Construction method of alzheimer's disease model pig based on endogenous multi-gene editing

Abstract

The present application relates to the technical field of gene editing, in particular to a construction method of an Alzheimer's disease model pig based on endogenous multi-gene editing. APP KM652 / 653NL 、 PSEN1 M143L and TAU P300L PegRNA and nick-sgRNA of the site, using an optimized editing system, achieving simultaneous precise editing of three endogenous gene sites in pigs, successfully obtaining an Alzheimer's disease model pig based on endogenous multi-gene simultaneous editing. The cloned pig can reproduce the characteristic Aβ deposition gene and Tau protein hyperphosphorylation double pathology phenotype of Alzheimer's disease, and can be applied to drug screening, pathological mechanism research, target verification and biomarker development of Alzheimer's disease, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to a method for constructing a pig model of Alzheimer's disease based on endogenous multi-gene editing. Background Technology

[0002] Alzheimer's disease (AD) is one of the most common neurodegenerative diseases, seriously threatening the health of the elderly. Its typical pathological features include the abnormal aggregation of β-amyloid (Aβ) in the brain to form plaques, as well as hyperphosphorylation of tau protein and neurofibrillary tangles. Currently, there is no cure for AD, and reliable animal models are urgently needed to elucidate its etiology and conduct drug screening.

[0003] Existing animal models of Alzheimer's disease (AD) mainly focus on rodents, especially mouse models. A typical example is the APP model constructed by Hsiao et al. in 1996. KM670 / 671NL Transgenic mouse model (Hsiao K, et al. Correlative memory deficits, Abeta elevation, and amyloid plaques in transgenic mice). Science . 1996, 274(5284):99-102.), this model can produce Aβ deposition in the brain, but does not have other key pathological features such as neuronal loss; subsequently, there was the 3xTg-AD (APP / PSEN1 / TAU triple gene) mouse model (Oddo S, et al. Triple-transgenic model of Alzheimer's disease with plaques and tangles: intracellular Abeta and synaptic dysfunction, Neuron Although the mouse model better simulates the coexistence of Aβ and Tau pathology, its pathogenesis and progression differ significantly from those of human AD. In addition, the mouse model has disadvantages such as large species differences, significant differences in brain structure, and differences in immune system and drug metabolism system between the two, resulting in a low clinical conversion rate when evaluating the efficacy of AD drugs.

[0004] Large animals (especially pigs) are closer to humans in brain anatomy, physiological function, immune system, and lifespan, making them a more promising model platform for neurodegenerative diseases. In recent years, studies have reported the use of CRISPR / Cas9 or transgenic strategies to construct pig models of Alzheimer's disease, such as Jakobsen et al. (Generation of minipigs with targeted transgene insertion by recombinase-mediated cassette exchange (RMCE) and somatic cell nuclear transfer (SCNT)). Transgenic Res ,2013, 22:163-171.; Jakobsen JE, et al. Expression of the Alzheimer's DiseaseMutations AβPP695sw and PSEN1M146I in Double-Transgenic G¨ottingen Minipigs, J Alzheimers Dis , 2016, 54:803-815) and Lee K, et al. Production of transgenic pig as an Alzheimer's disease model using a multi-cistronic vectorsystem, PLoS One , 2017, 12:e0177935.). Most of these models involve carrying AD-related mutations (such as APP). KM670 / 671NL Or PSEN1 M146I Human expression cassettes (such as those from CMV) are integrated into the pig genome and overexpressed using strong promoters (such as CMV), thereby inducing Aβ protein deposition. However, these "human transgenic" models generally have significant drawbacks: First, the edited target is an exogenous human mutant gene, which cannot reflect the endogenous mutant background in pigs; second, they usually rely on strong promoters to drive gene overexpression, leading to uncontrolled expression levels and potentially non-physiological phenotypes; third, human proteins and endogenous pig proteins differ in structure and processing methods, affecting functional accuracy; and fourth, existing models mostly only show Aβ deposition and cannot simultaneously reproduce the pathological features of Tau protein hyperphosphorylation, lacking a complete molecular phenotype reproduction.

[0005] To address the aforementioned issues, directly editing endogenous sites in pigs is a more ideal approach. However, current CRISPR-Cas9-based homology-directed repair (HDR) technology is inefficient (typically <1%) in simultaneous multi-gene editing and struggles to avoid unintended insertion / deletion mutations.

[0006] PE (Programming Precision Editing) technology is a new generation of gene editing tool based on the SpCas9 nickase (nCas9) and reverse transcriptase fusion protein (RT). PE utilizes a customized guide RNA (pegRNA) to carry the editing template, guiding nCas9 to target the target site. This triggers RT to activate the reverse transcription reaction, converting the pegRNA-carrying editing template into a cDNA sequence. By introducing an additional nick-sgRNA to target the non-edited strand, a nick is created, activating the cell's DNA repair mechanism. Subsequently, through cellular repair, precise base substitution, insertion, or deletion is achieved at the target site. This method eliminates the need for DNA double-strand breaks and external donor DNA templates, greatly improving the flexibility and safety of editing. More importantly, PE can design multiple pegRNAs plus nick-sgRNAs targeting complementary strands to achieve simultaneous and precise editing of multiple gene sites, theoretically possessing the potential to construct complex multi-gene disease models. Summary of the Invention

[0007] In order to overcome the shortcomings and drawbacks of existing Alzheimer's disease pig model construction methods, such as unstable exogenous expression, random insertion of sites, and inaccurate models, the primary objective of this invention is to provide a PE editing system based on synchronous editing of endogenous multiple genes.

[0008] Another object of the present invention is to provide an application of the above-mentioned PE editing system.

[0009] Another object of the present invention is to provide a recombinant expression vector for pegRNA or nick-sgRNA.

[0010] The fourth objective of this invention is to provide an Alzheimer's disease cell line based on endogenous multi-gene synchronous editing.

[0011] The fifth objective of this invention is to provide a method for constructing a pig model of Alzheimer's disease based on endogenous multi-gene editing.

[0012] The objective of this invention is achieved through the following technical solution:

[0013] A PE editing system based on simultaneous endogenous multi-gene editing, comprising components targeting pigs... APP KM652 / 653NL , PSEN1 M143L and TAU P300LpegRNA and nick-sgRNA at the site; among them, those targeting APP KM652 / 653NL The site, the nucleotide sequence of the pegRNA is shown in SEQ ID NO: 1; for PSEN1 M143L The site, the nucleotide sequence of the pegRNA is as shown in SEQ ID NO: 2; targeting TAU P300L The nucleotide sequence of the pegRNA is shown in any one of SEQ ID NO: 3-5; the nucleotide sequence of the nick-sgRNA is shown in SEQ ID NO: 6-8.

