CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-CRISPR-Cas12a)-based composition and kit for detecting DAFDV (Domestic

Through the CRISPR-Cas12a technology combined with fluorescence detection and ABTS color development method, the time-consuming and labor-intensive and equipment-dependent problems of Dabie Banda virus detection in the prior art are solved, and fast, sensitive and specific virus detection is achieved, which is suitable for on-site diagnosis.

CN120536635APending Publication Date: 2025-08-26CENT FOR DISEASE CONTROL & PREVENTION OF THE EASTERN THEATER COMMAND OF THE CHINESE PEOPLES LIBERATION ARMY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510664808.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

The prior art has problems such as time-consuming and labor-intensive testing, requiring professional equipment, high false positive rates and not suitable for rapid detection, and cannot meet the rapid, sensitive and specific detection needs.

Method used

CRISPR-Cas12a technology combined with fluorescence detection and ABTS chromogenic method, and the rapid, sensitive and specific detection of Dabi Banda virus is achieved through RT-RAA amplification and Cas proteolytic cascade reaction.

Benefits of technology

It realizes rapid detection in an environment of 37-40℃, with short detection time, high amplification efficiency, high sensitivity and low cost. It can perform visual sample detection without large-scale laboratory instruments, and is suitable for on-site diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005414848360000011
    Figure HDA0005414848360000011
  • Figure HDA0005414848360000012
    Figure HDA0005414848360000012
  • Figure HDA0005414848360000021
    Figure HDA0005414848360000021
Patent Text Reader

Abstract

The invention discloses a CRISPR-Cas12a-based composition and a CRISPR-Cas12a-based kit for detecting a large allofda virus and an application of the CRISPR-Cas12a-based composition and the kit. The invention provides a composition. The composition is composed of a single-stranded DNA molecule as shown in SEQ ID NO: 2, a single-stranded DNA molecule as shown in SEQ ID NO: 3 and a single-stranded RNA molecule as shown in SEQ ID NO: 5. The invention also provides a reagent kit, which comprises the composition and Cas12a protein. The reagent kit further comprises a probe or a DNA (deoxyribonucleic acid) molecule for forming a G-quadruplex. The method has a wide application prospect in the field diagnosis aspect of the Databi virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a composition and a kit for detecting Dabiebanda virus based on CRISPR-Cas12a and applications thereof. Background Art

[0002] Bandavirus dabieense (DBV), also known as severe fever with thrombocytopenia syndrome virus (SFTSV), belongs to the Bandavirus genus of the Phenuiviridae family. First discovered in 2009, DBV causes severe fever with thrombocytopenia syndrome (SFTS), a disease characterized by fever and thrombocytopenia. It presents with an acute onset and a high mortality rate in severe cases. The disease is primarily transmitted through tick bites, but can also spread from person to person through direct contact with infected blood, bloody secretions, excretions, and contaminants, leading to clusters. Since 2010, the spread of SFTS has continued to expand, with the number of reported cases increasing annually. Cases are highly sporadic, with some regional clustering. Cases have occurred in all age groups, with over 95% of reported cases occurring in people over 40 years old, and over 85% occurring in farmers. There is no significant gender difference in patients.

[0003] Dabebanda virus is a single-stranded, negative-sense RNA virus. The viral genome consists of three segments (L, M, and S). The L segment contains a single reading frame and encodes the RNA-dependent RNA polymerase. The M segment contains a single reading frame and encodes the glycoprotein precursor. The S segment is a bi-sense RNA that encodes the viral nucleoprotein and non-structural proteins in a bidirectional manner.

[0004] Methods for detecting SFTSV include virus isolation and culture, PCR technology, serological testing, and whole-genome and metagenomic sequencing. While these methods play an important role in detecting SFTSV, they are also time-consuming and labor-intensive, with long time cycles and low efficiency. They require specialized personnel and expensive equipment, have high false-positive rates, and are not suitable for rapid on-site testing. Therefore, whether for prevention or treatment, the development of a rapid, sensitive, and specific method for detecting SFTSV is necessary. Summary of the Invention

[0005] The purpose of the present invention is to provide a composition and a kit for detecting Dabiebanda virus based on CRISPR-Cas12a and its application.

