Molecular marker of wheat taSDH-2D gene and application thereof

Abstract

The application discloses a molecular marker of a wheat TaSDH-2D gene and application thereof, and belongs to the technical field of crop selection and cultivation. TM After analysis, the haplotype of the wheat TaSDH-2D gene is divided into TaSDH-2D-Hapl I and TaSDH-2D-Hapl II, the former has a significantly reduced spike stem length, and the kernel density, thousand-grain weight and yield per plant are all significantly improved, and is an excellent genotype of the wheat TaSDH-2D gene. The application has the advantages that a new tool is provided for genetic improvement of wheat yield-related traits, a new method is provided for wheat marker-assisted selection breeding, and the application has important significance for cultivating high-yield wheat varieties.

Description

Technical Field

[0001] The present invention relates to molecular markers and applications thereof, in particular to molecular markers of wheat TaSDH-2D gene and applications thereof in identifying wheat yield-related traits, belonging to the technical field of crop seed selection and breeding. Background Art

[0002] wheat( Triticum aestivum Wheat (L.) is one of the world's three major staple crops, and increasing wheat yield is a key focus of current wheat breeding. Spike length and grain density are key agronomic traits influencing wheat yield. Spike length plays a crucial role in shaping the ideal plant and ear shape of wheat. Excessive spike length can cause the ear to bend, leading to a significant decrease in yield and quality. To date, extensive research has been conducted on wheat ear traits using various populations, but relatively little research has been conducted on spike length and grain density. Identifying genes associated with spike length and grain density in wheat and developing reliable molecular markers will provide effective genetic resources for wheat genetic improvement and breeding. Summary of the Invention

[0003] The purpose of the present invention is to provide a molecular marker of wheat TaSDH-2D gene and its application, so as to provide gene resources and effective approaches for the genetic improvement of wheat yield-related traits.

[0004] In order to achieve the above objectives, the present invention adopts the following technical solutions:

[0005] The invention discloses a molecular marker of the wheat TaSDH-2D gene, which is a KASP marker and is obtained by amplifying a KASP marker primer set. The KASP marker primer set consists of two front primers 25002-X and 25002-Y and a back primer 25002-C. The nucleotide sequence of the front primer 25002-X is shown in SEQ ID NO: 3, the nucleotide sequence of the front primer 25002-Y is shown in SEQ ID NO: 4, and the nucleotide sequence of the back primer 25002-C is shown in SEQ ID NO: 5. The 5' end of the front primer 25002-X is labeled with a FAM fluorescent group, and the 5' end of the front primer 25002-Y is labeled with a HEX fluorescent group. The fluorescent signal of the KASP marker is detected by KlusterCaller. TM After software analysis, when the result is blue, the haplotype of the wheat TaSDH-2D gene is TaSDH-2D-Hapl I, and when the result is red, the haplotype of the wheat TaSDH-2D gene is TaSDH-2D-Hapl II.

[0006] The application of the molecular markers of the aforementioned wheat TaSDH-2D gene in identifying wheat spike stem length and grain density showed that compared with the TaSDH-2D-Hapl II type, the spike stem length of the TaSDH-2D-Hapl I type was significantly reduced and the grain density was significantly increased. The TaSDH-2D-Hapl I type is an excellent genotype of the wheat TaSDH-2D gene.

[0007] The application of the aforementioned molecular markers of the wheat TaSDH-2D gene in identifying wheat thousand-grain weight and yield per plant showed that compared with the TaSDH-2D-Hapl II type, the thousand-grain weight and yield per plant of the TaSDH-2D-Hapl I type were significantly improved. The TaSDH-2D-Hapl I type is an excellent genotype of the wheat TaSDH-2D gene.

[0008] The present invention is beneficial in that:

[0009] (1) Based on the genetic variation analysis of the TaSDH-2D gene in natural wheat populations, this paper explored its superior alleles and developed KASP markers that can be used to identify wheat yield-related traits such as spike length, grain density, 1000-grain weight, and yield per plant, providing a new tool for the genetic improvement of wheat yield-related traits.