[0014] against TAU P300L The preferred nucleotide sequence of the pegRNA is shown in SEQ ID NO: 5.

[0015] The PE editing system preferably further includes at least one of a PE editor, Nocodazole, and Puromycin.

[0016] The PE editor mentioned is not limited to pvPE-V3 and pvPE-V3-Puro, but can also be other types of PE editors with pilot editing functions, such as PEmax, PE6c, PE6d, PE7, pvPE-V4 or related variants.

[0017] The application of the PE editing system in the preparation of Alzheimer's disease cell lines or Alzheimer's disease model pig products.

[0018] A recombinant expression vector is obtained by linking pegRNA or nick-sgRNA from the PE editing system described above to a vector backbone.

[0019] The vector backbone is pU6-pegRNA-GG-acceptor or pGL3-U6-sgRNA-EGFP, or other types of expression vectors capable of completely transcribing the pegRNA and nick-sgRNA sequences.

[0020] The method for constructing the recombinant expression vector includes the following steps:

[0021] (1) Based on the pegRNA and nick-sgRNA sequences in the above PE editing system, design and synthesize pegRNA-Spacer, pegRNA 3'-extension (PBS+RTT sequence), sgRNA scaffold and nick-sgRNA forward and reverse primers with terminal linker sequences, and anneal them respectively;

[0022] (2) The annealed products of pegRNA-Spacer, pegRNA 3'-extensions and gRNA scaffold obtained in step (1) are linked with the linearized pegRNA vector backbone to obtain a pegRNA recombinant expression vector.

[0023] (3) The annealing product of nick-sgRNA obtained in step (1) is linked to the linearized nick-sgRNA vector backbone to obtain the nick-sgRNA recombinant expression vector.

[0024] An Alzheimer's disease cell line based on simultaneous endogenous multi-gene editing was constructed using the following method:

[0025] The above-mentioned pegRNA recombinant expression vector, nick-sgRNA recombinant expression vector, and PE editor were transformed into cells to obtain an Alzheimer's disease cell line based on simultaneous editing of endogenous multiple genes.

[0026] The pegRNA recombinant expression vector, nick-sgRNA recombinant expression vector, and PE editor described herein can be introduced into cells via electroporation; or delivered using the following alternative methods:

[0027] (1) PE system RNA synthesized in vitro (including transcripts of pegRNA and nick-sgRNA).

[0028] (2) Pre-assembled ribonucleoprotein complex (RNP, containing PE editor protein and RNA component).

[0029] The cells mentioned are not limited to porcine fetal fibroblasts (PFF), but may also include other porcine cells suitable for somatic cell nuclear transfer (SCNT), including but not limited to porcine ear fibroblasts, porcine kidney cells or porcine pluripotent stem cells.

[0030] The method for constructing an Alzheimer's disease cell line based on simultaneous endogenous multi-gene editing includes the following steps:

[0031] (1) will target APP KM652 / 653NL site, PSEN1 M143L and TAU P300L The pegRNA recombinant expression vector and nick-sgRNA recombinant expression vector at the three sites, PE editor and electroporation buffer were mixed and added to the cells to obtain a cell suspension;

[0032] (2) Electroporate the cell suspension from step (1);

[0033] (3) After electroporation, the cells were cultured in complete medium for 6-10 h; then replaced with fresh medium containing Nocodazole and cultured for 24-48 h; then replaced with fresh medium containing puromycin and cultured for 24-48 h for screening, and then single-clonal cell culture and identification were performed to obtain Alzheimer's disease cell lines based on endogenous multi-gene synchronous editing.

[0034] The preferred mass ratio of the pegRNA recombinant expression vector, nick-sgRNA recombinant expression vector, and PE editor in step (1) is 1:1:2.

[0035] The concentration of Nocodazole in the fresh culture medium containing Nocodazole described in step (3) is preferably (100-1000) ng / mL.

[0036] The concentration of puromycin in the fresh culture medium containing puromycin described in step (3) is preferably 2-3 μg / mL.

[0037] The preferred specific operation for monoclonal cell culture in step (3) is as follows:

[0038] After screening with puromycin, cells were digested and cultured using the single-cell dilution method to obtain monoclonal cell populations.

[0039] The culture medium is preferably a high-glucose DMEM medium containing 15% (v / v) fetal bovine serum and 1% (v / v) penicillin and streptomycin;

[0040] A pig model of Alzheimer's disease based on endogenous multi-gene editing was constructed from the aforementioned Alzheimer's disease cell line based on simultaneous endogenous multi-gene editing.

[0041] The method for constructing an Alzheimer's disease model pig based on endogenous multi-gene editing includes the following steps:

[0042] Using the Alzheimer's disease cell line based on the above-mentioned endogenous multi-gene synchronous editing as the donor cell and the oocyte as the recipient cell, somatic cell nuclear transfer was performed to obtain reconstructed embryos; the reconstructed embryos were then transferred to surrogate sows through embryo transfer surgery to obtain Alzheimer's disease model pigs.

[0043] The principle of this invention:

[0044] This invention provides a PE editing system based on Prime Editing (PE) technology, which enables the editing of endogenous substances in pigs. APP KM652 / 653NL , PSEN1 M143L and TAU P300LSimultaneous and precise editing of three sites resulted in an AD model pig exhibiting both elevated Aβ and Tau protein phosphorylation, two core pathological phenotypes of Alzheimer's disease. This model can be applied to research on the pathogenesis of Alzheimer's disease, drug screening, target validation, and biomarker development. This invention improves editing efficiency and reduces off-target risks through screening pegRNA / nick-sgRNA sequences, improving and optimizing the PE editor, and leveraging the synergistic effect of small molecule drugs, achieving precise editing as follows:

[0045] (1) Screening of efficient pegRNA / nick-sgRNA sequences: Targeting common pathogenic mutation sites in three Alzheimer's disease-related genes, APP, PSEN1 and TAU, this invention designs multiple pegRNAs and a universal nick-sgRNA sequence, and constructs their recombinant expression vectors by Bsa I restriction enzyme digestion, ligation and transformation; then, the PE editor and pegRNA recombinant expression plasmid or pegRNA recombinant expression plasmid + nick-sgRNA recombinant expression plasmid are transfected into porcine fetal fibroblasts (PFFs). High-throughput sequencing is used to identify the efficiency of pegRNA editing target sites, screen the best pegRNA for each site, and test the efficiency of the best combination of pegRNA and nick-sgRNA. The results show that the best combination of pegRNA and nick-sgRNA can significantly improve editing efficiency.