[0006] The present invention provides a composition consisting of a single-stranded DNA molecule shown in SEQ ID NO: 2, a single-stranded DNA molecule shown in SEQ ID NO: 3, and a single-stranded RNA molecule shown in SEQ ID NO: 5.

[0007] The present invention also provides a reagent kit comprising the composition.

[0008] The reagent kit also includes a probe; the probe is obtained by modifying a fluorescent group at one end of the linear single-stranded DNA molecule shown in SEQ ID NO: 14 and a fluorescence quenching group at the other end. Specifically, the fluorescent group is a 6-FAM group. Specifically, the fluorescence quenching group is a BHQ group.

[0009] The reagent set also includes a DNA molecule for forming a G-quadruplex.

[0010] The DNA molecule used to form a G-quadruplex is a single-stranded DNA molecule shown in SEQ ID NO: 15.

[0011] The reagent kit also includes Cas12a protein.

[0012] Specifically, the Cas12a protein is LbCas12a protein.

[0013] Specifically, the Cas12a protein is a protein obtained by adding NLS and His6 tags to the C-terminus of the LbCas12a protein derived from Lachnospiraceae bacterium.

[0014] The reagent kit further includes a target plasmid; the target plasmid is a plasmid having a double-stranded DNA molecule shown in SEQ ID NO: 1. The target plasmid can be used as a standard or a positive control.

[0015] Specifically, the target plasmid is a recombinant plasmid obtained by inserting the double-stranded DNA molecule shown in SEQ ID NO: 1 into the pUC57 plasmid.

[0016] Specifically, the target plasmid is a recombinant plasmid obtained by replacing a small fragment between the BamHI and HindIII restriction sites of the pUC57 plasmid with a double-stranded DNA molecule shown in SEQ ID NO: 1, while keeping other sequences unchanged.

[0017] The composition provided by the present invention can be combined with fluorescence to detect Dabiebanda virus.

[0018] The composition provided by the present invention can be combined with ABTS colorimetry to detect Dabiebanda virus.

[0019] The use of the composition provided by the present invention is as follows (a) or (b) or (c) or (d):

[0020] (a) For the detection of Dabiebanda virus;

[0021] (b) for detecting Dabiebandha virus nucleic acid;

[0022] (c) Used for screening or auxiliary screening of patients with fever and thrombocytopenia syndrome;

[0023] (d) Used to screen drugs for fever with thrombocytopenia syndrome.

[0024] The present invention also protects the use of the composition or the reagent set in preparing a kit; the function of the kit is as follows (a) or (b) or (c) or (d):

[0025] (a) For the detection of Dabiebanda virus;

[0026] (b) for detecting Dabiebandha virus nucleic acid;

[0027] (c) Used for screening or auxiliary screening of patients with fever and thrombocytopenia syndrome;

[0028] (d) Used to screen drugs for fever with thrombocytopenia syndrome.

[0029] The present invention also protects a kit comprising the composition or the reagent set; the functions of the kit are as follows (a) or (b) or (c) or (d):

[0030] (a) For the detection of Dabiebanda virus;

[0031] (b) for detecting Dabiebandha virus nucleic acid;

[0032] (c) Used for screening or auxiliary screening of patients with fever and thrombocytopenia syndrome;

[0033] (d) Used to screen drugs for fever with thrombocytopenia syndrome.

[0034] The kit also includes reagents required for RT-RAA. Specifically, the reagents required for RT-RAA can be provided by an RT-RAA nucleic acid amplification kit.

[0035] The kit also includes reagents required for ABTS color development. Specifically, the reagents required for ABTS color development can be provided by an EL-ABTS color development kit.

