Microgel based on acrylic anhydride gelatin and nucleic acid to be detected as well as preparation and application of microgel

Abstract

The invention relates to the technical field of droplet digital nucleic acid detection and biological materials, in particular to microgel based on acrylic anhydride gelatin and nucleic acid to be detected as well as preparation and application of the microgel. The preparation method comprises the following steps: firstly, dissolving a photoinitiator and acrylic anhydride gelatin, and uniformly mixing to obtain a pre-polymerized solution; uniformly mixing the pre-polymerized solution with a to-be-detected nucleic acid mixed solution to obtain a dispersion phase; oil incompatible with the dispersed phase is used as a continuous phase; building a constant-temperature device, and enabling the dispersed phase to form liquid drops by using a liquid drop microfluidic method; and finally, performing amplification treatment on the liquid drops, and then performing photo-initiation crosslinking to obtain the microgel based on the acrylic anhydride gelatin and the nucleic acid to be detected. The prepared microgel based on the acrylic anhydride gelatin and the nucleic acid to be detected is further applied to detection of target nucleic acid.

Description

Technical Field

[0001] The present invention relates to the field of droplet digital nucleic acid detection and biomaterial technology, in particular to a microgel based on acrylic anhydride gelatin and nucleic acid to be detected, and the preparation and application thereof. Background Art

[0002] The commercial success of droplet digital PCR (ddPCR) systems demonstrates the broad market potential of digital droplet nucleic acid detection technology. However, there are still areas for improvement. In particular, droplet instability (merging, breakage) during the process (heating and transfer) can lead to erroneous detection results and nucleic acid product contamination, resulting in false positives, which can be devastating for the entire detection process. Droplet digital loop-mediated isothermal amplification (ddLAMP) is a highly sensitive, rapid, constant-temperature, and absolutely quantitative nucleic acid detection method that has been widely used in pathogen detection, genetic disease screening, and environmental monitoring. Compared to ddPCR, ddLAMP boasts faster nucleic acid amplification, resulting in shorter detection times. Furthermore, the entire process is constant temperature, simplifying equipment requirements and reducing droplet instability caused by temperature fluctuations. Although ddLAMP has achieved some improvements in droplet stability, the risk of droplet merging and breakage during heating still exists, limiting its application and hindering downstream applications after droplet amplification, such as sample preparation for single-cell genetic testing.

[0003] Currently, the common approach to maintaining droplet stability in droplet digital nucleic acid detection is to increase the amount of surfactant and optimize the structure of the heating chamber. However, literature indicates that increasing surfactant concentration inhibits nucleic acid amplification efficiency. Furthermore, excessive surfactant use can further increase testing costs. The specialized design of the heating chamber also increases testing costs, and the risk of droplet fusion and breakage during post-amplification manipulation remains. Currently, some researchers are using microgels to enhance droplet stability in ddLAMP, such as low-melting-point agarose and polyethylene glycol hydrogels cross-linked via thiol Michael addition reactions. However, current hydrogels still present certain challenges. For example, the high viscosity of agarose hinders the preparation of uniform droplets in droplet microfluidic chips. Furthermore, agarose must be heated to a high melting point to dissolve. Because polyethylene glycol hydrogels are cross-linked via chemical reactions, the droplet production process must be completed quickly to avoid channel clogging caused by cross-linking.

[0004] Therefore, there is an urgent need for a hydrogel material suitable for droplet digital nucleic acid detection (including but not limited to ddLAMP) to improve droplet stability. This material needs to have the following advantages: 1) the addition of the material will not affect the efficiency of nucleic acid amplification; 2) the material has low and stable viscosity before cross-linking; 3) the cross-linking method of the material is easy to control. Summary of the Invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a microgel based on acrylic anhydride gelatin and a nucleic acid to be tested, and its preparation and application. The present invention overcomes the problem of droplet instability in ddLAMP technology, which leads to deviation in detection results and nucleic acid product pollution of the environment, and proposes a new technical solution for improving droplet stability (thermal stability, mechanical stability) and preventing nucleic acid amplification product contamination by adding biocompatible materials to nucleic acid amplification reagents. This technical solution must have the performance level of existing droplet digital loop-mediated isothermal amplification technology, and also have the advantages of low material viscosity, controllable light cross-linking, and good compatibility with enzymes required for nucleic acid amplification. It can improve droplet stability at a low cost and prevent leakage of amplification products from polluting the environment. Finally, it should also meet the requirements of downstream applications for droplet stability after the completion of ddLAMP.