[0046] (2) Improvement and optimization of the PE editor: This invention uses an engineered porcine endogenous retrovirus (PERV) reverse transcriptase (RT) and Cas9n to form an optimized PE editor (pvPE-V3-Puro). This PE editor significantly improves editing efficiency and reduces off-target risk compared to the traditional MMLV-RT.

[0047] (3) Synergistic effect of screening reagents: In this invention, pvPE-V3-Puro and pegRNA recombinant expression plasmids corresponding to the three mutation sites and nick-sgRNA recombinant expression plasmids are introduced into PFF cells by electroporation, and the small molecule drugs Nocodazole and puromycin are used for screening, which can further significantly improve the editing efficiency.

[0048] After electroporation and drug screening, a single-cell dilution method was used to obtain a monoclonal cell population. Successfully edited clones were confirmed by PCR amplification and Sanger sequencing. Cell clones with target mutations at all three sites were further selected for somatic cell nuclear transfer (SCNT), successfully obtaining live-born cloned piglets. This invention utilizes Guide-seq combined with deep sequencing to systematically analyze potential off-target sites for all pegRNA / nickRNA combinations, ensuring that the model pigs obtained by this invention have no significant off-target effects. Furthermore, molecular biological methods were used to detect the Aβ40 / 42 levels in the cerebrospinal fluid of the model pigs and the phosphorylation status of Tau protein in the hippocampus, confirming that the model pigs exhibited early molecular characteristics of Alzheimer's disease (AD).

[0049] In summary, compared with existing technologies, this invention provides an efficient, safe, and scalable technical solution for constructing AD model pigs, and establishes a model system with two typical pathological features: Aβ and phosphorylated Tau. This provides a valuable new model for future research on human Alzheimer's disease. Compared with traditional methods of constructing AD models through exogenous transgenesis, this invention focuses on editing key endogenous pathogenic mutation sites in pigs to reconstruct an AD model pig system with greater physiological relevance and genetic stability. This method is the first to achieve... APP KM652 / 653NL , PSEN1 M143L and TAU P300L Simultaneous and precise editing of three endogenous sites.

[0050] The present invention has the following advantages and effects compared with the prior art:

[0051] (1) This invention provides a PE editing system based on simultaneous editing of endogenous multiple genes, which includes highly efficient targeted editing. APP KM652 / 653NL , PSEN1 M143L and TAU P300L The combination of pegRNA and nick-sgRNA from three endogenous sites can be used to construct Alzheimer's disease cell lines and pig models, enabling simultaneous and precise editing of three gene loci.

[0052] (2) This invention utilizes the PE editing system combined with engineered porcine endogenous retrovirus reverse transcriptase and Cas9n to form an optimized PE editor, which for the first time achieves the synchronous and precise editing of multiple Alzheimer's disease-related genes in pigs, avoiding the expression fluctuation problem of traditional exogenous expression systems, and has the advantages of high editing efficiency and high genome safety.

[0053] (3) In the screening process, the present invention uses the small molecule drug Nocodazole and the puromycin drug as screening reagents. The combined use of the two has a significant synergistic effect and can significantly improve the screening efficiency.

[0054] (4) The Alzheimer's disease model pigs constructed in this invention truly simulate the two core pathological features of AD at the molecular level and have higher clinical relevance.

[0055] (5) The Alzheimer’s disease cell line and model pigs constructed in this invention can be used for drug screening, pathological mechanism research, target verification and biomarker development of Alzheimer’s disease, with broad application prospects. Attached Figure Description

[0056] Figure 1 It is a target APP KM652 / 653NL , PSEN1 M143L and TAU P300L The results of the analysis of the effects of different pegRNAs and the optimal pegRNA + nick-sgRNA combination on the efficiency of single-site gene editing are shown in the figure.

[0057] Figure 2 This is a schematic diagram of the target site mutation pattern and the structure of the optimal pegRNA and nick-RNA.

[0058] Figure 3 This is a schematic diagram of the structure of pvPE-V3 and pvPE-V3-Puro carriers.

[0059] Figure 4 This is a graph showing the results of single-target gene editing effects of the Nocodazole + Purinemycin editing system.

[0060] Figure 5 yes APP KM652 / 653NL , PSEN1 M143L and TAU P300L Sequencing results of monoclonal cells (clone 19 and clone 38) that were successfully edited simultaneously at three target sites.

[0061] Figure 6 This is a display image of a cloned pig successfully obtained after embryo transfer.

[0062] Figure 7 This is a sequence of sequencing results for three target sites in cloned pigs and wild-type pigs.

[0063] Figure 8 This is an analysis diagram of off-target sites detected by Guide-seq technology.

[0064] Figure 9 This is a graph showing the off-target effects of Sanger sequencing on three randomly selected cloned pigs to detect potential off-target sites.

[0065] Figure 10 This is an analysis of the Aβ levels in the cerebrospinal fluid of cloned and wild-type pigs.

[0066] Figure 11 This is an analysis of the TAU phosphorylation levels in the hippocampus of cloned and wild-type pigs. Detailed Implementation

[0067] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0068] PFF cell complete culture medium: Add 60 mL fetal bovine serum (EcoSy, FSD500) and 5.6 mL penicillin-streptomycin antibiotics (Gibco, 15070063) to 500 mL high glucose DMEM culture medium (Gibco, 11995-073), and store at 4℃ for later use.

[0069] Maturation culture medium: based on TCM-199 (Gibco, 31100027), with the addition of 0.1 mg / mL cysteine ​​(Sigma, C7880), 1 mM pyruvate (Sigma, 107360), 10% porcine follicular fluid and 10 ng / mL epidermal growth factor (EGF, Sigma, E4127).

[0070] Calcium-free HN23 micromanipulation solution: Dissolve 0.7965 g NaCl, 0.0168 g NaHCO3, 0.0358 g KCl, 0.0162 g KH2PO4, 0.0293 g MgSO4·7H2O, 0.1 g D-glucose, 0.0146 g glutamine, 0.15012 g taurine, 0.2335 g tyrosine, 0.4 g bovine serum albumin (BSA), 0.0065 g penicillin, and 0.005 g streptomycin in ultrapure water, adjust the pH to 7.2-7.4, bring the volume to 100 mL, filter through a 0.22 μm filter, and store at 4℃ for later use. All reagents were purchased from Sigma.