[0036] As an example, the Dabiebanda virus may be strain JS14.

[0037] The reagent kit provided by this invention offers the following advantages for detecting Dabiebanda virus: short detection time, high amplification efficiency, good specificity, high sensitivity (up to 1 copy / reaction), low cost, simple and convenient operation, and the entire process performed at 37-40°C, effectively eliminating the need for large laboratory instruments. Fluorescence detection, combined with a fluorescent flashlight, allows for visual detection of experimental samples, and ABTS color development allows for direct visual observation of the reaction results.

[0038] By coupling RT-RAA with Cas proteins, the present invention achieves a two-stage amplification process: sequence amplification (performed by RT-RAA) plus enzymatic cascade (performed by the Cas enzyme), surpassing the sensitivity of single-stage amplification, such as Q-PCR. Furthermore, because RT-RAA amplification does not require complex temperature changes, it eliminates the need for precision instruments like Q-PCR machines, making CRISPR-Cas technology promising for on-site diagnosis of Dabiebanda virus.

[0039] The present invention has broad application prospects in on-site diagnosis of Dabiebanda virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the result diagram of Example 2.

[0041] Figure 2 This is the result diagram of the fluorescence signal in Example 5.

[0042] Figure 3 This is a diagram showing the results of visual observation in Example 5.

[0043] Figure 4 This is the result diagram of the OD value in Example 6.

[0044] Figure 5 This is a diagram showing the results of visual observation in Example 6.

[0045] Figure 6 This is the result diagram of the fluorescence signal in Example 7.

[0046] Figure 7 This is a diagram showing the results of visual observation in Example 7.

[0047] Figure 8 This is the result diagram of the OD value in Example 8.

[0048] Figure 9 This is a diagram showing the results of visual observation in Example 8. DETAILED DESCRIPTION

[0049] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0050] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples are commercially available unless otherwise noted. Unless otherwise noted, quantitative experiments in the following examples were performed in duplicate, and the results were averaged.

[0051] LbCas12a protein (GenCRISPR TM LbCas12a Nuclease): Nanjing GenScript Biotechnology Co., Ltd., product number Z03753; this protein is derived from Lachnospiraceae bacteria and has an NLS and His6 tag added to the C-terminus. NEBuffer TM r2.1 (10×): New England Biolabs, product number B6002S.

[0052] The Alongshan virus used in the examples is the LN strain, which is described in the following literature (referred to as ALSV-LN): Bai Y, Li Y, Liu WL, et al. Analysis of the diversity of tick-borne viruses at the border areas in Liaoning Province, China. Front Microbiol. 2023 May 2: 14: 1179156. doi: 10.3389 / fmicb.2023.1179156.

[0053] The Henan tick virus used in the examples is described in the following literature (named Henan tickvirus CLCM-130 in the literature): Ye RZ, Liu YY, Xu DL, et al. Virome diversity shaped by genetic evolution and ecological landscape of Haemaphysalis longicornis. Microbiome. 2024 Feb 21; 12(1): 35. doi: 10.1186 / s40168-024-01753-9.

[0054] The Dabiebanda virus used in the examples is described in the following literature (referred to as SFTSV JS14 strain in the literature): Effects of severe fever with thrombocytopenia syndrome virus on the expression of Toll-like receptor 2 and inflammatory factors in mouse macrophages, Journal of Medical Postgraduates, 2019, 32(11): 1164-1168.

[0055] Example 1: Screening target sequences and preparing target plasmids, as well as designing and preparing amplification primer pairs and crRNA

[0056] 1. Target sequence screening

[0057] The inventors retrieved a large number of genome sequences from various viruses of the genus Bandavirus (including Dabiebandavirus and other viruses of the genus), and conducted extensive sequence analysis and sequence comparison to screen for specific target sequences in the Dabiebandavirus genome. The identified target sequence, shown in SEQ ID NO: 1, is located in the L segment of the Dabiebandavirus genome. This target sequence is specifically present in the Dabiebandavirus genome and is a conserved sequence of the Dabiebandavirus.

