DNA vaccine for preventing canine distemper as well as preparation method and application of DNA vaccine

Abstract

The invention discloses a preparation method of a DNA (deoxyribonucleic acid) vaccine for preventing canine distemper, which comprises the following steps: taking plasmids of genes containing a newly separated canine distemper virus strain, namely a canine distemper virus fusion protein with an amino acid sequence shown as SEQ ID NO.6 and / or a hemagglutinin protein with an amino acid sequence shown as SEQ ID NO.8 as immunogens; hUO, mPEG-DMG, distearoyl phosphatidylcholine and cholesterol are used as lipid materials to prepare the canine distemper lipid nanoparticle DNA vaccine, and the vaccine can effectively stimulate neutralizing antibodies of mice, dogs, foxes and raccoon dogs and has clinical practical prospects.

Description

Technical Field

[0001] The invention belongs to the field of veterinary biological products and relates to a DNA vaccine for preventing canine distemper and a preparation method and application thereof. Background Art

[0002] Canine distemper (CD) is an acute, highly contagious, and fatal infectious disease of animals caused by the canine distemper virus (CDV). It is a global epidemic. CDV has a wide host range, including a variety of terrestrial carnivores, including canids, raccoons, bears, felines, civets, hyenas, and mustelids. In addition to common susceptible hosts such as dogs, minks, foxes, and raccoon dogs, CDV also poses a serious threat to rare species such as giant pandas and Siberian tigers. CDV is primarily transmitted through direct contact or aerosols via nasal fluid, tears, and saliva. Clinical manifestations include biphasic fever, acute catarrhal rhinitis, pneumonia, conjunctivitis, and neurological damage. In recent years, CDV has continued to mutate, with 19 genotypes now recognized: America-1, America-2, America-3, South America / North America-4, America-5 (a subtype of America-2), Asia-1, Asia-2, Asia-3, Asia-4, Asia-5, Asia-6, Europe Wildlife, Arctic, Africa-1, Africa-2, South America-1, South America-2, South America-3, and Rockborn-like. Multispecies CDV infection is becoming increasingly frequent, with fatal cases of natural CDV infection in non-human primates, further complicating CD prevention and control. Vaccination is the primary means of CD prevention and control. Currently available commercial vaccines are primarily modified live vaccines (MLVs), typically containing the America-1 strain, which exhibits significant immunogenicity differences from the strains circulating in my country. This type of MLV is susceptible to interference with CDV antibodies, resulting in shorter immune efficacy and duration of repeated immunization, making it more susceptible to clinical morbidity following immunization. Furthermore, as a live virus, MLV presents safety risks such as strain spillover and transmission during production and field application, environmental shedding, and cross-species adaptation and mutation. DNA vaccines can simultaneously activate both humoral and cellular immunity, offering advantages such as high safety, long-lasting immunity, low production costs, and simple processes. Combining them with lipid nanoparticle (LNP) delivery systems can enhance the intracellular delivery efficiency and immunogenicity of plasmid DNA, demonstrating unique advantages in enhancing its immune efficacy and prolonging its duration.

[0003] CDV is a member of the Paramyxoviridae family and the Morbillivirus genus. Its genome encodes six structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin protein (H), and large polymerase protein (L). H and F are key molecules involved in CDV infection and are the primary target antigens for vaccine development. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the first aspect of the present invention provides a composition, which is a first composition, a second composition, a third composition, a fourth composition, or a combination of the first composition and the second composition;

[0005] The first composition contains a first plasmid vector;

[0006] The second composition contains a second plasmid vector;

[0007] The third composition contains a combination of the first plasmid vector and the second plasmid vector;

[0008] The fourth composition contains a third plasmid vector;

[0009] The first plasmid vector is capable of expressing the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6;

[0010] The second plasmid vector is capable of expressing the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.8;

[0011] The third plasmid vector can express the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6 and the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.8.

[0012] In some embodiments, in the composition, selected from the following situations A1, A2 and A3;

[0013] A1: The coding sequence of the canine distemper virus fusion protein is shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004;

[0014] The coding sequence of the canine distemper virus hemagglutinin protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839;

[0015] A2: The backbone of the first plasmid vector is pCAGGS vector;

[0016] The backbone of the second plasmid vector is a pCAGGS vector;

[0017] The backbone of the third plasmid vector is a pCAGGS vector.

[0018] A3: The composition further contains excipients.

[0019] In some embodiments, in the composition, selected from the following situations B1, B2 and B3;

[0020] B1: The pCAGGS vector is a pCAGGS vector with the SV40 replication origin deleted;

[0021] B2: a Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus fusion protein;

[0022] A Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus hemagglutinin protein;

[0023] B3: The excipients of the composition include lipid materials and lipid nanoparticle solvents, and the lipid materials include cationic lipids, polymer-conjugated lipids, neutral lipids and structural lipids.

[0024] In some embodiments, in the composition, selected from the following C1, C2, C3, C4, C5 and C6;

[0025] C1: the molar ratio of the cationic lipid, the polymer-conjugated lipid, the neutral lipid and the structural lipid is 50: 1-2 (including but not limited to any value of 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 or a range between any two values): 5-20 (including but not limited to any value of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or a range between any two values): 20-60 (including but not limited to any value of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60 or a range between any two values);

[0026] In the first composition, the weight ratio of the first plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or the range between any two values):100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0027] In the second composition, the weight ratio of the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or the range between any two values):100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0028] In the third composition, the weight ratio of the first plasmid vector, the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:0.5-2:15-40 (including but not limited to any value of 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or a range between any two values):100-10000 (including but not limited to any value of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or a range between any two values);

[0029] In the fourth composition, the weight ratio of the third plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-50 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 45, 50 or the range between any two values): 100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0030] C2: The cationic lipid is selected from heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecanoxy)hexyl)amino)octanoate);

[0031] C3: the polymer conjugated lipid is selected from mPEG-DMG;

[0032] C4: the neutral lipid is selected from distearoylphosphatidylcholine;

[0033] C5: the structural lipid is selected from cholesterol;

[0034] C6: The lipid nanoparticle solvent is an aqueous solution containing 0.2-0.3 w / w% tromethamine, 0.1-0.2 ww / % sodium acetate trihydrate and 6-10 w / w% sucrose, with a pH of 7-8.

[0035] A second aspect of the present invention provides a method for preparing a composition, wherein the composition is the first composition, the second composition, the third composition, the fourth composition, or a combination of the first composition and the second composition;

[0036] The first composition contains a first plasmid vector;

[0037] The second composition contains a second plasmid vector;

[0038] The third composition contains a combination of the first plasmid vector and the second plasmid vector;

[0039] The fourth composition contains a third plasmid vector;

[0040] The first plasmid vector is capable of expressing the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6;

[0041] The second plasmid vector is capable of expressing the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.8;

[0042] The third plasmid vector is capable of expressing the canine distemper virus fusion protein with an amino acid sequence as shown in SEQ ID NO.6 and the canine distemper virus hemagglutinin protein with an amino acid sequence as shown in SEQ ID NO.8;

[0043] The excipients of the composition include lipid materials and lipid nanoparticle solvents, wherein the lipid materials include cationic lipids, polymer-conjugated lipids, neutral lipids and structural lipids;

[0044] The preparation method of the first composition comprises the following steps:

[0045] S1-1: preparing a first lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent;

