulated in a molecular tweezers functionalized gel matrix; The molecular clamp functionalized gel matrix is composed of gap-2A, gap-2B, SA, SB and acrylamide hydrogel; The sequence of gap-2A is shown in SEQ ID NO: 1; The sequence of gap-2B is shown in SEQ ID NO: 2; The 5′ end of the SA is modified with an acrylate group, and the sequence is shown in SEQ ID NO: 3; The 5′ end of the SB is modified with an acrylate group, and the sequence is shown in SEQ ID NO: 4; The bimetallic nanozyme is a Mn-Zr bimetallic MOF or a Pt-Ru bimetallic MOF.
2. The bimetallic nanozyme aptamer hydrogel according to claim 1, characterized in that The molar ratio of gap-2A, gap-2B, SA, and SB is 1:1:1:1 to 2:2:1:
1.
3. The bimetallic nanozyme aptamer hydrogel according to claim 2, characterized in that The molar ratio of gap-2A, gap-2B, SA, and SB is 1:2:1:
1.
4. The bimetallic nanozyme aptamer hydrogel according to claim 1, characterized in that Every 2 mg of acrylamide monomer corresponds to 0.5-2 μL of 3-5 mg / mL Pt-Ru bimetallic nanozyme solution.
5. A method for preparing the bimetallic nanozyme aptamer hydrogel according to any one of claims 1 to 4, characterized in that: include: Gap-2A, gap-2B, SA, and SB were dissolved in a solvent and first heated at 90-100°C for 3-7 minutes to eliminate the secondary structure, and then cooled linearly to 20-30°C to ensure that the nucleic acid chains formed a stable complex through base complementary pairing; The complex and acrylamide monomer are placed in a redox initiation system, and the bimetallic nanozyme is added to initiate polymerization and cross-linking of the acrylamide monomer through a free radical reaction. The polymerization of free radicals causes the bimetallic nanozyme to be coated in the entire gel cross-linking system; Multiple washings with solvent are performed to remove unreacted impurities.
6. The method for preparing the bimetallic nanozyme aptamer hydrogel according to claim 5, characterized in that: The linear cooling rate is no higher than 0.1°C / s.
7. The method for preparing the bimetallic nanozyme aptamer hydrogel according to claim 5, characterized in that: The redox initiation system includes ammonium persulfate and tetramethylethylenediamine.
8. The method for preparing the bimetallic nanozyme aptamer hydrogel according to claim 5, characterized in that: The Mn-Zr bimetallic MOF consists of ZrCl 4、 MnCl2·4H2O, NH2-BDC and PVP are dissolved in a solvent, subjected to ultrasonic treatment, reacted at 110-130°C for 8-10 hours, and then washed and vacuum dried to obtain the product.
9. The method for preparing the bimetallic nanozyme aptamer hydrogel according to claim 5, characterized in that: The Pt-Ru bimetallic MOF is prepared by preheating K2PtCl4, RuCl3, glycine, PVP and water at 55-65°C for at least 5 minutes, adding L-ascorbic acid and maintaining the temperature at 55-65°C for sufficient reaction, and then washing and vacuum drying.
10. Use of the bimetallic nanozyme aptamer hydrogel according to any one of claims 1 to 4 in detecting sulfonamide pollutants.