[0058] 2. Preparation of target plasmid

[0059] The double-stranded DNA molecule shown in SEQ ID NO: 1 was used to replace the small fragment between the BamHI and HindIII restriction sites of the pUC57 plasmid, while keeping other sequences unchanged, to obtain the target plasmid (which has been sequenced and verified).

[0060] 3. Design and prepare amplification primer pairs and crRNA

[0061] Based on the target sequence, an amplification primer pair was designed. The amplification primer pair consists of primer SFTSV-1F and primer SFTSV-1R. Both primers SFTSV-1F and SFTSV-1R are single-stranded DNA molecules. Primers SFTSV-1F and SFTSV-1R were artificially synthesized.

[0062] SFTSV-1F (SEQ ID NO: 2): 5'-TCAGTTCTCCTGGCAAATGATAGGAAGACCCAAGG-3';

[0063] SFTSV-1R (SEQ ID NO: 3): 5'-CTCCAAACTCTTCCACCTCAGCAGACCACAA-3'.

[0064] Based on the 5′ TTTV PAM sequence in SEQ ID NO: 1 or the reverse complement of SEQ ID NO: 1, multiple crRNAs were designed and named crRNA1 to crRNA10. Each crRNA was a single-stranded RNA molecule. Each crRNA was artificially synthesized.

[0065] crRNA1:5'- UAAUUUCUACUAAGUGUAGAU AAAACUCUUGACAAUUGGGCC-3'.

[0066] crRNA2:5'- UAAUUUCUACUAAGUGUAGAU ACAACUCAAGAGCUUGUCGAC-3'.

[0067] crRNA3:5'- UAAUUUCUACUAAGUGUAGAU AGAUGUCAUAGCUGUAGAGCUC-3'.

[0068] crRNA4:5'- UAAUUUCUACUAAGUGUAGAU AUGGAGCACCUAUCUUGUGG-3'.

[0069] crRNA5:5'- UAAUUUCUACUAAGUGUAGAU GAGAAGGAGUGGUGGCUGUGA-3'.

[0070] crRNA6:5'- UAAUUUCUACUAAGUGUAGAU UUGGGUAUCUGAUCAGUUCUG-3'.

[0071] crRNA7:5'- UAAUUUCUACUAAGUGUAGAU CCAGGAGAACUGAGGCAUGUG-3'.

[0072] crRNA8:5'- UAAUUUCUACUAAGUGUAGAU UUAGAGAACCCUCGAGACAGU-3'.

[0073] crRNA9:5'- UAAUUUCUACUAAGUGUAGAU ACCUCAUCAGCCCUUGCUUUCU-3'.

[0074] crRNA10:5'- UAAUUUCUACUAAGUGUAGAU CAGGAAUAUGAGGAAUGGC-3'.

[0075] Example 2, crRNA screening

[0076] Test crRNA: crRNA1 to crRNA10 prepared in Example 1 respectively.

[0077] Prepare the cleavage reaction system and incubate at 37°C for 30 min. During the reaction, read the fluorescence value every 20 s using a fluorescence detector.

[0078] Cutting reaction system (20 μL): 2 μL NEBuffer TM r2.1 (10×), 1 μL LbCas12a protein solution, 1 μL crRNA solution, 1 μL probe solution, 1 μL target plasmid solution and 14 μL DEPC water. The active ingredient provided by the LbCas12a protein solution is LbCas12a protein. The active ingredient provided by the crRNA solution is the test crRNA. The active ingredient provided by the probe solution is the probe. The active ingredient provided by the target plasmid solution is the target plasmid prepared in Example 1. In the reaction system, the content of LbCas12a protein is 445nM, the content of crRNA is 500nM, the content of the probe is 50nM, and the content of the target plasmid is 1.65nM. An equal volume of DEPC water was used instead of the target plasmid solution as a negative control.