[0046] S1-2: using the first plasmid vector as a solute and a plasmid solvent as a solvent to prepare a first plasmid solution;

[0047] S1-3: mixing the first lipid material solution and the first plasmid solution to prepare a first lipid nanoparticle solution;

[0048] S1-4: replacing the lipid solvent and the plasmid solvent in the first lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the first composition;

[0049] The preparation method of the second composition comprises the following steps:

[0050] S2-1: preparing a second lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent;

[0051] S2-2: using the second plasmid vector as a solute and the plasmid solvent as a solvent to prepare a second plasmid solution;

[0052] S2-3: mixing the second lipid material solution and the second plasmid solution to prepare a second lipid nanoparticle solution;

[0053] S2-4: replacing the lipid solvent and the plasmid solvent in the second lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the second composition;

[0054] The preparation method of the third composition comprises the following steps:

[0055] S3-1: preparing a third lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent;

[0056] S3-2: using the first plasmid vector and the second plasmid vector as solutes and a plasmid solvent as a solvent to prepare a third plasmid solution;

[0057] S3-3: mixing the third lipid material solution and the third plasmid solution to prepare a third lipid nanoparticle solution;

[0058] S3-4: replacing the lipid solvent and the plasmid solvent in the third lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the third composition;

[0059] The preparation method of the fourth composition comprises the following steps:

[0060] S4-1: preparing a fourth lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent;

[0061] S4-2: using the third plasmid vector as a solute and the plasmid solvent as a solvent to prepare a fourth plasmid solution;

[0062] S4-3: mixing the fourth lipid material solution and the fourth plasmid solution to prepare a fourth lipid nanoparticle solution;

[0063] S4-4: replacing the lipid solvent and the plasmid solvent in the fourth lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the fourth composition.

[0064] In some embodiments, in the composition, selected from the following situations D1 and D2;

[0065] D1: The coding sequence of the canine distemper virus fusion protein is as shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004;

[0066] The coding sequence of the canine distemper virus hemagglutinin protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839;

[0067] D2: The backbone of the first plasmid vector is a pCAGGS vector;

[0068] The backbone of the second plasmid vector is a pCAGGS vector;

[0069] The backbone of the third plasmid vector is a pCAGGS vector.

[0070] In some embodiments, in the composition, selected from the following situations E1, E2, E3, E4, E5, E6, E7, E8, E9 and E10;

[0071] E1: The pCAGGS vector is a pCAGGS vector with the SV40 replication origin deleted;

[0072] E2: a Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus fusion protein;

[0073] A Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus hemagglutinin protein;

[0074] E3: the molar ratio of the cationic lipid, the polymer-conjugated lipid, the neutral lipid and the structural lipid is 50: 1-2 (including but not limited to any value of 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 or a range between any two values): 5-20 (including but not limited to any value of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or a range between any two values): 20-60 (including but not limited to any value of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60 or a range between any two values);

[0075] In the first composition, the weight ratio of the first plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or the range between any two values):100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0076] In the second composition, the weight ratio of the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or the range between any two values):100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0077] In the third composition, the weight ratio of the first plasmid vector, the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:0.5-2:15-40 (including but not limited to any value of 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40 or a range between any two values):100-10000 (including but not limited to any value of 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or a range between any two values);

[0078] In the fourth composition, the weight ratio of the third plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-50 (including but not limited to any value among 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 45, 50 or the range between any two values): 100-10000 (including but not limited to any value among 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 1000 or the range between any two values);

[0079] E4: The cationic lipid is selected from heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecyloxy)hexyl)amino)octanoate);

[0080] E5: the polymer-conjugated lipid is selected from mPEG-DMG;

[0081] E6: The neutral lipid is selected from distearoylphosphatidylcholine;

[0082] E7: The structural lipid is selected from cholesterol;

[0083] E8: The lipid solvent is ethanol;

[0084] E9: The plasmid solvent is 80-120 mM citric acid buffer solution, pH 3.5-4.5;

[0085] E10: The lipid nanoparticle solvent is an aqueous solution containing 0.2-03 w / w% tromethamine, 0.1-0.2 w / w% sodium acetate trihydrate and 6-10 w / w% sucrose, with a pH of 7-8.

[0086] The third aspect of the present invention provides a biomaterial, wherein the biomaterial is selected from the following F1, F2, F3, F4, F5, F6 and F7;

[0087] F1: Protein

[0088] The protein is a first protein, a second protein, or a combination of the first protein and the second protein;

[0089] The amino acid sequence of the first protein is shown in SEQ ID NO.6;

[0090] The amino acid sequence of the second protein is shown in SEQ ID NO.8;

[0091] F2: fusion protein

[0092] The fusion protein is the first fusion protein, the second fusion protein, or a combination of the first fusion protein and the second fusion protein;

[0093] The amino acid sequence of the first fusion protein contains the amino acid sequence shown in SEQ ID NO.6 and a tag peptide and / or a signal peptide for separating and purifying the protein;

[0094] The amino acid sequence of the second fusion protein contains the amino acid sequence shown in SEQ ID NO.8 and a tag peptide and / or a signal peptide for separating and purifying the protein;

[0095] F3: Gene

[0096] The gene is the first gene, the second gene, or a combination of the first gene and the second gene;

[0097] The coding sequence of the first gene is capable of encoding the first protein described in F1 or the first fusion protein described in F2;

[0098] The coding sequence of the second gene is capable of encoding the second protein described in F1 or the second fusion protein described in F2;

[0099] F4: RNA

[0100] The RNA is a first RNA, a second RNA, or a combination of the first RNA and the second RNA;

[0101] The first RNA can be translated to produce the first protein described in F1 or the first fusion protein described in F2;

[0102] The second RNA can be translated to produce the second protein described in F1 or the second fusion protein described in F2;

[0103] F5: Genetic Engineering Vector

[0104] The genetic engineering vector is a first genetic engineering vector, a second genetic engineering vector, a third genetic engineering vector, or a combination of the first genetic engineering vector and the second genetic engineering vector;

[0105] The first genetic engineering vector contains a gene expression cassette encoding the first protein described in F1 or the first fusion protein described in F2;

[0106] The second genetic engineering vector contains a gene expression cassette encoding the second protein described in F1 or the second fusion protein described in F2;

[0107] The third genetic engineering vector contains a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette encodes the first protein described in F1 or the first fusion protein described in F2, and the second gene expression cassette encodes the second protein described in F1 or the second fusion protein described in F2;

[0108] F6: Cell

[0109] The cell is a first cell, a second cell, a third cell, or a combination of the first cell and the second cell;

[0110] The first cell contains the first genetic engineering vector described in F5;

[0111] The second cell contains the second genetic engineering vector described in F5;

[0112] The third cell contains the third genetic engineering vector described in F5;

[0113] F7: Reagent Kit

[0114] The kit is a first kit, a second kit, a third kit, or a combination of the first kit and the second kit;

[0115] The first kit contains the first protein described in F1, the first fusion protein described in F2, the first RNA described in F4, the first genetic engineering vector described in F5 or the first cell described in F6;

[0116] The second kit contains the second protein described in F1, the second fusion protein described in F2, the second RNA described in F4, the second genetic engineering vector described in F5 or the second cell described in F6;

[0117] The third kit contains the third genetic engineering vector described in F5 or the third cell described in F6.