[0071] NCSU-23 basic culture medium: Take 300 mL of ultrapure water and add 3.178 g NaCl, 1.053 g NaHCO3, 0.178 g KCl, 0.081 g KH2PO4, 0.147 g MgSO4·7H2O, 0.125 g CaCl2·2H2O, 0.500 g D-glucose, 0.073 g glutamine, 0.438 g taurine, 0.273 g tyrosine, 0.033 g penicillin, and 0.025 g streptomycin in sequence. Adjust the pH to 7.2-7.4 and bring the volume to 500 mL. Filter through a 0.22 μm filter and dispense for later use. All reagents were purchased from Sigma.

[0072] Embryo culture medium: Take 20 mL of NCSU-23 basal culture medium, add 200 mg of fatty acid-free bovine serum albumin (BSA, Sigma, A8806), and gently stir until completely dissolved. Then, bring the volume to 50 mL with NCSU-23 basal culture medium. Filter the mixture through a 0.22 μm filter for sterilization, aliquot, and store at 4°C for later use.

[0073] Example 1: Design and Optimization of Gene Editing System

[0074] 1.1 Design and Validation of Gene Editing Systems

[0075] (1) pegRNA design

[0076] pegRNA has a decisive impact on PE editing efficiency. This invention employs four schemes, namely targeting... APP KM652 / 653NL , PSEN1 M143L and TAU P300L Four pegRNAs were designed with mutations (Table 1), as detailed below:

[0077] pegRNA1: Use the PrimeDesign online website (https: / / drugthatgene.pinellolab.partners.org / ) to select the pegRNA sequence recommended by the website;

[0078] pegRNA2: Use the pegFinder online website (http: / / pegfinder.sidichenlab.org / ) to select the pegRNA sequence recommended by the website;

[0079] pegRNA3: Use the Pridict online website (http: / / www.pridict.it / ) to select the highest-rated pegRNA.

[0080] pegRNA4: First, set the PBS and RTT of the pegRNA to 13 nt and 12 nt, respectively, and then dynamically adjust them according to specific sequence characteristics. Specifically: For the PBS sequence, if its GC content is >60%, adjust it to 11 nt or 9 nt; if the GC content of the PBS is <40%, adjust it to 15 nt, so that the GC content of the PBS is kept as close as possible to 40%~60%; for the RTT, it is preferred that the last base of the 3' end is a G or T base, and that it has at least 5 nt homology with the cleavage site.

[0081] Table 1. pegRNA sequences designed and tested in this invention.

[0082]

[0083] Note: Uppercase italics represent pegRNA-Spacer sequences, lowercase represents sgRNA scaffold sequences, underline represents pegRNA 3'-extension sequences (PBS+RTT sequences), and lowercase letters in underline represent edit sites.

[0084] (2) Nick RNA design

[0085] Using the PrimeDesign online website (https: / / drugthatgene.pinellolab.partners.org / ), nick-sgRNAs complementary to the pegRNA target strand were selected for each site, with preference given to nick-sgRNAs that were close to the target and targeted the edited sequence. The nick-RNA sequences obtained in this invention are as follows:

[0086] Targeted APP KM652 / 653NL The nick-sgRNA sequence is: 5'-TACACCACAGTCCAAACATG-3' (SEQ ID NO: 6);

[0087] Targeted PSEN1 M143L The nick-sgRNA sequence is: 5'-TGTCGTCCTGACTATTCTCC-3' (SEQ ID NO: 7);

[0088] Targeted Tau P300L The nick-sgRNA sequence is: 5'-GATAATATCAAACACGTGCT-3' (SEQ ID NO: 8).

[0089] 1.2 Construction of pegRNA and nick-sgRNA expression vectors

[0090] 1.2.1 Vector Enzyme Digestion Linearization

[0091] PegRNA vector backbone pU6-pegRNA-GG-acceptor (Addgene, #132777) and nick-sgRNA vector backbone pGL3-U6-sgRNA-EGFP (Addgene, #107721) were purchased from the Addgene plasmid sharing platform. These vectors were digested with enzymes. The specific digestion system (30 μL) consisted of: 3 μL 10× CutSmart buffer (Neb, USA), 1 μL Bsa I restriction enzyme (Neb, USA), and 2 μg pU6-pegRNA-GG-acceptor or pGL3-U6-sgRNA-EGFP plasmid DNA, with ultrapure water added to a final volume of 30 μL. The mixture was then placed in a PCR instrument at 37°C for 2 h for digestion and 80°C for 15 min for inactivation. The digestion products were separated into target fragments using a 1.5% agarose gel, and purified using the Axypre DNA Gel Extraction Kit (Axgene) after gel excision.

[0092] 1.2.2 Carrier Connection

[0093] (1) Primer annealing: Based on the above pegRNA and nick-sgRNA, a synthesis company was commissioned to synthesize guide sequences (spacer), backbone sequences (scaffold), reverse transcription primer binding sites (PBS), and reverse transcription templates (RTT) with editing sites (Table 2). Then, the pegRNA-Spacer, pegRNA 3'-extension (PBS+RTT sequence), sgRNA scaffold, and nick-sgRNA forward and reverse primers with end-linking sequences were annealed into double strands. The specific annealing system (25 μL) was as follows: 2.5 μL of 10×T4 Ligation Buffer, 1 μL each of 100 μM forward primer F and reverse primer R, and ultrapure water to make up to 25 μL. The EP tube containing this system was sealed and placed in a beaker containing boiling water and slowly cooled at room temperature to obtain the corresponding annealed double strands.

[0094] Table 2 Primer sequences for constructing pegRNA and nick-sgRNA expression vectors

[0095]

[0096] Note: The lowercase letters at the 5' end are the connector sequence required for connection, and the lowercase letters in the 3' extension are the edit sequence for editing sites.

[0097] (2) Ligation of pegRNA: The pegRNA-Spacer annealing product, pegRNA 3'-extension annealing product, and sgRNA scaffold annealing product obtained in step (1) and the BsaI linearized pU6-pegRNA-GG-acceptor vector backbone were ligated. The ligation system is shown in Table 3. After the system was prepared, it was placed at room temperature for 10 min, then transferred to a PCR instrument for 16℃ for 5 min, 37℃ for 15 min (8 cycles), and finally inactivated at 80℃ for 15 min to obtain the pegRNA ligation product.