[0079] The probe is obtained by modifying the 5' end of the single-stranded DNA molecule shown in SEQ ID NO: 14 with a 6-FAM group and the 3' end with a BHQ1 group. Probe: 5'-6-FAM-TTTTTTTTTTTT-BHQ-3'.

[0080] See the results Figure 1 When crRNA2 was used, the slope ratio of the fluorescence curves of the experimental group and the negative control group was the largest (14). Therefore, the present invention selected crRNA2 as the crRNA for detecting Dabiebanda virus.

[0081] Example 3: Establishing a method for detecting Dabiebanda virus using CRISPR-Cas12a combined with fluorescence

[0082] Detection principle: crRNA and Cas12a protein form a binary complex. When there is a DNA molecule with a target sequence in the reaction system, crRNA hybridizes with the target sequence segment in the DNA molecule to form an R-loop. After R-loop is formed, the Cas12a protein cuts downstream of the PAM sequence in the DNA molecule with the target sequence (i.e., exerts cis-cleavage activity). After the cis-cleavage activity is activated, the Cas12a protein cuts single-stranded DNA molecules of any sequence (i.e., exerts trans-cleavage activity). The probe is modified with a fluorescent group at one end of a linear single-stranded DNA molecule and a quenching group at the other end. Under the action of the trans-cleavage activity of the Cas12a protein, the probe is cut, and a fluorescent signal can be observed after the fluorescent group is released.

[0083] 1. RT-RAA Amplification

[0084] RT-RAA Nucleic Acid Amplification Kit (48T), Jiangsu Qitian Gene Biotechnology Co., Ltd., product number B00R00A; the components provided by the kit include a 48-channel reaction vessel, RAA amplification buffer, and magnesium acetate solution.

[0085] 1. Prepare RT-RAA reaction premix

[0086] The 44 μL RT-RAA reaction premix consists of: 25 μL RAA amplification buffer, 2 μL upstream primer solution, 2 μL downstream primer solution, and 15 μL water. The upstream primer solution contains the active ingredient SFTSV-1F primer at a concentration of 10 μM. The downstream primer solution contains the active ingredient SFTSV-1R primer at a concentration of 10 μM.

[0087] 2. In a 48-channel reaction vessel, add 44 μL of RT-RAA reaction premix and 1 μL of nucleic acid sample to each reaction tube. Add 5 μL of magnesium acetate solution to the cap of each reaction tube, cap the tube, and incubate at 37°C for 30 min. Set up a negative control by replacing the nucleic acid sample with an equal volume of DEPC water.

[0088] 2. Cleavage Reaction

[0089] Prepare the cleavage reaction system and then react at 37°C for 30 minutes.

[0090] Cutting reaction system (20 μL): 2 μL NEBuffer TM r2.1 (10×), 1 μL LbCas12a protein solution, 1 μL crRNA2 solution, 1 μL probe solution, 5 μL step 1 amplification product and 10 μL DEPC water. The active ingredient provided by the LbCas12a protein solution is LbCas12a protein. The active ingredient provided by the crRNA2 solution is crRNA2. The active ingredient provided by the probe solution is the probe. In the reaction system, the content of LbCas12a protein is 445 nM, the content of crRNA2 is 500 nM, and the content of the probe is 50 nM.

[0091] The probe is obtained by modifying the 5' end of the single-stranded DNA molecule shown in SEQ ID NO: 14 with a 6-FAM group and the 3' end with a BHQ1 group. Probe: 5'-6-FAM-TTTTTTTTTTTT-BHQ-3'.