[0118] In some embodiments, in the biomaterial, the following G1, G2, G3 and G4 are selected;

[0119] G1: the coding sequence of the first protein is as shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004;

[0120] The coding sequence of the second protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839;

[0121] G2: The backbone vector of the first genetic engineering vector is the pCAGGS vector with the SV40 replication origin deleted;

[0122] The backbone vector of the second genetic engineering vector is a pCAGGS vector with a deleted SV40 replication origin;

[0123] The backbone vector of the third genetic engineering vector is a pCAGGS vector with a deleted SV40 replication origin;

[0124] G3: In the first genetic engineering vector, a Kozak sequence is introduced at the 5' end of the coding sequence of the first protein or the first fusion protein;

[0125] In the second genetic engineering vector, a Kozak sequence is introduced at the 5' end of the coding sequence of the second protein or the second fusion protein;

[0126] In the third genetic engineering vector, a Kozak sequence is introduced into the 5' end of the coding sequence of the first protein or the first fusion protein; a Kozak sequence is introduced into the 5' end of the coding sequence of the second protein or the second fusion protein;

[0127] G4: The host cell of the first cell is Escherichia coli;

[0128] The host cell of the second cell is Escherichia coli;

[0129] The host cell of the third cell is Escherichia coli.

[0130] The fourth aspect of the present invention provides use of the composition described in the first aspect of the present invention or the biomaterial described in the third aspect of the present invention in the preparation of a preparation for preventing, alleviating and / or controlling canine distemper in animals.

[0131] In some embodiments, the animal is selected from the group consisting of dogs, minks, foxes, raccoon dogs, giant pandas, tigers, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0132] Figure 1The construction principles and identification results of the recombinant plasmids p17F and p17H are shown. Scale bars represent 400 μm. (A) Schematic diagram of the construction of the recombinant plasmids p17F and p17H; (B) Double enzyme digestion (Kpn I and Nhe I) identification of the recombinant plasmids p17F and p17H; (C) Western blot identification of the recombinant plasmids p17F and p17H, with a PBS control; (D) Indirect immunofluorescence expression identification of the recombinant plasmids p17F and p17H, with a PBS control.

[0133] Figure 2 The results of IFA identification of the in vitro activity of DNA-LNP preparations are shown. The scale bar in the figure represents 400 μm.

[0134] Figure 3 Figure 3. Comparison of the safety and immunogenicity of naked plasmid and DNA-LNP vaccine candidates in mice. (A) Body weight changes of mice within 21 days after primary immunization; (B) Serum Nab titers of mice at different time points after primary immunization.

[0135] Figure 4 Figure 2 shows the safety and immunogenicity assessment results of mice immunized with the DNA-LNP candidate vaccine. (A) Changes in mouse serum IL-2 levels; (B) Changes in mouse serum IL-4 levels; (C) Changes in mouse serum IFN-γ levels; (D) Changes in mouse serum TNF-α levels; (E) Serum Nab titers at different time points after primary immunization; (F) Changes in mouse body weight within 21 days after primary immunization.

[0136] Figure 5 The results of the CDV Nab comparison of the p17F / H-LNP candidate vaccine and MLV-immunized dogs are shown.

[0137] Figure 6 The results of CDV Nab control in foxes and raccoon dogs immunized with the p17F / H-LNP candidate vaccine are shown. (A) Nab titers in fox serum at different time points after primary immunization; (B) Nab titers in raccoon dog serum at different time points after primary immunization. DETAILED DESCRIPTION

[0138] To make the objectives, technical solutions and advantages of the present invention more clear, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.

[0139] Materials and instruments not described in the present invention are conventional materials and instruments in the field. Operation details not described in the present invention are conventional operations in the field. The software used in the present invention is operated by conventional methods with reference to the instructions of the software provider. The kit used in the present invention is operated by conventional methods with reference to the kit instruction manual.

[0140] The nucleic acid sequences shown in the present invention are written from left to right in the direction of 5' to 3', and the protein sequences are written from left to right in the direction of N-terminus to C-terminus.

[0141] During the passage of the canine distemper virus (CDV) HLJ17 strain, the transcriptional regulatory activity of all genes in the genome, the transcriptional initiation and termination of all genes in the genome, the amino acid sequence of proteins encoded by all genes in the genome, the clinical pathogenicity of the virus, the immunogenicity of the virus, and the reproductive capacity of the virus remained unchanged compared to the canine distemper virus (CDV) HLJ17 strain. This includes but is not limited to the following:

[0142] During the passage of the CDV HLJ17 strain, the viral reproductive capacity did not change, which mainly refers to the absence of any mutations in the genomic sequence and the maintenance of the original reproductive capacity (no mutation-induced lethality, etc.), or the slight change in reproductive capacity is within the error range of the detection system of conventional technology or the degree of change that cannot be detected according to conventional technology. According to common sense in the art, even for two progeny viruses isolated from a monoclonal plaque of the CDV HLJ17 strain, the results of the reproductive capacity index measurement will have systematic errors, and there will be certain differences in the measurements of different batches or different operators. Obviously, minor genetic mutations inevitably occur during the passage of the virus. Synonymous mutations in the coding sequence or minor mutations in the non-coding region of the genome that are not involved in the genetic regulation of the virus do not affect the reproductive capacity of the virus or its biological activity. This passaged strain falls within the scope of the substantial technical contribution of CDV HLJ17 and is the inevitable reasonable variation range of the direct technical contribution of the present invention. This range will minimize the obvious separation between the content protected by the patent, the content of actual use, and the content defined in the claims. Similarly, no change in the clinical pathogenicity and immunogenicity of the virus also means that it does not exceed the systematic error of the detection method, the difference is not statistically significant, or the difference value is slightly higher than, approximately equal to, or less than the standard deviation of the measurement method.

[0143] During the propagation of the CDV HLJ17 strain, the transcriptional regulatory activity of all genes did not change. This mainly refers to the fact that the pattern of all transcriptional regulatory elements accepting endogenous viral or host-derived gene expression regulation did not change, the pattern of responding to external signals did not undergo detectable changes, and the host signal transduction pathways and metabolic regulation patterns in which the virus participated did not undergo detectable changes. Minor mutations that did not participate in regulation, such as minor changes in non-coding new sequence bases, did not affect the expression regulation pattern of the corresponding genes, and fell within the range of no change in transcriptional regulatory activity.

[0144] During the passage of CDV HLJ17 strain virus, the transcription initiation and transcription termination of all genes did not change, which mainly means that the expression regulation pattern of the genes did not change, and there was no detectable significant change in the transcription regulation of the genes.

[0145] During the propagation of the CDV HLJ17 strain virus, the amino acid sequences of all proteins did not change. This mainly means that during the propagation of the strain, the amino acid sequences of all proteins did not change. Synonymous mutations of genes will not affect gene function, and mutations during the virus propagation process are inevitable. Therefore, the progeny viruses whose amino acid sequences of all proteins have not changed are still within the scope of the technical contribution of the preserved strain.

[0146] Example 1. Acquisition and identification of canine distemper virus HLJ17 strain

[0147] (1) Cases

[0148] Puppies at a dog farm in Heilongjiang Province fell ill with symptoms including high fever, depression, mucus and eye discharge, and later neurological symptoms. Based on these symptoms, they were suspected of having canine distemper.

[0149] (2) Virus isolation

[0150] Take nose and eye swabs from sick dogs, add sterile cold physiological saline to the swabs, shake thoroughly, filter with a 0.45 μm filter, collect the filtrate, add filter-sterilized penicillin and streptomycin to a final concentration of 1000 IU / ml and 1000 μg / ml, and divide into aliquots to obtain mixed solution a.