[0098] Table 3 pegRNA ligation system

[0099]

[0100] (3) Ligation of nick-sgRNA: The annealed nick-sgRNA product obtained in step (1) was ligated with the BsaI linearized pGL3-U6-sgRNA-EGFP vector backbone. The ligation system (10 μL) consisted of: 1 μL Quick Ligase buffer (Neb, USA), 1 μL Quick Ligase, 1 μL BsaI linearized pGL3-U6-sgRNA-EGFP vector backbone DNA and 1 μL nick-sgRNA annealed product. The ligation was carried out at room temperature for 15 min to obtain the nick-sgRNA ligation product, which was then stored in a -20℃ freezer.

[0101] 1.2.3 Preparation of high-purity plasmids

[0102] Take 5 μL of the pegRNA or nick-sgRNA ligation product obtained in step 1.2.2 and transform it into DH5α competent cells (Qingke Biotechnology, DLC114) according to the manufacturer's instructions. Spread the transformed cells on solid LB agar plates (each LB solid medium contains 10 g peptone, 5 g yeast extract, 10 g NaCl, 15 g agar powder, and 30 mg ampicillin) and incubate overnight at 37°C. Pick 6 clones corresponding to each pegRNA / nick-sgRNA and expand them in 1 mL of liquid LB medium. Take 500 μL and send it to Qingke Biotechnology Co., Ltd. for Sanger sequencing (sequencing primers: atggactatcatatgcttaccgta). Select the correctly ligated clones and add them to 200 mL of liquid medium. The cells were cultured overnight in LB liquid medium at 37°C using a shaker. DNA was extracted using a high-purity, endotoxin-free plasmid extraction kit (Takata, 9783) to obtain recombinant expression plasmids pU6-pegRNA-GG-acceptor-pegRNA1 / 2 / 3 / 4 and pGL3-U6-sgRNA-EGFP-nick-sgRNA targeting different sites.

[0103] 1.3 Testing and Optimization of PEGRNA / Nick-SgRNA Unit Site Editing Efficiency

[0104] 1.3.1 Obtaining primary PFF cells

[0105] After euthanasia, Bama fragrant sows at 31 days of gestation were dissected. The entire uterus was removed, and the fetuses were taken out one by one along with the fetal membranes. They were then transferred into DMEM (Gibco, 11995-073) solution containing 5% (v / v) penicillin-streptomycin (Gibco, 15070063) and stored at 4°C. In a clean bench, each isolated fetus was transferred individually to a sterile 10 cm culture dish. The head, internal organs, limbs, and tail of the fetus were removed using sterile forceps and scissors. The remaining parts of the fetus were cleaned with PBS solution (Gibco, 10010049) containing 5% (v / v) penicillin-streptomycin antibiotic solution. The remaining tissue was then minced and 5 mL of type IV collagenase working solution (Sigma, C5138) at a concentration of 200 U / mL was added. The mixture was transferred to a 15 mL sterile centrifuge tube and incubated at 37°C for 2 h. The centrifuge tube was then centrifuged at 1000 rpm for 5 min to remove the supernatant collagenase working solution. The incubated tissue pieces were then evenly transferred to two T75 culture dishes and cultured in complete PFF cell culture medium. The next day, the cell adhesion and separation from the cell tissue were observed under a microscope. When the cell proliferation and confluence reached more than 85%, the construction of the porcine primary PFF cell line was completed, and the cells were cryopreserved or passaged.

[0106] 1.3.2 Cell transfection

[0107] The primary PFF cells obtained in step 1.3.1 were placed in complete culture medium and cultured in a 37°C, 5% CO2 incubator. When the cell confluence reached 85-90%, the cells were digested with 0.25% trypsin (Sigma, T4049) and counted using a hemocytometer. 4 × 10⁻⁶ cells were collected from each electroporation reaction. 5 One cell was centrifuged in a 15 mL centrifuge tube at 200×g for 5 min. After discarding the supernatant, 20 μL of Entranster-E electroporation buffer (Engreen, 98668-20), 1 μg of pvPE-V3 editor, 0.5 μg of the recombinant plasmid pU6-pegRNA-GG-acceptor-pegRNA obtained in step 1.2.3, and 0.5 μg of the recombinant plasmid pGL3-U6-sgRNA-EGFP-nick-sgRNA obtained in step 1.2.3 were added. After mixing, the cell suspension was transferred to a 16-well electroporation strip and placed in the electroporation strip holder of a Lonza 4D-Nucleofector electroporator. The cells were electroporated twice consecutively using the CA-137 program. After electroporation, the cells were placed in a 6-well cell culture dish with complete culture medium and cultured for 3 days after replacing the complete culture medium 7 h later.

[0108] The pvPE-V3 editor is obtained by replacing the MMLV-RT element located at 4915-6966bp in the pCMV-PE2 editor (Addgene, #132775) with the NC (nucleocapsid) + PERV-RT-M7(ΔH) (engineered Bama miniature pig type C PERV reverse transcriptase) element (commercially synthesized and replaced by Nanjing Genscript Biotech Co., Ltd.). The pvPE-V3 editor specifically includes the elements CMV, Cas9 (H840A), NC, PERV-RT-M7(ΔH), nuclear localization signal, and PolyA tail (…). Figure 3 The nucleotide sequence (SEQ ID NO:101) of NC+PERV-RT-M7(ΔH) is shown below:

[0109]

[0110] 1.3.3 Editing Efficiency Test

[0111] 1.3.3.1 Cell DNA Acquisition

[0112] Cells cultured in step 1.3.2 were digested using 0.125% trypsin (Sigma, T4049), and then collected into 200 μL EP tubes. The cells were centrifuged at 750×g for 5 min, and the supernatant was removed using a vacuum aspirator. The cells were resuspended in 12 μL of cell lysis buffer (0.45% NP40 lysis buffer and 6% proteinase K) and placed in a PCR instrument. The reaction program was 56℃ for 1.5 h and 85℃ for 15 min to obtain cellular DNA.

[0113] 1.3.3.2 Target site amplification and high-throughput sequencing

[0114] Two rounds of PCR amplification were performed on the target site using the primers listed in Table 4. The first round of PCR amplified the target site, while the second round used tagged primers to label the samples. Both rounds of PCR used PrimeSTAR Max DNA Polymerase (Takara, R045A). The specific reaction system was: 8 μL PrimeSTAR Max Premix, 1 μL each of forward and reverse primers, 1 μL cellular DNA, and 5 μL ultrapure water. The PCR reaction conditions were: 94℃ for 5 min; (94℃ for 30 seconds, 68℃ (decreasing by 0.5℃ per cycle) for 30 seconds, 72℃ for 1 min) for 26 cycles; (94℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 1 min) for 14 cycles; 72℃ for 5 min. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for commercial library construction and sequencing.