[0010] (2) The KASP marker developed in this invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance for breeding high-yield wheat varieties;

[0011] (3) By applying the KASP marker developed by the present invention, it is possible to predict whether a wheat variety contains the superior allele of the TaSDH-2D gene (TaSDH-2D-Hapl I), thereby predicting wheat yield-related traits. This not only saves costs but also greatly improves selection efficiency, providing new possibilities for efficiently screening the superior allele of the TaSDH-2D gene and breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a schematic diagram of the mutation site and haplotype analysis of the wheat TaSDH-2D gene;

[0013] Figure 2 This is the KASP marker genotyping diagram of some wheat TaSDH-2D genes, where blue represents CC, red represents AA, green represents heterozygous, and gray represents invalid results;

[0014] Figure 3 This is the result of the association analysis between the haplotype of wheat TaSDH-2D gene and 1000-grain weight. ** indicates P <0.01;

[0015] Figure 4 This is the result of the association analysis between the haplotype of wheat TaSDH-2D gene and the yield per plant. ** indicates P <0.01, NS indicates no statistical significance. DETAILED DESCRIPTION

[0016] The present invention will be described in detail below with reference to the accompanying drawings and examples. Unless otherwise specified, the experimental methods used in the examples are conventional methods.

[0017] 1. Obtaining polymorphic sites of the wheat TaSDH-2D gene

[0018] In the early stage of the present invention, based on genome-wide association analysis, a site significantly associated with the stable stem length and grain density of wheat spikelets was detected on wheat chromosome 2D. Based on gene function annotation, expression analysis and network analysis of the localized interval, two highly reliable candidate genes were predicted. One of the genes encodes secoisolariciresinol dehydrogenase (SDH), named TaSDH-2D gene. This gene is highly expressed in wheat roots, stems and spikes. Its genomic sequence is shown in SEQ ID NO: 1, and its CDS sequence is shown in SEQ ID NO: 2.

[0019] Combined with the resequencing data of 2789 hexaploid wheat accessions in the Wheat Genome Joint Variation Database, sequence polymorphism analysis was performed on the promoter and gene regions of the wheat TaSDH-2D gene. Figure 1 As shown, two SNP variations were found in the promoter region (SNP1 base is G / A, SNP2 base is C / A, the physical positions of which are 24868698 and 24869126 respectively in the Chinese Spring reference genome sequence RefSeq v2.1), containing two haplotypes, namely TaSDH-2D-Hapl I and TaSDH-2D-Hapl II.

[0020] 2. Development of molecular markers and haplotype identification for the wheat TaSDH-2D gene

[0021] 1. KASP Marker Development

[0022] Based on the SNP2 site variation of the wheat TaSDH-2D gene, a KASP marker primer set was developed to distinguish the base variation (C / A) at the SNP2 site.

[0023] The primer set consists of two front primers (25002-X, 25002-Y) and one back primer (25002-C). The nucleotide sequences of each primer are as follows:

[0024] 25002-X: GAAGGTGACCAAGTTCATGCTCCTCTAGTCTAGGGAATAGACAC (SEQ ID NO: 3);

[0025] 25002-Y:GAAGGTCGGAGTCAACGGATTATTCCTCTAGTCTAGGGAATAGACAA (SEQ ID NO: 4);

[0026] 25002-C:TCCAGGTTTTTAATCAAGTTTCTTTCAAAAA (SEQ ID NO: 5).

[0027] In order to enable the PCR amplification product to be detected by a microplate reader, the 5' end of the forward primer (25002-X) shown in SEQ ID NO: 3 was labeled with a FAM fluorescent group, and the 5' end of the forward primer (25002-Y) shown in SEQ ID NO: 4 was labeled with a HEX fluorescent group.