[0151] The above-mentioned mixed solution a was inoculated onto Vero cells for isolation and culture. The culture medium was DMEM containing 2v / v% newborn calf serum, and the inoculum size was 1v / v%. The cells were placed in a 37°C, 5% CO2 incubator and observed. No visible cytopathic effect was observed in the blind passage for 3 generations. When the cells were blind passaged to the 5th generation, spider cytopathic effect appeared in the cells. On this basis, the cells were further expanded for 1 generation and 200ml of cell culture solution a was collected for co-cultivation as virus seed. Most of the cells were freeze-dried after adding a sucrose skim milk protective agent for preservation. The virus contained in the cell culture solution a is called strain HLJ17 (canine distemper virus HLJ17 strain, CDV HLJ17 strain).

[0152] (3) Molecular biological identification

[0153] With reference to conserved sequences among canine distemper virus strains, primers FF (SEQ ID NO. 1) and RF (SEQ ID NO. 2) with the following sequences were designed for the canine distemper virus fusion protein gene (F gene). Primers FH (SEQ ID NO. 3) and RH (SEQ ID NO. 4) with the following sequences were designed for the canine distemper virus hemagglutinin protein gene (H gene). PCR amplification of strain HLJ17 from cell culture supernatant a was performed using the above two primer pairs, and the amplified products were sequenced by Sanger sequencing to obtain the coding sequences of the F and H genes.

[0154] FF:GTCATGCACAACAAAATC

[0155] RF:GCTTCAGAGTGATCTTACAT

[0156] FH:GTCATGCTCTCCTACCAAG

[0157] RH:GTCTCAAGGTTTTGAACGG

[0158] The coding sequence of the F gene is as follows (SEQ ID NO.5):

[0159]

[0160] The protein sequence of the F gene is as follows (SEQ ID NO.6):

[0161] MHNKIPNKSKPLPHTRQDPLQQHSTRSTETKISQGRYSITSAQRSTYYSPQTLDRSVHYIMNRTRSCKQTSHGSNNIPPHRDHEGIIHHTPESVTQGASSWFKRWQSNATNAGSQCTWLVLWCIGIASLFLCSKAQIHWNNLSTIGIIGTDSVHYKIMTRPSHQYLVIKLMPNVSLIDNCTKAELGEYEKLLNSVLEPINQALTLMTNNVKPLQSVGSGRRQRRFAGVVLAGAALGVATAAQITAGIALHQSNLNAQAIQSLRASLEQSNKAIEEIREATQETVIAVQGVQDYVNNELVPAMQHMSCELVGQRLGLKLLRYYTELLSIFGPSLRDPISAEISIQALSYALGGEIHKILEKLGYSGNDMIAILESRGIKTKITHVDLPGKLIILSISYPTLSEVKGVIVHRLEAVSYNIGSQEWYTTVPKYVATNGYLISNFDESSCVFVSESAICSQNSLYPMSPILQQCIRGDTSSCARTLVSGTMGNKFILSKGNIVANCASILCKCYSTSTIINQSPDKLLTFIASDTCPLVEIDGVTIQVGGRQYPDMVYESKVALGPAISLERLDVGTNLGNALKKLDDAKVLIDSSNQILETVKRSSFNFGSLLSVPILICTALALLLLIYCCKRRYRQTFKHNTKVDPTFKPDLTGTSKSYVRSL

[0162] The coding sequence of the H gene is as follows (SEQ ID NO.7):

[0163]

[0164] The protein sequence of the H gene is as follows (SEQ ID NO.8):

[0165] MLSYQDKVGAFYKDNARANSSKLSLVTEEQGGRRPPYLLFVLLILLIGILVLLAITGVRFHQVSTSNMEFSRLLKEDMEKSEAVHHQVIDVLTPLFKIIGDEIGLRLPQKLNEIKQFILQKTNFFNPNREFDFRDLHWCINPPSKIKVNFTNYCDTVGVKKSLASAANPIILSALSVARGDIFPPYRCSGATTSVGRVFPLSVSLSMSLISRTSEIINMLTAISDGVYGKTYLLVPDYIEGEFDSQKIRVFEIGFIKRWLNDMPLLQTTNYMVLPETSKAKVCTIAVGELTLASLCVDESTVLLYHDSNGSQDGILVVTLGIFGATPMDQVEEVIPIAHPSVERIHITNHRGFIKDSIVTWMVPVLVSEKQEEQKNCLESACHRKSYPMCNQTSWEPFGGGQLPSYGRLTLPLDPSIDLQLNISFTYGPVILNGDGMDYYESPLLDSGWLTIPPKNGTVLGLINKASRGDQFTVTPHVLTFAPRESSGNCYLPIQTSQIMDKDVLTESNLVVLPTQNFRYVIATYDISRGDHAIVYYVYDPIRTISYTYPFRLTTKGRPDFLRIECFVWDDDLWCHQFYRFEANITNSTTSVENLVRIRFSCNRSKP

[0166] (IV) Sequence analysis of the F and H genes of the CDV HLJ17 strain

[0167] Nucleotide sequence homology comparisons of the CDV HLJ17 strain F gene (abbreviated as HLJ17F gene) with those of CDV strains published in Genbank using the BLASTN program revealed that the highest homology was with the CDV NJ19 strain F gene (Genbank: MW086526.1), with a homology of 99.4%. Nucleotide sequence homology comparisons of the CDV HLJ17 strain H gene (abbreviated as HLJ17H gene) with those of CDV strains published in Genbank revealed that the highest homology was with the CDV Th_H strain H gene (Genbank: ON093253.1), with a homology of 99.78%. Sequence analysis of the CDV H gene revealed that HLJ17 is a canine distemper virus type Asia-1.

[0168] Example 2: Construction of recombinant plasmid

[0169] The coding sequences of the HLJ17F and HLJ17H genes were codon-optimized for mammalian preference, and a Kozak sequence (GCCGCCACC) and a KpnI restriction site were introduced at the 5' end, and an NheI restriction site was introduced at the 3' end. HLJ17F gene fragment 17F (SEQ ID NO.9) and HLJ17H gene fragment 17H (SEQ ID NO.10) were designed and synthesized. Figure 1 A.

[0170] The 17F sequence is as follows:

[0171]

[0172]

[0173] Among them, positions 1-6 are KpnI restriction sites, positions 7-15 are Kozak sequences, positions 16-2004 are coding sequences, and positions 2005-2010 are NheI restriction sites.

[0174] The 17H ​​sequence is as follows:

[0175]

[0176]

[0177] Among them, positions 1-6 are KpnI restriction sites, positions 7-15 are Kozak sequences, positions 16-1839 are coding sequences, and positions 1840-1845 are NheI restriction sites.

[0178] Using Kpn I and Nhe I restriction endonucleases and T4 DNA ligase, the 17F fragment and the 17H ​​fragment were cloned into the KanR-resistant pCAGGS△SV40 ori vector (prepared by deleting the SV40 ori from the pCAGGS vector). The recombinant plasmids were named p17F and p17H, respectively. The recombinant plasmids were transformed into competent Escherichia coli DH5α strain and purified using PureLink TM HiPure Plasmid Maxiprep Kit (purchased from Thermo Fisher Scientific, USA) was used for the large-scale extraction and preparation of p17F and p17H.