[0115] Table 4 Primers for PE editing efficiency detection

[0116]

[0117] Note: Lowercase sequences are index sequences.

[0118] 1.3.3.3 Editing Efficiency Analysis

[0119] For each sample, the R1.fastq and R2.fastq sequencing files were analyzed for editing efficiency using CRISPResso2 (V2.0.43) software. Input parameters included ref_seq, pegRNA_spacer_seq, pegRNA_extension_pegRNA_scaffold_seq, and nicking_guide_seq; other parameters used default values. ref_seq was the reference sequence for PCR amplification, and pegRNA_extension_pegRNA_scaffold_seq was the complete sgRNA-scaffold sequence. The result interpretation criteria were: only "Prime-edited UNMODIFIED" types were considered precise editing products; other editing types (such as insertions, deletions, or mismatches) were considered non-specific editing byproducts.

[0120] This invention first involves transfecting different pU6-pegRNA-GG-acceptor-pegRNAs targeting different target sites into primary PFF cells. Figure 1 This graph shows the editing efficiency results of different pegRNAs targeting three sites. For the APP site, pegRNA3 showed the best efficiency among the four pegRNAs; for the PSEN1 site, pegRNA4 showed the best efficiency; and for the TAU site, pegRNA4 showed the best efficiency (slightly higher than pegRNA1 and 3). When the optimal pegRNAs were combined with their corresponding nick-sgRNAs, the efficiency was further improved, indicating that this combination can effectively target the target sites. The structures of the optimal pegRNAs and nick-RNAs at the target sites are shown below. Figure 2 As shown in Table 1, the optimal pegRNA / nick-sgRNA ratio is determined based on the test results.

[0121] 1.4 Optimization of Unit Point Editing System

[0122] To further improve the editing efficiency of target sites, this invention employs an optimized editing system that includes post-treatment with Nocodazole after electroporation and enrichment with puromycin. The specific method is as follows:

[0123] The recombinant expression plasmid corresponding to the optimal pegRNA+nick-sgRNA combination (prepared in step 1.2.3 of Example 1) and the pvPE-V3-Puro editor were electroporated into PFF cells according to the method in 1.3.2. Seven hours after electroporation, the culture medium was replaced to remove dead cells caused by electroporation, and Nocodazole was added to a concentration of 500 ng / mL. After 48 hours of electroporation, the medium was replaced with fresh complete medium without Nocodazole, and puromycin (2 μg / mL) was added for selection for 48 hours. After selection, the medium was replaced with fresh complete medium and cultured for another 3 days. Editing efficiency was then assessed according to the method in 1.3.3. A control system was established with no Nocodazole and puromycin or with only puromycin. The pvPE-V3-Puro editor is a variant of the pvPE-V3 editor, and the results are as follows: Figure 3 As shown, the editor fuses the puromycin resistance gene (PuroR) to the end of pvPE-V3 via the P2A sequence. This gene was commercially synthesized by Nanjing Genscript Biotech Co., Ltd. and cloned between the 3' nuclear localization signal and the PolyA tail of pvPE-V3. The P2A sequence and the puromycin resistance gene sequence (used for subsequent cell screening) are common sequences.

[0124] Figure 4 This is the result image showing the effect of adding Nocodazole + Purinemycin to the unit point selection. The efficiency is greatly improved after combining the two methods, including TAU. P300L The mutation efficiency exceeds 90%.

[0125] Example 2: Multi-site synchronous editing and cloning of pigs

[0126] This embodiment uses the optimized pegRNA / nick-sgRNA and editing system from Example 1 to conduct targeted... APP KM652 / 653NL , PSEN1 M143L and TAU P300L Three-point simultaneous cell editing was used to obtain purified cell clones for the preparation of cloned pigs.

[0127] 2.1 Cell Editing

[0128] 2.1.1 PFF cell culture, electroporation, and enrichment of positive cells

[0129] (1) Resuscitate P1 generation PFF cells and culture them in a 37°C, 5% CO2 incubator.

[0130] (2) When the cell confluence reaches 85-90%, digest the cells with trypsin at a mass fraction of 0.25% and collect approximately 2 × 10⁻⁶ cells. 6 Centrifuge each cell at 200×g for 5 min and discard the supernatant.

[0131] (3) will target APP, PSEN1 and TAU 2.5 μg each of the recombinant expression plasmid corresponding to the optimal pegRNA of the gene (prepared in step 1.2.3 of Example 1) and the recombinant expression plasmid corresponding to nick-sgRNA (prepared in step 1.2.3 of Example 1), and 5 μg of pvPE-V3-Puro editor plasmid containing the puromycin resistance gene were mixed in 100 μL of Entranster-E buffer, added to the cells in step (2), and mixed well.

[0132] (4) Transfer the cell suspension from step (3) to the electroporation cup of the Lonza 4D-Nucleofector electroporator and electroporate twice consecutively using the CA-137 program. After electroporation, place the cells in a 10 cm culture dish and culture them in complete culture medium. Replace the culture medium 7 h after electroporation to remove dead cells caused by electroporation, and add Nocodazole to 500 ng / mL. Replace the culture medium with fresh culture medium without Nocodazole 48 h after electroporation, and add puromycin (2 μg / mL) for selection for 48 h.

[0133] 2.1.2 Monoclonal Cell Culture and Identification

[0134] After screening with puromycin, cells were digested with trypsin at a concentration of 0.25% (w / v). A serial dilution method was used, with 1-2 cells per field of view under a microscope at 40x magnification as a reference. Cells were diluted at different serial dilutions to approximately 50 10 cm culture dishes and cultured in high-glucose DMEM medium containing 15% (v / v) fetal bovine serum and 1% (v / v) penicillin-streptomycin for 10-11 days. Once cell clones emerged, single-cell clones were collected and cultured in 24-well plates for 2-3 days. When cell confluence reached approximately 80%, cells were digested, and 1 / 3 of the cells were harvested. Cell DNA was extracted using the method described in 1.3.3.1. The DNA of each single clone was amplified using the first round primers in Table 4 and the method described in step 1.3.3.2, and the genotype was identified by Sanger sequencing. The remaining 2 / 3 of the cells were seeded into 6-well cell culture dishes for further culture.

[0135] This invention yielded 60 well-growing monoclonal cell populations. Sanger sequencing identified clones 19 and 38 as having target mutations at all three target sites. Figure 5 ).