[0092] 3. Interpretation of results

[0093] 1. Interpret results using fluorescence signal intensity

[0094] During the reaction process of step 2, the fluorescence value is read every 20 seconds using a fluorescence detector, and the cumulative fluorescence value at the completion of the reaction is used as the signal intensity. If the signal intensity of the nucleic acid sample of the test sample in the above step is less than or equal to twice the signal intensity of the negative control in the above step, the test sample is judged to contain Dabiebandha virus nucleic acid. If the signal intensity of the nucleic acid sample of the test sample in the above step is greater than twice the signal intensity of the negative control in the above step, the test sample is judged to contain Dabiebandha virus nucleic acid.

[0095] 2. Visually interpret the results

[0096] After completing step 2, use a portable fluorescent flashlight (fluorescent emission wavelength is OD 440nm -OD 460nm ) irradiate the reaction product. If no fluorescence is observed, the sample is judged to contain no Dabiebanda virus nucleic acid. If fluorescence is observed, the sample is judged to contain Dabiebanda virus nucleic acid.

[0097] Example 4: Establishing a method for detecting Dabiebanda virus using CRISPR-Cas12a combined with ABTS colorimetric development

[0098] Detection principle: G-quadruplex is a high-level structure formed by the folding of DNA or RNA rich in tandem repeats of guanine (G). It is a deoxyribozyme (deoxyribozyme / DNAzyme) with porphyrin metalloenzyme and peroxidase activity. When the G-quadruplex binds to hemin, the formed G-quadruplex / Hemin complex acts as a DNA enzyme that can catalyze the oxidation of ABTS by H2O2 to produce a color change, forming a blue-green or blue solution visible to the naked eye. crRNA forms a binary complex with the Cas12a protein. When a DNA molecule with a target sequence is present in the reaction system, the crRNA hybridizes with the target sequence segment in the DNA molecule to form an R-loop. After the R-loop is formed, the Cas12a protein cuts downstream of the PAM sequence in the DNA molecule with the target sequence (i.e., exerts cis-cleavage activity). After the cis-cleavage activity is activated, the Cas12a protein cuts single-stranded DNA molecules of any sequence (i.e., exerts trans-cleavage activity). Under the action of the trans-cleavage activity of the Cas12a protein, catG4 is cut and cannot form a G-quadruplex / Hemin complex, so the expected color change cannot be produced.

[0099] 1. RT-RAA Amplification

[0100] Same as step 1 of embodiment 3.

[0101] 2. Cleavage Reaction

[0102] The cleavage reaction system was prepared and then reacted at 37°C for 70 minutes.

[0103] Cutting reaction system (20 μL): 2 μL NEBuffer TM r2.1 (10×), 1 μL LbCas12a protein solution, 1 μL crRNA2 solution, 1 μL catG4 solution, 0.5 μL amplification product of step 1 and 14.5 μL DEPC water. The active ingredient provided by the LbCas12a protein solution is LbCas12a protein. The active ingredient provided by the crRNA2 solution is crRNA2. The active ingredient provided by the catG4 solution is catG4. In the reaction system, the content of LbCas12a protein is 111nM, the content of crRNA2 is 250nM, and the content of catG4 is 1000nM.

[0104] catG4 is a single-stranded DNA molecule.

[0105] catG4 (SEQ ID NO: 15): 5'-TGGGTAGGGCGGGTTGGGAAA-3'.

[0106] 3. Color reaction

[0107] EL-ABTS colorimetric kit: Shanghai Sangon Biotechnology Co., Ltd., product number C510031; the EL-ABTS colorimetric kit includes reaction solution, solution A, and stop solution. To prepare the ABTS reaction solution, transfer 10 mL of the provided reaction solution to a brown bottle and add 2.5 μl of the provided solution A. Hemin (CAS: 16009-13-5): Beijing Solebold Technology Co., Ltd., product number H8130.

[0108] Prepare the color development reaction system, then react at 37°C for 5 minutes, and then add the stop solution provided by the kit.

[0109] Color development reaction system: 1 μL hemin solution, 2 μL KCl solution, 50 μL ABTS reaction solution, 20 μL cleavage product from step 2. In the reaction system, the hemin content is 1 μM and the KCl content is 7 mM.