[0006] The purpose of the present invention can be achieved by the following technical solutions:

[0007] The first object of the present invention is to provide a microgel based on acrylic anhydride gelatin and a nucleic acid to be detected, comprising the following steps:

[0008] (S1) dissolving a photoinitiator and acrylic anhydride-treated gelatin and mixing them to obtain a prepolymer solution;

[0009] (S2) mixing the prepolymer solution prepared in step (S1) with the nucleic acid mixture to be tested to form a dispersed phase; and using an oil incompatible with the dispersed phase as a continuous phase;

[0010] (S3) constructing a constant temperature device and using a droplet microfluidics method to form droplets of the dispersed phase prepared in step (S2);

[0011] (S4) The droplets prepared in step (S3) are amplified and then subjected to photoinitiated cross-linking to obtain a microgel based on acrylated gelatin and the nucleic acid to be tested.

[0012] In one embodiment of the present invention, in step (S1), the photoinitiator is selected from one or more of phenyl-2,4,6-trimethylbenzoyl lithium phosphite (LAP), ethyl 2,4,6-trimethylbenzoylphosphonate (TPO-L), (2,4,6-trimethylbenzoyl)di(p-tolyl)phosphine oxide (TMO) or bis(2,4,6-trimethylbenzoyl)phenylphosphine oxide;

[0013] The chemical structural formula of the acrylic anhydride gelatin is shown below:

[0014]

[0015] In one embodiment of the present invention, the mass ratio of the photoinitiator to the acrylated gelatin is 3-10:0.1-0.4.

[0016] In one embodiment of the present invention, the mass ratio of the photoinitiator to the acrylated gelatin is 5:0.2.

[0017] In one embodiment of the present invention, in step (S2), the nucleic acid mixture to be tested comprises the following components at the following concentrations:

[0018] 1×Bst DNA polymerase reaction buffer solution, 8-16 mM MgSO4, 2.5-3.0 mM dNTPs, 16 U Bst DNA polymerase, 3-3.5 μM FIB and BIP, 0.2-0.6 μM F3 and B3, 0.6-1.0 μM LF and LB, and 2×SYBR Green I. The nucleic acid to be tested is 2.5×10 1 ~2.5×10 4 copy.

[0019] In one embodiment of the present invention, the volume ratio of the prepolymerization solution to the nucleic acid mixture to be tested is 1:0.8-1.2.

[0020] In one embodiment of the present invention, the volume ratio of the prepolymerization solution to the nucleic acid mixture to be tested is 1:1.

[0021] In one embodiment of the present invention, in step (S2), the continuous phase is HFE-7500.

[0022] In one embodiment of the present invention, in step (S3), the constant temperature device used controls the temperature to 35-40°C, and the temperature range covers the range from the water phase inlet to the chip position where the droplets are formed.

[0023] In one embodiment of the present invention, in step (S4), during the amplification treatment, the temperature is 60-70°C and the time is 25-35 min;

[0024] During the photo-induced cross-linking process, the light source was 0.8 to 1.2 cm away from the droplets.

[0025] In one embodiment of the present invention, during the amplification process, the temperature is 65° C. and the time is 30 min;

[0026] During the photoinitiated cross-linking process, the light source was 1 cm away from the droplets.

[0027] The second object of the present invention is to provide a microgel based on acrylic anhydride gelatin and a nucleic acid to be detected, which is prepared by the above method.

[0028] The third object of the present invention is to provide a microgel based on acrylic anhydride gelatin and a nucleic acid to be detected for use in the detection of target nucleic acids.

[0029] In one embodiment of the present invention, the microgel can be used to detect whether the nucleic acid to be detected is the target nucleic acid;

[0030] When the nucleic acid to be detected is determined to be the target nucleic acid, it can also be used to detect the concentration of the target nucleic acid.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) The present invention adds GelA to the ddLAMP reagent and uses photocrosslinking to obtain microgels after droplet amplification. This preparation method is simple, can enhance the stability of the droplets at a low cost, prevent nucleic acid product contamination, and is beneficial for downstream operations after nucleic acid amplification.

[0033] (2) In the present invention, GelA has a low viscosity property with better fluidity. For example, the viscosity of GelA (5%) is 2 to 9 mPa·s, and the viscosity remains stable between 30 and 40°C, which is conducive to the high-throughput production of droplets of uniform size. In addition, the photocrosslinking of GelA is controlled by photoinitiation, which greatly reduces the operational difficulty of droplet generation and enhances the controllability of crosslinking.