[0136] 2.2 Somatic cell nuclear transfer and embryo transfer

[0137] Furthermore, this invention selects clone 38 for somatic cell nuclear transfer experiments. The specific method is as follows:

[0138] 2.2.1 Oocyte Collection and In Vitro Maturation

[0139] (1) Fresh isolated pig ovaries were collected from the slaughterhouse. After sterilization, cumulus-oocyte complexes were extracted from follicles with a diameter of 3-6 mm. Oocytes were screened under a microscope and placed in a maturation culture medium and cultured in a 5% CO2, 38.5°C incubator for about 38-42 hours for in vitro maturation.

[0140] (2) After culture, the mature cumulus-oocyte complex was removed from the cumulus cells surrounding the oocyte with hyaluronidase (Sigma) and the first polar body was expelled. Then, it was equilibrated for 20 min with calcium-free HN23 micromanipulation solution containing 1% (w / v) cytochalasin for subsequent nuclear transfer.

[0141] 2.2.2 Preparation of reconstructed embryos

[0142] (1) The donor cells were clone 38 gene-edited somatic cells, which were digested with trypsin and resuspended in calcium-free HN23 micromanipulation solution. Enucleation was performed in the micromanipulation system: the oocytes were polarized to the 4 o'clock position, fixed with a fixation needle, and the polar body and adjacent cytoplasm were aspirated with an enucleation needle with an outer diameter of 20 μm. Subsequently, donor cells with a diameter of 15-20 μm and strong refractive properties were selected, injected under the zona pellucida, and gently pressed to adhere to the oocyte membrane to form a reconstructed embryo.

[0143] (2) After the reconstructed embryos were restored in NCSU-23 basal culture medium for 1 h, they were activated. The activation was performed using an ECM200 electroshock device (BTX, USA) with parameters of 2 unidirectional DC pulses (30 μs, 120 V / mm). After activation, the embryos were transferred to embryo culture medium covered with mineral oil and placed in a 38.5℃, 5% CO2 incubator for 4 h to confirm the fusion state and obtain the activated reconstructed embryos.

[0144] 2.2.3 Embryo Transfer and Piglet Acquisition

[0145] Healthy, maternally active gilts or multiparous Large White sows were selected as surrogate mothers. Embryo transfer was performed on the second day of estrus (standing reflex period). Reconstructed embryos (approximately 2000 in total) developed to the 2-4 cell stage were evenly distributed among 5 sows in estrus at the same time, and injected into the oviduct via the ampulla-isthmus junction (5-7 cm on each side). Four sows successfully gave birth post-surgery, yielding a total of 24 live piglets, of which 19 healthy piglets survived to weaning. Figure 6 ).

[0146] Example 3: Molecular Characterization of Cloned Pigs

[0147] 3.1 Genotypic Analysis of Cloned Pigs

[0148] Using a tissue DNA extraction kit, ear tissue DNA was extracted from the 19 cloned pigs obtained in Example 2, and the genotype of the cloned pigs at the three target sites was identified according to the method in 2.1.2.

[0149] See results Figure 7 After Sanger sequencing, all cloned pigs were found to have the same genotype as clone 38.

[0150] 3.2 Off-target detection in cloned pigs

[0151] To evaluate whether the technical method of this invention produces potential off-target phenomena during the editing process, this embodiment uses Guide-seq technology to target... APP KM652 / 653NL , PSEN1 M143L and TAU P300L The following steps were taken to obtain potential sgRNA-dependent off-target sites for three pegRNAs and three nick-sgRNAs:

[0152] 3.2.1 Cell electroporation and screening

[0153] Recombinant expression plasmids (2 μg each) corresponding to the optimal pegRNA / nick-sgRNA targeting the APP, PSEN1, and TAU genes were mixed with pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, 62988) (5 μg) and dsODN (4 μg) and transfected into cells according to step 2.1.1. Transfection with only PX459V2.0-Cas9 and dsODN served as a control group. After transfection, cells were cultured for 48 h, then screened for 2 days with complete medium containing 2.5 μg / mL puromycin, followed by 5 days of further culture. Genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Generay Biotech). The dsODN sequence was: 5'-GTTTAATTGAGTTGTCATATGTTAATAACGGTAT-3' (SEO ID NO:84).

[0154] 3.2.2 Detection of potential off-target sites

[0155] Using the DNA extracted in step 3.2.1 as the target, Guide-seq technology was used to detect potential off-target sites. The specific method is described in the literature (Tsai SQ et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases). Nat Biotechnoogy . 2015;33(2):187-197).

[0156] Guide-seq results indicate that only for APP... KM652 / 653NL pegRNA and nick-sgRNA have 3 and 5 potential off-target sites, respectively. Figure 8 ).

[0157] 3.2.3 Off-target validation in cloned pigs

[0158] Based on the potential off-target sites obtained in step 3.2.2, three cloned pigs were randomly selected from the 19 cloned pigs. Using the primers listed in Table 5 and PrimeSTAR Max DNA Polymerase (Takara, R045A), PCR amplification was performed on eight potential off-target sites. The specific reaction system was: 15 μL PrimeSTAR Max Premix, 1.5 μL each of forward and reverse primers, 2 μL cellular DNA, and 10 μL ultrapure water. The PCR reaction conditions were: 94℃ for 5 min; (94℃ for 30 seconds, 68℃ (decreasing by 0.5℃ per cycle) for 30 seconds, 72℃ for 1 min) for 26 cycles; (94℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 1 min) for 14 cycles; 72℃ for 5 min. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing.

[0159] Sanger sequencing results as follows Figure 9 As shown, the cloned pigs showed no visible off-target effects at the eight potential off-target sites, indicating that the genome integrity of the AD model pigs obtained in this invention is good, providing a reliable safety guarantee for subsequent research.

[0160] Table 5 Off-target detection primers

[0161]

[0162] Note: Lowercase sequences are index sequences.

[0163] 3.3 Phenotypic Analysis of Cloned Pigs

[0164] (1) To assess whether cloned pigs have molecular characteristics associated with Alzheimer's disease, cerebrospinal fluid (CSF) and brain tissue samples were collected from 10-month-old cloned pigs and age-matched wild-type pigs of the same breed (both of the same breed).

[0165] (2) The levels of Aβ40 and Aβ42 and the Aβ42 / 40 ratio in the cerebrospinal fluid of cloned pigs and wild-type pigs were quantitatively analyzed using the Neurology 3-Plex A kit (Quanterix, 101995).