[0179] p17F and p17H were double-digested with Kpn I and Nhe I, respectively, and the expected size bands appeared in gel electrophoresis ( Figure 1 B).

[0180] According to the instructions of ExFect transfection reagent (purchased from Nanjing Novozyme Biotechnology Co., Ltd.), p17F and p17H were transfected into HEK-293 cells cultured in 6-well plates at a dose of 1 μg / well. The cell confluence was about 80%. Western Blot and indirect immunofluorescence (IFA) identification were performed 48 hours after transfection, and the sample transfected with PBS was used as a control. (1) Canine anti-CDV serum (homemade) was used as the primary antibody, and IRDye 700DX-labeled rabbit anti-canine IgG (purchased from Rockland, USA) was used as the secondary antibody to incubate the cells. The Western Blot images were scanned by Odyssey CLx imaging system. Western Blot detection showed the expected size band ( Figure 1 C). (2) The cells were incubated with canine anti-CDV serum (homemade) as the primary antibody and FITC-labeled rabbit anti-canine IgG (purchased from Abimat Pharmaceutical Technology (Shanghai) Co., Ltd.) as the secondary antibody. The cell nuclei were stained with DAPI and the green fluorescent staining cells of IFA were observed under a fluorescence microscope. The green fluorescent positive cells appeared in IFA detection ( Figure 1 D) The above results indicate that the recombinant plasmids p17F and p17H were successfully constructed and can correctly express the target proteins.

[0181] Example 3: Preparation and identification of DNA-LNP vaccine formulations

[0182] HUO (cationic lipid), Chinese name: heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecyloxy)hexyl)amino)octanoate), was synthesized in-house.

[0183] mPEG-DMG-2K (polyethylene glycol derivative), mPEG-DMG with a molecular weight of 2K (specifically 2526), ​​Chinese name: methoxy-polyethylene glycol-dimyristoyl-racemic-glycerol, CAS number: 160743-62-4, was purchased from Xiamen Sinobond Biotechnology Co., Ltd.

[0184] Auxiliary lipid (neutral phosphatidylcholine) DSPC, Chinese name: distearoylphosphatidylcholine, CAS number: 816-94-4, purchased from MERCK.

[0185] Cholesterol was purchased from Nippon Seika Co., Ltd.

[0186] Lipid nanoparticle DNA (DNA-LNP) vaccines were prepared using microfluidics. Recombinant plasmids p17F and p17H were diluted in 100 mM citric acid-sodium chloride buffer (pH 4.0) to prepare an aqueous phase with a concentration of 328 μg / mL.

[0187] Cationic lipid (HUO), mPEG-DMG-2K, auxiliary lipid DSPC and cholesterol were fully mixed in anhydrous ethanol at a molar ratio of 50:1.5:10:38.5 to prepare a lipid phase with a total concentration of the above four materials of 24 mg / mL.

[0188] Initial LNPs were prepared by mixing the lipid phase and aqueous phase in a 1:3 volume ratio at a total mixing flow rate of 12 mL / min using a rapid nanodrug preparation microfluidic system. The initial LNPs were rinsed with a pH 7.4 Tris-NaAc-sucrose solution dialyzate 3-5 times the volume of the initial LNP to remove components such as ethanol and citric acid-sodium chloride buffer. The resulting filtrate was sterile filtered through a 0.45 + 0.2 μm pore size filter membrane. The filtrate obtained, with the same volume as the initial LNP, was the DNA-LNP preparation p17F-LNP (LNP prepared from plasmid p17F) and p17H-LNP (LNP prepared from plasmid p17H), respectively, and stored below -15°C.

[0189] The preparation method of the pH 7.4 Tris-NaAc-sucrose solution of the present invention is as follows: tromethamine (0.2360%), sodium acetate trihydrate (0.1420%) and sucrose (8.0500%) are weighed according to mass percentage, the final mass is adjusted to 7.4 by purified water.

[0190] The quality of p17F-LNP and p17H-LNP was determined by testing the concentration, particle size and particle size distribution index (PDI), encapsulation efficiency, in vitro activity and other indicators of DNA-LNP preparations [Method reference: Avila M, Alves L, Khosravi M, et al. Molecular Determinants Defining the Triggering Range of Prefusion F Complexes of Canine Distemper Virus [J]. Journal of Virology, 2014, 88 (5): 2951-2966.]. The main steps are as follows: the DNA-LNP preparation was dissolved in a mixture of chloroform / methanol (volume ratio of 1:4) and the concentration of the DNA-LNP preparation was determined by measuring the ultraviolet absorbance at 260 nm. The particle size and particle size distribution index (PDI) of the DNA-LNP preparation were determined by dynamic light scattering (DLS). According to Quant-iT TM The DNA-LNP preparation was treated according to the instructions of the dsDNA HS kit (purchased from Life Technologies, USA), and the fluorescence value was measured at a standard fluorescence wavelength (excitation / emission: 480 nm / 530 nm) using a microplate reader to detect the encapsulation efficiency of the DNA-LNP preparation.

[0191] The three DNA-LNP preparations, p17F-LNP, p17H-LNP, and p17F / H-LNP combination (a mixture of p17F-LNP and p17H-LNP at a DNA weight ratio of 1:1), were inoculated into HEK-293 cells in 6-well plates and then subjected to indirect immunofluorescence. The inoculation doses of the three preparations were 0.5 μg / well, 0.5 μg / well, and 0.5+0.5 μg / well (calculated based on the mass of the plasmid), respectively. The primary antibody for all three preparations was anti-CDV canine polyclonal antibody serum (1:50 dilution), and the secondary antibody for all three preparations was FITC-labeled rabbit anti-canine IgG (1:5000 dilution). Cell nuclei were stained with DAPI, and green fluorescent cells were observed under a fluorescence microscope by IFA. As a control, the ratio of fluorescent-positive cells to total cells was calculated using IMAGE J software to detect the in vitro activity of the DNA-LNP preparations.

[0192] The quality parameters of the DNA-LNP formulations, p17F-LNP and p17H-LNP, were tested. The results showed that the concentrations of p17F-LNP and p17H-LNP were 0.577 mg / mL and 0.719 mg / mL, respectively (both higher than 0.5 mg / mL), with encapsulation efficiencies of 93.2% and 97.2%, respectively. The nanoparticle diameters of p17F-LNP and p17H-LNP were 105 nm and 104 nm, respectively, with particle size distribution indexes (PDIs) of 0.106 and 0.105, respectively.

[0193] p17F-LNP, p17H-LNP and p17F / H-LNP combination preparations were inoculated into HEK-239 cells, and three independent IFA experiments showed that p17F and p17H of the three preparations were effectively expressed ( Figure 2 ) and calculated the ratio of fluorescent-positive cells to total cells using IMAGE J software, confirming that the in vitro activity of all three formulations was greater than 60%. These results demonstrate that the quality of the p17F-LNP, p17H-LNP, and p17F / H-LNP formulations met the expected standards and can be used as candidate vaccine laboratory products for in vivo evaluation.

[0194] Example 4: Mouse Experiment

[0195] (I) Comparison of safety and immunogenicity evaluation of naked plasmid and DNA-LNP candidate vaccines in mice

[0196] p17F and p17H were diluted with PBS to 30 μg / 0.1 mL.

[0197] p17F / H: p17F and p17H were diluted to 60 μg / 0.1 mL with PBS respectively and then mixed in equal volumes.