[0034] (3) In the present invention, GelA and the photoinitiator are both biocompatible materials. Through optimization, they can maintain the detection effect of ddLAMP. The concentration detection range of ddLAMP for target nucleic acid with the addition of GelA is 25 copies / test to 25,000 copies / test. Even uncross-linked GelA can enhance the thermal stability of the droplets. The cross-linked microgel can significantly enhance the mechanical stability of the droplets and maintain stability during multiple transfers, which is beneficial to the storage, absorption, and phase transfer of the droplets, and facilitates the subsequent application of ddLAMP.

[0035] (4) In the present invention, the nucleic acid amplification products encapsulated by the microgels did not leak even during electrophoresis, which further proves that the GelA-based ddLAMP can prevent the nucleic acid amplification products from leaking and contaminating the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1Rheological properties of GelA gels and preparation of gel microgel particles using droplet microfluidics. (a) Storage modulus and loss modulus of gel solutions (5% and 10% GelA solid content gel solutions) before and after sol-gel transition; (b) Shear viscosity curves of gel solutions at 30, 35, and 40°C for 5% and 10% GelA solid content gel solutions; (c) Storage modulus and loss modulus curves of photocrosslinked gels containing 3%, 5%, and 10% wt% GelA; (d) Bright field images and particle size distribution of 5% solid content gel droplets prepared by droplet microfluidics at different oil phase flow rates (120-400 μL / h) and an aqueous phase flow rate of μL / h; scale bar = 100 μm; (e) Bright field images and size distribution of droplets before and after heating (65°C, 30 min); scale bar = 100 μm.

[0037] Figure 2 Optimization of LAMP amplification conditions in a photoinduced cross-linked gel solution. (a) LAMP fluorescence curves at different photoinitiator (LAP) concentrations; (b) LAMP fluorescence curves at different gel solution concentrations; (c) LAMP fluorescence curves at different target sequence concentrations in the gel solution.

[0038] Figure 3 Photos of droplets after different transfer cycles: (a) droplet (deionized water); (b) droplet without photocrosslinking (5% solid content GelA + 0.2% solid content LAP); (c) microgel after photocrosslinking (5% solid content GelA + 0.2% solid content LAP); scale bar equals 200 μm.

[0039] Figure 4 Transfer and electrophoresis of GelA-based ddLAMP gel microspheres after amplification and photocrosslinking. (a) Bright-field and dark-field images of GelA-based ddLAMP droplets after amplification and photocrosslinking; scale bar = 250 μm; (b) A section of a positive microgel after photocrosslinking; (c) Photograph of gel microspheres immobilized in agarose followed by electrophoresis (electrophoresis conditions: 18.2 V / cm, 30 minutes); scale bar = 250 μm.

[0040] Figure 5 Quantitative performance and amplification efficiency of the GelA-based ddLAMP panel. (a) Comparison of amplification results between the ddLAMP panel and the GelA-based ddLAMP panel at different target sequence concentrations; scale bar equals 500 μm. (b) Comparison of predicted target nucleic acid concentrations between the ddLAMP panel and the GelA-based ddLAMP panel; (c) Comparison of amplification efficiency between the ddLAMP panel and the GelA-based ddLAMP panel. DETAILED DESCRIPTION

[0041] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0042] In the following examples, the acrylated gelatin is acrylated gelatin in which the ratio of amino groups substituted by acrylic anhydride on gelatin is 60%;

[0043] The target DNA is a pUC57 plasmid containing the nucleotide sequence (cDNA) shown in SEQ ID NO. 1: a recombinant plasmid (the cDNA insertion sites are EcoR I and Hind III, and the synthesis was commissioned to Sangon Biotechnology (Shanghai) Co., Ltd.); the nucleotide sequence of FIP is shown in SEQ ID NO. 2, the nucleotide sequence of BIP is shown in SEQ ID NO. 3, the nucleotide sequence of F3 is shown in SEQ ID NO. 4, the nucleotide sequence of B3 is shown in SEQ ID NO. 5, the nucleotide sequence of LF is shown in SEQ ID NO. 6, and the nucleotide sequence of LB is shown in SEQ ID NO. 7;

[0044] Specifically, SEQ ID NO.1 (5'-3'): GCTGCAATCGTGCTACAACTTCCTCAAGGA ACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG;