[0028] The genomic DNA of the wheat to be tested is used as a template and the KAPS marker primer set after the above labeling is used to perform a PCR amplification reaction to obtain the KASP marker.

[0029] 2. Genotype identification

[0030] (1) PCR amplification

[0031] PCR amplification was performed using the genomic DNA of 245 wheat varieties to be tested as templates using the labeled KAPS primer set described above. The reaction system and amplification procedure are as follows:

[0032] The reaction volume was 5.07 μL and contained 2.5 μL of DNA template (30 ng / μL), 2.5 μL of KASP Master Mix (LGC Genomics, Hoddeston, UK), and 0.07 μL of KASP Assay Mix. The KASP Assay Mix was prepared by combining 12 μL of 100 μM labeled 25002-X, 12 μL of 100 μM labeled 25002-Y, and 30 μL of 100 μM 25002-C, and then adding ddH2O to make up to 100 μL.

[0033] Amplification program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 65°C-55°C for 60 s, 10 cycles, decreasing the temperature by 0.6°C per cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 26 cycles, and insulation at 10°C.

[0034] (2) Fluorescence signal scanning and analysis

[0035] The fluorescence signal of the PCR amplification product of the wheat to be tested was collected by an enzyme-labeled instrument and KlusterCaller TM The software analyzes the fluorescence signal according to KlusterCaller TM The software's analysis results (red / blue / green / gray) determine the genotype of the wheat TaSDH-2D gene to be tested. The specific determination method is as follows:

[0036] (i) If KlusterCaller TM If the software analysis result is blue, the base of the SNP2 site of the wheat TaSDH-2D gene to be tested is C, the genotype of the wheat TaSDH-2D gene to be tested is CC, and the haploid is recorded as TaSDH-2D-Hapl I (the nucleotide sequence of the target fragment is shown in SEQ ID NO: 6);

[0037] (ii) If KlusterCaller TM If the software analysis result is red, the base of the SNP2 site of the wheat TaSDH-2D gene to be tested is A, the genotype of the wheat TaSDH-2D gene to be tested is AA, and the haploid is recorded as TaSDH-2D-Hapl II (the nucleotide sequence of the target fragment is shown in SEQ ID NO: 7);

[0038] (iii) If KlusterCaller TM If the software analysis result is green, the wheat TaSDH-2D gene to be tested is a heterozygous gene;

[0039] (iv) If KlusterCaller TM If the analysis result of the software is gray, it is an invalid result.

[0040] KlusterCaller for some wheat TM The software analysis results are shown in Figure 2 The results of KASP marker amplification detection for all 245 natural wheat populations are shown in Tables 1-1, 1-2, 1-3, 1-4, 1-5 and 1-6.

[0041] Table 1-1 TaSDH-2D genotyping results in natural wheat populations

[0042]

[0043] Table 1-2 TaSDH-2D genotyping results in natural wheat populations

[0044]

[0045] Table 1-3 TaSDH-2D genotyping results in natural wheat populations

[0046]

[0047] Table 1-4 TaSDH-2D genotyping results in natural wheat populations

[0048]

[0049] Table 1-5 TaSDH-2D genotyping results in natural wheat populations

[0050]

[0051] Table 1-6 TaSDH-2D genotyping results in natural wheat populations

[0052]

[0053] 3. Association analysis between wheat TaSDH-2D gene haplotypes and yield-related traits

[0054] Yield-related traits were identified across three environments over two years (E1: Pula Valley Experimental Base, Laishan District, Yantai, 2020; E2: Experimental Base, College of Horticulture, Ludong University, Zhifu District, Yantai, 2021; E3: Experimental Station, Luancheng, Shijiazhuang, 2021). The best linear unbiased estimator (BLUE) for each trait was calculated using the lme4 R package. A genome-wide association study was performed using the generalized linear model (GLM) in the GAPIT R package, combined with 245 wheat 55K microarrays and haplotypes of the TaSDH-2D gene.