[0198] p17F-LNP and p17H-LNP were diluted to 30 μg / 0.1 mL with Tris-NaAc-sucrose solution.

[0199] p17F / H-LNP was prepared by diluting p17F-LNP and p17H-LNP to 60 μg / 0.1 mL respectively with Tris-NaAc-sucrose solution and then mixing them in equal volumes.

[0200] The aforementioned masses refer to the mass of plasmid in each mixture.

[0201] To evaluate the safety and immunogenicity of the DNA-LNP formulation, 6-week-old, SPF-grade BALB / c female mice (purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) were divided into seven groups, each containing 6 mice. Each group received intramuscular injections of 0.1 mL of p17F, p17H, p17F-LNP, p17H-LNP, a bivalent formulation of p17F and p17H (p17F / H), and a bivalent formulation of p17F-LNP and p17H-LNP (p17F / H-LNP), respectively. One group received an intramuscular injection of 0.1 mL of PBS as a control (placebo). Twenty-one days after the primary immunization, mice received a secondary immunization with the same dose and vaccine. Body weight changes were recorded for 21 consecutive days after the primary immunization. Blood samples were collected on days 21, 35, and 60, and serum was isolated for CDV neutralizing antibody testing.

[0202] The method for detecting CDV neutralizing antibodies is as follows: the animal serum samples were inactivated in a 56°C water bath for 30 minutes. The inactivated serum was serially diluted 2-fold (dilution factor 1:4 to 1:256) using serum-free DMEM medium. 50 μL of each dilution was mixed with an equal volume of 200 TCID 50 The rCDV-eGFP virus solution (pre-calibrated titer, rCDV-eGFP is formed by transferring the CDV vaccine strain CDV / R-20 / 8 into the expressible EGFP) was mixed in a 96-well plate and incubated at 37°C for 1 hour for neutralization reaction. The virus regression titration control (rCDV-eGFP, synchronous titration TCID 50 ) and blank cell control (Vero cells without virus and serum). Then 1×10 5 Vero cells were cultured in a 5% CO2 incubator at 37°C for 48 hours. Green fluorescent protein expression in each well was observed under a fluorescence microscope. Four replicates were set for each dilution, and the number of wells with or without fluorescent spots was recorded. The titer of each replicate was calculated based on the highest dilution without green fluorescence. Serum neutralization titers were calculated using the Reed & Muench method, and data were statistically analyzed using GraphPad Prism 9.0.

[0203] All mice immunized with DNA-LNP preparations showed no abnormal behavior or facial movements during the 21-day observation period, including eye socket tightening, nose bulging, changes in ear posture and whisker position, and redness and swelling at the immunization site. There was no significant difference in body weight changes compared with mice immunized with naked plasmid DNA preparations and mice in the PBS control group, and the body weight loss did not exceed 10% ( Figure 3A). Both DNA-LNP and naked plasmid DNA can induce CDV neutralizing antibodies (NAb) in mice, and the Nab titer increased after the second immunization. On the 60th day after immunization, the Nab titer of the DNA-LNP group was 8.17-10.28 log2, while that of the naked plasmid DNA group was 3.08-4.61 log2. During the 60-day monitoring period, the NAb level in the DNA-LNP immunization group was significantly higher than that in the naked plasmid DNA group ( Figure 3 B). The combined formulation p17F / H-LNP induced significantly higher NAb levels than the p17F-LNP and p17H-LNP formulations on days 21 and 35 after immunization ( Figure 3 B) These results indicate that the DNA-LNP vaccine candidate is safe in mice and has a significantly higher level of immunogenicity than naked plasmid.

[0204] (II) Safety and immunogenicity evaluation of DNA-LNP candidate vaccines in mice

[0205] p17F-LNP and p17H-LNP were diluted to 10 μg / 0.1 mL with Tris-NaAc-sucrose solution.

[0206] p17F / H-LNP was prepared by diluting p17F-LNP and p17H-LNP to 20 μg / 0.1 mL respectively with Tris-NaAc-sucrose solution and then mixing them in equal volumes.

[0207] The aforementioned masses refer to the mass of plasmid in each mixture.

[0208] To determine the immunogenicity of the DNA-LNP formulation at the applied dose, 6-week-old, SPF-grade BALB / c female mice were divided into four groups of 6 mice each. Three groups of mice were inoculated intramuscularly with 0.1 mL of p17F-LNP, p17H-LNP, or p17F / H-LNP, respectively. One group of mice served as a control group (Placebo). Twenty-one days after the initial immunization, mice received a secondary immunization with the same dose and vaccine. Body weight changes were recorded for 21 consecutive days after the initial immunization. Blood was collected at different time points after immunization, and serum was isolated for CDV neutralizing antibody detection using the same method as above. Cytokine responses were assessed using mouse TNF-α and mouse IFN-γ ELISA kits purchased from Shenzhen Xinbosheng Biotechnology Co., Ltd.; mouse IL-2 and mouse IL-4 ELISA kits were purchased from Thermo Fisher Scientific.

[0209] The cytokine levels in serum were detected on days 14, 21, 35, and 49 after the initial immunization. Compared with the Placebo group, the cytokine levels in the DNA-LNP preparation immunization group were significantly increased, including IL-2 ( Figure 4 A), IL-4 ( Figure 4 B), IFN-γ ( Figure 4 C) and TNF-α ( Figure 4 D). After completing two immunization procedures 21 days apart, the DNA-LNP group induced high levels of NAb during the 120-day monitoring period. On day 120, the NAb titers of the p17F-LNP, p17H-LNP, and p17F / H-LNP groups were 6.56 log2, 4.94 log2, and 7.39 log2, respectively. Figure 4 E). Compared with p17F-LNP or p17H-LNP, p17F / H-LNP showed significantly higher Nab levels at different time points after immunization. At the same time, the immunized mice did not show abnormalities in immunization sites and facial movements, and the weight changes during the 21-day observation period were not significantly different from those of the PBS control group mice ( Figure 4 F) The above results indicate that the p17F / H-LNP preparation is safe and highly immunogenic in mice when administered at 10 μg twice, on days 0 and 21.

[0210] Example 5: Dog Experiment

[0211] p17F / H-LNP was prepared by diluting p17F-LNP and p17H-LNP to 200 μg / 0.1 mL respectively with Tris-NaAc-sucrose solution and then mixing them in equal volumes.

[0212] The aforementioned masses refer to the mass of plasmid in each mixture.

[0213] Ten three-month-old CDV antibody-negative beagle dogs (purchased from the Xilingjiao Breeding Center in Jinan) were randomly divided into two groups of five dogs each. Five dogs were vaccinated intramuscularly with 100 μg of a bivalent p17H-LNP formulation (p17F / H-LNP), and five dogs were vaccinated intramuscularly with 1 mL of a commercially available live attenuated CD vaccine (MLV). Twenty-one days after the initial immunization, the dogs received a second immunization with the same dose and vaccine, and the MLV group received a third dose on day 120. The dogs' clinical status was observed daily, and blood was collected at time points for 300 days after the initial immunization. Serum was isolated and tested for CDV neutralizing antibodies (using the same method as in Example 4).