[0110] IV. Interpretation of results

[0111] 1. Use enzyme-labeled instrument to interpret the results

[0112] After completing step 3, measure the OD value of the reaction product at 405 nm using a microplate reader. If the OD value of the nucleic acid sample of the test sample after the above step is less than half the OD value of the negative control after the above step, the test sample is judged to contain Dabiebandha virus nucleic acid. If the OD value of the nucleic acid sample of the test sample after the above step is greater than or equal to half the OD value of the negative control after the above step, the test sample is judged to not contain Dabiebandha virus nucleic acid.

[0113] 2. Visually interpret the results

[0114] After completing step 3, perform a visual inspection. If the reaction product is dark blue, the sample is considered to contain no Dabiebandha virus nucleic acid. If the reaction product is colorless or light blue, the sample is considered to contain Dabiebandha virus nucleic acid.

[0115] Example 5. Determination of the sensitivity of CRISPR-Cas12a combined with fluorescence detection of Dabiebanda virus

[0116] Preparation of nucleic acid samples: Take the total RNA of Dabiebanda virus and dilute it to make the target gene content 1×10 2 copies / μL, 1×10 1 copies / μL or 1 copy / μL.

[0117] Proceed as in Example 3.

[0118] During the reaction of step 2, the fluorescence value was read every 20 seconds using a fluorescence detector. Figure 2 . Figure 2 In the table, 0 represents negative control, 1 represents 1 copy / system, 10 represents 1 Represents 10 copies / system, 10 2 Represents 100 copies / system. Detection sensitivity can reach 1 copy / reaction.

[0119] After completing step 2, use a portable fluorescent flashlight (fluorescent emission wavelength is OD 440nm -OD 460nm ) irradiated the reaction product. Figure 3 . Figure 3 In the table, 1 represents the negative control, 2 represents 1 copy / system, 3 represents 10 copies / system, and 4 represents 100 copies / system. 1 Copy / system or 10 2 Obvious fluorescence can be observed when copying / system.

[0120] Example 6. Determination of the sensitivity of CRISPR-Cas12a combined with ABTS colorimetric detection of Dabiebanda virus

[0121] Preparation of nucleic acid samples: Take the total RNA of Dabiebanda virus and dilute it to make the target gene content 1×10 2 copies / μL, 1×10 1 copies / μL or 1 copy / μL.

[0122] Proceed as in Example 4.

[0123] After completing step 3, the OD value of the reaction product was measured at 405 nm using a microplate reader. Figure 4 The detection sensitivity can reach 1 copy / reaction.

[0124] After completing step 3, visually observe. Figure 5 The reaction product of the negative control is dark blue. Compared with the negative control, the reaction products of nucleic acid samples with different copy numbers are significantly lighter in color.

[0125] Example 7. Specific detection of Dabiebanda virus using CRISPR-Cas12a combined with fluorescence detection

[0126] The test viruses were Dabie Banda virus, Alongshan virus, and Henan tick virus. Nucleic acid samples were obtained from total RNA of the test viruses (RNA content was 10 copies / μl).

[0127] Proceed as in Example 3.

[0128] During the reaction of step 2, the fluorescence value was read every 20 seconds using a fluorescence detector. Figure 6 The detection system established by the present invention has good specificity and has no cross reaction with Alongshan virus and Henan tick virus.

[0129] After completing step 2, use a portable fluorescent flashlight (fluorescent emission wavelength is OD 440nm -OD 460nm ) irradiated the reaction product. Figure 7 Only samples containing the genome of the large Bepbanda virus showed significant fluorescence.

[0130] Example 8. Specific detection of Dabiebanda virus using CRISPR-Cas12a combined with ABTS colorimetric detection

[0131] The test viruses were Dabie Banda virus, Alongshan virus, and Henan tick virus. Nucleic acid samples were obtained from total RNA of the test viruses (RNA content was 10 copies / μl).

[0132] Proceed as in Example 4.