[0045] SEQ ID NO.2(5'-3'):CCCCTACTGCTGCCTGGAGGCAGTCAAGCCTCTT CTCG;

[0046] SEQ ID NO.3(5'-3'): TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGC AGCAAAG;

[0047] SEQ ID NO.4(5'-3'): CCAAAATCAGCGAAATGCA;

[0048] SEQ ID NO.5(5'-3'): AGCCAATTTGGTCATCTGGA;

[0049] SEQ ID NO.6(5'-3'): TCCATTCTGGTTACTGCCAGTTGAA;

[0050] SEQ ID NO.7(5'-3'): ACTCAACATGGCAAGGAAGACCTTA;

[0051] Unless otherwise specified, all reagents used are commercially available reagents, and all detection means and methods used are conventional detection means and methods in the art.

[0052] Example 1

[0053] This example provides a performance analysis of GelA, as follows:

[0054] (1) Mixing acrylic anhydride gelatin (GelA) and pure water to obtain GelA solutions with concentrations of 5 wt % and 10 wt %, respectively;

[0055] GelA exhibits distinct sol-gel phase transition properties. Its solution undergoes a spontaneous, reversible sol-gel transition at room temperature (25°C), forming a cross-linked physical gel. However, in droplet microfluidics, the stable formation of uniform, monodisperse droplets can only be achieved when the solution exhibits good fluidity and a relatively stable viscosity. Therefore, accurately measuring the solution-gel transition temperature of GelA plays an important role in determining the temperature control parameters of droplet microfluidic chips.

[0056] The storage modulus and loss modulus of GelA solutions with a concentration of 5wt% and 10wt% were tested with temperature in the range of 5℃ to 45℃. Figure 1 As shown in a.

[0057] pass Figure 1 It can be found that the sol-gel transition temperatures of 5wt% and 10wt% GelA are 27.5°C and 30.3°C, respectively. Therefore, when GelA is subsequently used in conjunction with nucleic acids, the temperature control device of the droplet microfluidic chip should be set to above 30.3°C. However, in droplet digital nucleic acid detection, there is a risk of excessively high droplet temperatures during production and reagent pre-amplification, leading to inflated test results. To reduce the possibility of GelA pre-amplification, the temperature setting should not be too high. At the same time, considering the heat conduction loss during the heating process, the temperature is considered to be set to 30-40°C.

[0058] (2) Acrylic anhydride gelatin (GelA) was mixed with pure water to obtain GelA solutions with concentrations of 5 wt% and 10 wt%, respectively. The viscosities of the GelA solutions with concentrations of 5 wt% and 10 wt% were tested at 30°C, 35°C, and 40°C using a rotational rheometer. The results were as follows: Figure 1 As shown in b.

[0059] pass Figure 1 b It can be found that when the concentration of GelA solution is 5wt%, as the temperature of the solution increases, the overall viscosity of the GelA solution decreases, and the viscosity hardly changes when the shear rate is 10 1 / s to 100 1 / s, and the overall viscosity varies in the range of 2 to 9 mPas. When the concentration of GelA solution is 5wt%, the overall viscosity varies in the range of 10 to 30 mPas. Therefore, it is proved that both 5wt% and 10wt% GelA solutions have excellent fluidity at 30 to 40°C, which is conducive to the high-throughput preparation of uniform droplets through droplet microfluidic chips. Taking all factors into consideration, the temperature was set to 35°C for subsequent experiments.

[0060] (3) Acrylic anhydride gelatin (GelA) was mixed with pure water to obtain GelA solutions with concentrations of 3 wt%, 5 wt% and 10 wt%, respectively; the mechanical properties of GelA gels with concentrations of 3 wt%, 5 wt% and 10 wt% (35°C) were tested, and the results were as follows: Figure 1 As shown in c.

[0061] pass Figure 1 c It can be found that with the increase of GelA solid content, the mechanical strength of GelA increases. The storage modulus of 5wt% GelA gel is stable at about 200 Pa, while the storage modulus of 3wt% GelA gel is stable at about 12 Pa.

[0062] (4) A 5 wt% GelA solution was used as the dispersed phase and an immiscible fluorinated oil (HFE-7500) was used as the continuous phase. The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (the temperature of the dispersed phase inlet and the droplet microfluidic chip was controlled at 35°C by a heating device). The flow rate of the continuous phase was adjusted to 120 μl / h, 150 μl / h, 300 μl / h, and 400 μl / h, respectively. The bright field images and particle size distribution of the obtained droplets were investigated. The results are shown in FIG. Figure 1 As shown in d.