[0214] Beagle dogs were immunized with the p17F / H-LNP candidate vaccine at a dose of 100 μg to explore the immunogenicity of the p17F / H-LNP candidate vaccine in dogs, and the commercial vaccine MLV was used as a parallel control. Both the p17F / H-LNP formulation and MLV induced CDV NAb responses on day 14 after immunization. After the booster immunization on day 21, the p17F / H-LNP maintained a high level of Nab levels during the 300-day immune monitoring period, with titers of 8.63 log2 and 8.43 log2 on days 120 and 300, respectively, while the Nab level of the MLV group dropped to 6.07 log2 on day 120, which was significantly lower than that of the p17F / H-LNP group. In order to synchronously compare the duration of immunity of the two vaccines, a third MLV immunization was performed on day 120. The Nab titer of the MLV group showed a downward trend on day 300 after immunization, and was significantly lower than that of the p17F / H-LNP group on days 180 and 300 ( Figure 5 All dogs vaccinated with the p17F / H-LNP formulation showed no abnormalities in diet, behavior, or vaccination site during the 300-day monitoring period. These results demonstrate that the p17F / H-LNP formulation is safe for dogs and can induce high-level neutralizing antibody responses that last for more than 300 days, suggesting its potential for development as a canine CD vaccine.

[0215] Example 6: Fox and raccoon dog experiment

[0216] p17F / H-LNP was prepared by diluting p17F-LNP and p17H-LNP to 200 μg / 1 mL respectively with Tris-NaAc-sucrose solution and then mixing them in equal volumes.

[0217] The aforementioned masses refer to the mass of plasmid in each mixture.

[0218] Four CDV antibody-negative foxes aged 4-6 months and four CDV antibody-negative raccoon dogs aged 4-6 months were purchased from Jishuntai Farm in Daoli District, Harbin. The foxes and raccoon dogs were each vaccinated intramuscularly with 1 mL of a bivalent p17H-LNP formulation (p17F / H-LNP). Twenty-one days after the initial immunization, a secondary immunization with the same dose and vaccine was performed. The animals were observed clinically daily, and blood was collected 14, 21, and 35 days after the initial immunization. Serum was isolated and tested for CDV neutralizing antibodies (using the same method as in Example 4).

[0219] Foxes and raccoon dogs were selected as CDV-susceptible wild animals to evaluate the immunogenicity of the p17F / H-LNP formulation. The p17F / H-LNP candidate vaccine was immunized. Foxes and raccoon dogs immunized with a 100 μg dose of p17F / H-LNP induced the production of Nab on day 14 after the initial immunization. On day 21, the Nab titers of foxes and raccoon dogs were 5.00 log2 and 3.79 log2, respectively. After the second immunization on day 21, the Nab levels of foxes and raccoon dogs increased significantly, and on day 35, their Nab titers were 6.79 log2 and 7.04 log2, respectively. Figure 6 All animals showed no abnormalities in diet, behavior, or vaccination site after two immunizations. These results demonstrate that the p17F / H-LNP formulation is safe and immunogenic in foxes and raccoon dogs, and has the potential to be used as a CD vaccine for fur-bearing animals such as foxes and raccoon dogs.

[0220] It is understood from common technical knowledge that the present invention may be implemented by other embodiments that do not depart from its spirit or essential features. Therefore, the embodiments disclosed above are, in all respects, merely illustrative and not exclusive. All modifications within the scope of the present invention or equivalent to the scope of the present invention are intended to be encompassed by the present invention.

Claims

1. A composition, which is the first composition, the second composition, the third composition, the fourth composition, or a combination of the first composition and the second composition; The first composition contains a first plasmid vector; The second composition contains a second plasmid vector; The third composition contains a combination of the first plasmid vector and the second plasmid vector; The fourth composition contains a third plasmid vector; The first plasmid vector is capable of expressing the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6; The second plasmid vector is capable of expressing the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.8; The third plasmid vector can express the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6 and the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.

8.

2. The composition according to claim 1, wherein In the composition, selected from the following situations A1, A2 and A3; A1: The coding sequence of the canine distemper virus fusion protein is shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004; The coding sequence of the canine distemper virus hemagglutinin protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839; A2: The backbone of the first plasmid vector is pCAGGS vector; The backbone of the second plasmid vector is a pCAGGS vector; The backbone of the third plasmid vector is a pCAGGS vector. A3: The composition further contains excipients.

3. The composition according to claim 2, wherein In the composition, selected from the following cases B1, B2 and B3; B1: The pCAGGS vector is a pCAGGS vector with the SV40 replication origin deleted; B2: a Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus fusion protein; A Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus hemagglutinin protein; B3: The excipients of the composition include lipid materials and lipid nanoparticle solvents, and the lipid materials include cationic lipids, polymer-conjugated lipids, neutral lipids and structural lipids.

4. The composition according to claim 3, wherein In the composition, selected from the following C1, C2, C3, C4, C5 and C6; C1: the molar ratio of the cationic lipid, the polymer-conjugated lipid, the neutral lipid and the structural lipid is 50:1-2:5-20:20-60; In the first composition, the weight ratio of the first plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40:100-10000; In the second composition, the weight ratio of the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40:100-10000; In the third composition, the weight ratio of the first plasmid vector, the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:0.5-2:15-40:100-10000; In the fourth composition, the weight ratio of the third plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-50:100-10000; C2: The cationic lipid is selected from heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecanoxy)hexyl)amino)octanoate); C3: the polymer conjugated lipid is selected from mPEG-DMG; C4: the neutral lipid is selected from distearoylphosphatidylcholine; C5: the structural lipid is selected from cholesterol; C6: The lipid nanoparticle solvent is an aqueous solution containing 0.2-0.3 w / w% tromethamine, 0.1-0.2 ww / % sodium acetate trihydrate and 6-10 w / w% sucrose, with a pH of 7-8.

5. A method for preparing a composition, wherein the composition is the first composition, the second composition, the third composition, the fourth composition, or a combination of the first composition and the second composition; The first composition contains a first plasmid vector; The second composition contains a second plasmid vector; The third composition contains a combination of the first plasmid vector and the second plasmid vector; The fourth composition contains a third plasmid vector; The first plasmid vector is capable of expressing the canine distemper virus fusion protein whose amino acid sequence is shown in SEQ ID NO.6; The second plasmid vector is capable of expressing the canine distemper virus hemagglutinin protein whose amino acid sequence is shown in SEQ ID NO.8; The third plasmid vector is capable of expressing the canine distemper virus fusion protein with an amino acid sequence as shown in SEQ ID NO.6 and the canine distemper virus hemagglutinin protein with an amino acid sequence as shown in SEQ ID NO.8; The excipients of the composition include lipid materials and lipid nanoparticle solvents, wherein the lipid materials include cationic lipids, polymer-conjugated lipids, neutral lipids and structural lipids; The preparation method of the first composition comprises the following steps: S1-1: preparing a first lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent; S1-2: using the first plasmid vector as a solute and a plasmid solvent as a solvent to prepare a first plasmid solution; S1-3: mixing the first lipid material solution and the first plasmid solution to prepare a first lipid nanoparticle solution; S1-4: replacing the lipid solvent and the plasmid solvent in the first lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the first composition; The preparation method of the second composition comprises the following steps: S2-1: preparing a second lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent; S2-2: using the second plasmid vector as a solute and the plasmid solvent as a solvent to prepare a second plasmid solution; S2-3: mixing the second lipid material solution and the second plasmid solution to prepare a second lipid nanoparticle solution; S2-4: replacing the lipid solvent and the plasmid solvent in the second lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the second composition; The preparation method of the third composition comprises the following steps: S3-1: preparing a third lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent; S3-2: using the first plasmid vector and the second plasmid vector as solutes and a plasmid solvent as a solvent to prepare a third plasmid solution; S3-3: mixing the third lipid material solution and the third plasmid solution to prepare a third lipid nanoparticle solution; S3-4: replacing the lipid solvent and the plasmid solvent in the third lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the third composition; The preparation method of the fourth composition comprises the following steps: S4-1: preparing a fourth lipid material solution using the cationic lipid, the polymer-conjugated lipid, the neutral lipid, and the structural lipid as solutes and a lipid solvent as a solvent; S4-2: using the third plasmid vector as a solute and the plasmid solvent as a solvent to prepare a fourth plasmid solution; S4-3: mixing the fourth lipid material solution and the fourth plasmid solution to prepare a fourth lipid nanoparticle solution; S4-4: replacing the lipid solvent and the plasmid solvent in the fourth lipid nanoparticle solution with the lipid nanoparticle solvent to obtain the fourth composition.