[0133] After completing step 3, the OD value of the reaction product was measured at 405 nm using a microplate reader. Figure 8The detection system established by the present invention has good specificity and has no cross reaction with Alongshan virus and Henan tick virus.

[0134] After completing step 3, visually observe. Figure 9 Only the Dabiebanda virus sample was colorless, while the negative samples, Alongshan virus samples, and Henan tick virus samples were all blue.

[0135] crRNA1 (SEQ ID NO: 4): 5'- TAATTTCTACTAAGTGTAGAT AAAACTCTTGACAATTGGGCC-3'. crRNA2 (SEQ ID NO: 5): 5'- TAATTTCTACTAAGTGTAGAT ACAACTCAAGAGCTTGTCGAC-3'. crRNA3 (SEQ ID NO: 6): 5'- TAATTTCTACTAAGTGTAGAT AGATGTCATAGCTGTAGAGCTC-3'. crRNA4(SEQ IDNO:7):5'- TAATTTCTACTAAGTGTAGAT ATGGAGCACCTATCTTGTGG-3'. crRNA5 (SEQ ID NO: 8): 5'- TAATTTCTACTAAGTGTAGAT GAGAAGGAGTGGTGGCTGTGA-3'. crRNA6 (SEQ ID NO: 9): 5'- TAATTTC TACTAAGTGTAGAT TTGGGTATCTGATCAGTTCTG-3'. crRNA7 (SEQ ID NO: 10): 5'- TAATTTCTACTAA GTGTAGAT CCAGGAGAACTGAGGCATGTG-3'. crRNA8 (SEQ ID NO: 11): 5'- TAATTTCTACTAAGTGTAG AT TTAGAGAACCCTCGAGACAGT-3'. crRNA9 (SEQ ID NO: 12): 5'- TAATTTCTACTAAGTGTAGAT ACCTCATCAGCCCTTGCTTTCT-3'. crRNA10 (SEQ ID NO: 13): 5'- TAATTTCTACTAAGTGTAGAT CAGGAATATGAGGAATGGC-3'.

[0136] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A composition comprising a single-stranded DNA molecule represented by SEQ ID NO: 2, a single-stranded DNA molecule represented by SEQ ID NO: 3, and a single-stranded RNA molecule represented by SEQ ID NO:

5.

2. A reagent kit comprising the composition according to claim 1.

3. The reagent set according to claim 2, further comprising: a probe; wherein the probe is obtained by modifying a fluorescent group at one end of the single-stranded DNA molecule shown in SEQ ID NO: 14 and a fluorescence quenching group at the other end.

4. The reagent kit according to claim 2, wherein: The reagent kit further includes a single-stranded DNA molecule shown in SEQ ID NO:

15.

5. The reagent kit according to any one of claims 2 to 4, characterized in that: The reagent kit also includes Cas12a protein.

6. The reagent kit according to any one of claims 2 to 5, wherein: The reagent kit further includes a target plasmid; the target plasmid is a plasmid having a double-stranded DNA molecule shown in SEQ ID NO:

1.

7. Use of the composition of claim 1 or the reagent set of any one of claims 2 to 6 in the preparation of a kit; wherein the function of the kit is the following (a) or (b) or (c) or (d): (a) For the detection of Dabiebanda virus; (b) for detecting Dabiebandha virus nucleic acid; (c) Used for screening or auxiliary screening of patients with fever and thrombocytopenia syndrome; (d) Used to screen drugs for fever with thrombocytopenia syndrome.

8. A kit comprising the composition of claim 1 or the reagent set of any one of claims 2 to 6; the function of the kit is the following (a) or (b) or (c) or (d): (a) For the detection of Dabiebanda virus; (b) for detecting Dabiebandha virus nucleic acid; (c) Used for screening or auxiliary screening of patients with fever and thrombocytopenia syndrome; (d) Used to screen drugs for fever with thrombocytopenia syndrome.