[0166] (3) The phosphorylation level of Tau protein in the hippocampus of cloned pigs was analyzed using Western blottin. The specific method is as follows:

[0167] Brain tissue samples were homogenized in RIPA lysis buffer (Beyotime, P0013B) containing protease and phosphatase inhibitors (Beyotime, P1045), centrifuged, and the supernatant was collected. Protein concentration was determined using an enhanced BCA protein quantification kit (Beyotime, P0010S). 10 μg of protein was subjected to SDS-PAGE electrophoresis (Beyotime, P0012A) and transferred to a PVDF membrane (Beyotime, FFP32). The membrane was blocked for 2 h with 5% BSA (Beyotime, ST023) in TBST solution (CWBIO, CW0043S). Subsequently, the samples were treated with mouse anti-Tau (TAU5, 1:1000, Thermomix). The primary antibodies against rabbit antiphosphorylated Tau (Ser396, 1:1000, HUABIO, ET1610-31), rabbit antiphosphorylated Tau (Ser404, 1:2000, HUABIO, HA721665), rabbit anti-GAPDH (1:2000, Proteintech, 10494-1-AP) were incubated overnight at 4°C. After washing with TBST, the antibodies were incubated at room temperature for 1 h with HRP-labeled anti-mouse IgG (1:10000, Abcam, ab6789) or anti-rabbit IgG (1:10000, Abcam, ab6721) secondary antibodies. Finally, the antibodies were developed with BeyoECL Plus chromogenic reagent (Beyotime, P0018S), and the signals were acquired by the Bio-Rad imaging system and quantitatively analyzed using ImageJ software.

[0168] Figure 10 This is an analysis of the Aβ levels in the cerebrospinal fluid of cloned and wild-type pigs. Compared with wild-type pigs, the levels of Aβ40 and Aβ42, as well as the Aβ42 / 40 ratio, were significantly increased in the cerebrospinal fluid of cloned pigs. Further analysis of the phosphorylation levels of Tau protein in the hippocampus of cloned and wild-type pigs is shown in the figure. Figure 11 .from Figure 11 The results show that the relative abundance of phosphorylated Ser396 was significantly increased in cloned pigs. These results indicate that preliminary molecular features associated with Alzheimer's disease have appeared in the cloned pigs obtained in this invention.

[0169] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A PE editing system based on endogenous multi-gene simultaneous editing, characterized in that The pegRNA and the nick-sgRNA targeting the pig APP KM652 / 653NL , PSEN1 M143L and TAU P300L sites, respectively; wherein, for the APP KM652 / 653NL site, the nucleotide sequence of the pegRNA is shown as SEQ ID NO: 1; for the PSEN1 M143L site, the nucleotide sequence of the pegRNA is shown as SEQ ID NO: 2; for the TAU P300L site, the nucleotide sequence of the pegRNA is shown as any one of SEQ ID NOs: 3-5; and the nucleotide sequence of the nick-sgRNA is shown as SEQ ID NOs: 6-8.

2. The PE editing system as claimed in claim 1, characterized in that comprising at least one of a PE editor, Nocodazole and puromycin.

3. Use of the PE editing system of claim 1 or 2 in the preparation of a product for constructing an Alzheimer's disease cell line or an Alzheimer's disease model pig.

4. A recombinant expression vector, characterized in that The pegRNA in the PE editing system of claim 1 or 2 is obtained by being connected to a vector backbone, or the pegRNA and the nick-sgRNA in the PE editing system of claim 1 or 2 are obtained by being connected to a vector backbone respectively.

5. The method for constructing a recombinant expression vector according to claim 4, wherein comprising the following steps: (1) based on the sequences of the pegRNA and the nick-sgRNA in the PE editing system of claim 1 or 2, design and synthesize forward and reverse primers of the pegRNA-Spacer, the pegRNA 3'-extension, the sgRNA scaffold and the nick-sgRNA with terminal connection sequences, and anneal them respectively; (2) connect the annealing products of the pegRNA-Spacer, the pegRNA 3'-extension and the gRNA scaffold obtained in step (1) and the linearized pegRNA vector backbone to obtain a pegRNA recombinant expression vector; (3) connect the annealing product of the nick-sgRNA obtained in step (1) and the linearized nick-sgRNA vector backbone to obtain a nick-sgRNA recombinant expression vector.

6. An Alzheimer's disease cell line based on endogenous multi-gene simultaneous editing, characterized in that obtained by the following method: transform the recombinant expression vector and the PE editor described in claim 4 into cells to obtain an Alzheimer's disease cell line based on endogenous multi-gene synchronous editing.

7. The Alzheimer's disease cell line based on endogenous multi-gene synchronous editing according to claim 6, characterized in that: the pegRNA recombinant expression vector, the nick-sgRNA recombinant expression vector and the PE editor are introduced into cells by electroporation or are delivered by the following alternative forms: (1) PE system RNA synthesized in vitro; (2) pre-assembled ribonucleoprotein complex.

8. The method for constructing an Alzheimer's disease cell line based on endogenous multi-gene simultaneous editing according to claim 6 or 7, characterized in that comprising the following steps: (1) the pegRNA recombinant expression vector and the nick-sgRNA recombinant expression vector for the three sites are mixed with the PE editor and the electroporation buffer, and are added into the cells to obtain a cell suspension; APP KM652 / 653NL sites, PSEN1 M143L and TAU P300L the pegRNA recombinant expression vector and the nick-sgRNA recombinant expression vector for the three sites are mixed with the PE editor and the electroporation buffer, and are added into the cells to obtain a cell suspension; (2) perform electroporation on the cell suspension in step (1); (3) culture the electroporated cells in complete medium for 6-10 h; replace the fresh medium containing Nocodazole and continue to culture for 24-48 h; replace the fresh medium containing puromycin for secondary screening and culture for 24-48 h to obtain an Alzheimer's disease cell line based on endogenous multi-gene synchronous editing.

9. The construction method of the Alzheimer's disease cell line based on endogenous multi-gene synchronous editing according to claim 8, characterized in that: the concentration of Nocodazole in the fresh medium containing Nocodazole in step (3) is 100-1000 ng / mL. 10.A method for constructing an Alzheimer's disease model pig based on endogenous multi-gene editing, characterized in that comprising the following steps: The Alzheimer's disease cell line based on endogenous multi-gene synchronous editing according to claim 6 or 7 is used as a donor cell, and an oocyte is used as a recipient cell to perform somatic cell nuclear transfer to obtain a reconstructed embryo; the reconstructed embryo is transplanted into a surrogate sow through embryo transfer surgery to obtain an Alzheimer's disease model pig.

Images