6. The preparation method according to claim 5, wherein In the composition, selected from the following situations D1 and D2; D1: The coding sequence of the canine distemper virus fusion protein is as shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004; The coding sequence of the canine distemper virus hemagglutinin protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839; D2: The backbone of the first plasmid vector is a pCAGGS vector; The backbone of the second plasmid vector is a pCAGGS vector; The backbone of the third plasmid vector is a pCAGGS vector.

7. The composition according to claim 5 or 6, wherein In the composition, selected from the following situations E1, E2, E3, E4, E5, E6, E7, E8, E9 and E10; E1: The pCAGGS vector is a pCAGGS vector with the SV40 replication origin deleted; E2: a Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus fusion protein; A Kozak sequence is introduced into the 5' end of the coding sequence of the canine distemper virus hemagglutinin protein; E3: the molar ratio of the cationic lipid, the polymer-conjugated lipid, the neutral lipid and the structural lipid is 50:1-2:5-20:20-60; In the first composition, the weight ratio of the first plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40:100-10000; In the second composition, the weight ratio of the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-40:100-10000; In the third composition, the weight ratio of the first plasmid vector, the second plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:0.5-2:15-40:100-10000; In the fourth composition, the weight ratio of the third plasmid vector, the lipid material and the lipid nanoparticle solvent is 1:15-50:100-10000; E4: The cationic lipid is selected from heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((undecyloxy)hexyl)amino)octanoate); E5: the polymer-conjugated lipid is selected from mPEG-DMG; E6: The neutral lipid is selected from distearoylphosphatidylcholine; E7: The structural lipid is selected from cholesterol; E8: The lipid solvent is ethanol; E9: The plasmid solvent is 80-120 mM citric acid buffer solution, pH 3.5-4.5; E10: The lipid nanoparticle solvent is an aqueous solution containing 0.2-03 w / w% tromethamine, 0.1-0.2 w / w% sodium acetate trihydrate and 6-10 w / w% sucrose, with a pH of 7-8.

8. A biomaterial selected from the group consisting of F1, F2, F3, F4, F5, F6 and F7; F1: Protein The protein is a first protein, a second protein, or a combination of the first protein and the second protein; The amino acid sequence of the first protein is shown in SEQ ID NO.6; The amino acid sequence of the second protein is shown in SEQ ID NO.8; F2: fusion protein The fusion protein is the first fusion protein, the second fusion protein, or a combination of the first fusion protein and the second fusion protein; The amino acid sequence of the first fusion protein contains the amino acid sequence shown in SEQ ID NO.6 and a tag peptide and / or a signal peptide for separating and purifying the protein; The amino acid sequence of the second fusion protein contains the amino acid sequence shown in SEQ ID NO.8 and a tag peptide and / or a signal peptide for separating and purifying the protein; F3: Gene The gene is the first gene, the second gene, or a combination of the first gene and the second gene; The coding sequence of the first gene is capable of encoding the first protein described in F1 or the first fusion protein described in F2; The coding sequence of the second gene is capable of encoding the second protein described in F1 or the second fusion protein described in F2; F4: RNA The RNA is a first RNA, a second RNA, or a combination of the first RNA and the second RNA; The first RNA can be translated to produce the first protein described in F1 or the first fusion protein described in F2; The second RNA can be translated to produce the second protein described in F1 or the second fusion protein described in F2; F5: Genetic Engineering Vector The genetic engineering vector is a first genetic engineering vector, a second genetic engineering vector, a third genetic engineering vector, or a combination of the first genetic engineering vector and the second genetic engineering vector; The first genetic engineering vector contains a gene expression cassette encoding the first protein described in F1 or the first fusion protein described in F2; The second genetic engineering vector contains a gene expression cassette encoding the second protein described in F1 or the second fusion protein described in F2; The third genetic engineering vector contains a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette encodes the first protein described in F1 or the first fusion protein described in F2, and the second gene expression cassette encodes the second protein described in F1 or the second fusion protein described in F2; F6: Cell The cell is a first cell, a second cell, a third cell, or a combination of the first cell and the second cell; The first cell contains the first genetic engineering vector described in F5; The second cell contains the second genetic engineering vector described in F5; The third cell contains the third genetic engineering vector described in F5; F7: Reagent Kit The kit is a first kit, a second kit, a third kit, or a combination of the first kit and the second kit; The first kit contains the first protein described in F1, the first fusion protein described in F2, the first RNA described in F4, the first genetic engineering vector described in F5 or the first cell described in F6; The second kit contains the second protein described in F1, the second fusion protein described in F2, the second RNA described in F4, the second genetic engineering vector described in F5 or the second cell described in F6; The third kit contains the third genetic engineering vector described in F5 or the third cell described in F6.

9. The biomaterial according to claim 8, wherein Among the biological materials, the following G1, G2, G3 and G4 were selected; G1: the coding sequence of the first protein is as shown in SEQ ID NO.5 or SEQ ID NO.9 from position 16 to position 2004; The coding sequence of the second protein is shown in SEQ ID NO.7 or SEQ ID NO.10 from position 16 to position 1839; G2: The backbone vector of the first genetic engineering vector is the pCAGGS vector with the SV40 replication origin deleted; The backbone vector of the second genetic engineering vector is a pCAGGS vector with a deleted SV40 replication origin; The backbone vector of the third genetic engineering vector is a pCAGGS vector with a deleted SV40 replication origin; G3: In the first genetic engineering vector, a Kozak sequence is introduced at the 5' end of the coding sequence of the first protein or the first fusion protein; In the second genetic engineering vector, a Kozak sequence is introduced at the 5' end of the coding sequence of the second protein or the second fusion protein; In the third genetic engineering vector, a Kozak sequence is introduced into the 5' end of the coding sequence of the first protein or the first fusion protein; a Kozak sequence is introduced into the 5' end of the coding sequence of the second protein or the second fusion protein; G4: The host cell of the first cell is Escherichia coli; The host cell of the second cell is Escherichia coli; The host cell of the third cell is Escherichia coli.

10. Use of the composition according to any one of claims 1 to 5 or the biomaterial according to claim 8 or 9 in the preparation of a preparation for preventing, alleviating and / or controlling canine distemper in animals.

11. The use according to claim 10, characterized in that The animal is selected from dogs, minks, foxes, raccoon dogs, giant pandas, tigers and the like.

Images