[0055] The results of association analysis between haplotypes of wheat TaSDH-2D gene and spike length and grain density are shown in Table 2-1 and Table 2-2.

[0056] Table 2-1 Results of association analysis between haplotypes of wheat TaSDH-2D gene and spike length

[0057]

[0058] Note: BLUE3 represents the best linear unbiased estimate of each trait under three environments; * represents P <0.05, ** indicates P <0.01.

[0059] Table 2-2 Association analysis results between haplotypes of wheat TaSDH-2D gene and grain density

[0060]

[0061] Note: BLUE3 represents the best linear unbiased estimate of each trait under three environments; * represents P <0.05, ** indicates P <0.01.

[0062] It can be seen from Table 2-1 and Table 2-2 that the wheat TaSDH-2D gene is significantly correlated with wheat spike length and grain density; compared with TaSDH-2D-Hapl II, the spike length of TaSDH-2D-Hapl I was significantly reduced by 27.9%-35.5%, and the grain density was significantly increased by 5.5%-12.1%.

[0063] In addition, the present invention also conducted an association analysis between the haplotype of wheat TaSDH-2D gene and 1000-grain weight and yield per plant. Figure 3 , and the results of the correlation analysis with single plant yield are shown in Figure 4 .

[0064] Depend on Figure 3 and Figure 4 It can be seen that the wheat TaSDH-2D gene is significantly correlated with wheat 1000-grain weight and yield per plant; compared with TaSDH-2D-Hapl II, the 1000-grain weight of TaSDH-2D-Hapl I was significantly increased by 6.6%-8.2%, and the yield per plant was significantly increased by 4.6%-9.7%.

[0065] The above results indicate that TaSDH-2D-Hapl I is an excellent genotype of the wheat TaSDH-2D gene, and the KAPS marker primer set (25002-X, 25002-Y, and 25002-C) developed in the present invention has important application value for improving wheat yield-related traits.

[0066] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. Molecular marker of wheat TaSDH-2D gene, characterized in that: The molecular marker is a KASP marker, which is amplified by a KASP marker primer set using genomic DNA of wheat to be tested as a template. The nucleotide sequence of the KASP marker is shown in SEQ ID NO: 6 or SEQ ID NO:

7. The KASP marker primer set consists of two front primers 25002-X and 25002-Y and a back primer 25002-C. The nucleotide sequence of the front primer 25002-X is shown in SEQ ID NO: 3, the nucleotide sequence of the front primer 25002-Y is shown in SEQ ID NO: 4, and the nucleotide sequence of the back primer 25002-C is shown in SEQ ID NO:

5. The 5' end of the front primer 25002-X is labeled with a FAM fluorescent group, and the 5' end of the front primer 25002-Y is labeled with a HEX fluorescent group. The fluorescent signal of the KASP marker is detected by KlusterCaller TM After software analysis, when the result is blue, the nucleotide sequence of the KASP marker is shown as SEQ ID NO: 6, and the haplotype of the wheat TaSDH-2D gene is TaSDH-2D-Hapl I; when the result is red, the nucleotide sequence of the KASP marker is shown as SEQ ID NO: 7, and the haplotype of the wheat TaSDH-2D gene is TaSDH-2D-Hapl II.

2. A method for predicting wheat spike length and grain density, characterized in that: The molecular marker of the wheat TaSDH-2D gene according to claim 1 is used to identify the haplotype of the wheat TaSDH-2D gene. Compared with the TaSDH-2D-Hapl II type, the wheat of the TaSDH-2D-Hapl I type has a shorter spike length and a higher grain density.

3. A method for predicting wheat thousand-grain weight and single-plant yield, characterized in that: The haplotype of the wheat TaSDH-2D gene is identified using the molecular marker of the wheat TaSDH-2D gene according to claim 1. Compared with the TaSDH-2D-Hapl II type, the wheat of the TaSDH-2D-Hapl I type has a higher thousand-grain weight and single-plant yield.

Images