[0063] pass Figure 1 d It can be found that as the oil phase flow rate increases, the droplet size decreases. A droplet size of 54 microns can meet the requirements of droplet digital nucleic acid detection. In order to reduce the consumption of HFE-7500 oil phase, after comprehensive consideration, the continuous phase flow rate was adjusted to 150 μL / h in subsequent experiments.

[0064] (5) A 5 wt% GelA solution was used as the dispersed phase (flow rate of 30 μL / h) and an immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (using a heating device to control the temperature of the dispersed phase inlet and the droplet microfluidic chip to 35°C). The droplets were then heated (temperature of 65°C for 35 min). The bright field images and particle size distribution of the droplets before and after heating were investigated. The results are shown in Figure 5. Figure 1 As shown in e.

[0065] pass Figure 1 As can be seen in Figure 5, the droplet size only decreased by 0.16 μm after heating, and no droplets merged. This indicates that the GelA solution has good thermal stability in this system.

[0066] Example 2

[0067] This example provides an exploration of a photoinduced cross-linked gel solution, specifically as follows:

[0068] (1) Negative control group: 5 wt% GelA was used as the dispersed phase;

[0069] Positive control group: GelA solution and LAMP reagent were mixed at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration was 5 wt%, LAMP concentration was 0.1 wt%);

[0070] Experimental group 1: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 5 wt% and LAP concentration of 0.1 wt%).

[0071] Experimental group 2: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 5 wt% and LAP concentration of 0.2 wt%).

[0072] Experimental group 3: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 5 wt% and LAP concentration of 0.4 wt%).

[0073] The LAMP reagent and target sequence mixed solution are as follows:

[0074] 1× Bst DNA polymerase reaction buffer solution (40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 4 mM MgSO4, 0.2% Triton X-100, pH 8.8), 12 mM MgSO4, 2.8 mM dNTPs, 16 U Bst DNA polymerase, 3.2 μM FIB and BIP, 0.4 μM F3 and B3, 0.8 μM LF and LB, and 2× SYBR Green I, target DNA was 2.5 × 10 4 copy.

[0075] The dispersed phase (negative control group, positive control group, experimental group 1, experimental group 2 and experimental group 3) had a flow rate of 30 μL / h, and the immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (a heating device was used to control the temperature of the dispersed phase inlet and the droplet microfluidic chip to 35°C). The corresponding droplets were then amplified, and the corresponding fluorescence intensity was shown in Figure 2. Figure 2 As shown in a.

[0076] pass Figure 2 As can be seen in the results, at LAP concentrations of 0.1wt% and 0.2wt%, the fluorescence peak appeared at 10.1 minutes and 12.6 minutes, respectively. However, no fluorescence peak was detected within 35 minutes in the 0.4wt% concentration group, indicating that this concentration completely inhibited the amplification reaction. Compared to the 9.6-minute peak time in the positive control group, increasing LAP concentrations resulted in a delayed LAMP reaction. Therefore, a LAP concentration of 0.2wt% was used in subsequent experiments.

[0077] (2) Negative control group: 5 wt% GelA was used as the dispersed phase;

[0078] Experimental group 1: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 3 wt% and LAP concentration of 0.2 wt%).

[0079] Experimental group 2: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 5 wt% and LAP concentration of 0.2 wt%).

[0080] Experimental group 3: GelA and LAP were dissolved in TE buffer to obtain a prepolymer solution, which was then mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 10 wt% and LAP concentration of 0.2 wt%).

[0081] The LAMP reagent and target sequence mixed solution are as follows:

[0082] 1× Bst DNA polymerase reaction buffer solution (40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 4 mM MgSO4, 0.2% Triton X-100, pH 8.8), 12 mM MgSO4, 2.8 mM dNTPs, 16 U Bst DNA polymerase, 3.2 μM FIB and BIP, 0.4 μM F3 and B3, 0.8 μM LF and LB, and 2× SYBR Green I, target DNA was 2.5 × 10 4 copy.

[0083] The dispersed phase (negative control group, experimental group 1, experimental group 2 and experimental group 3) had a flow rate of 30 μL / h, and the immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (the temperature of the dispersed phase inlet and the droplet microfluidic chip was controlled at 35°C by a heating device). The corresponding droplets were then amplified, and the corresponding fluorescence intensity was shown in Figure 2. Figure 2 As shown in b.

[0084] pass Figure 2 b) As can be seen, at GelA concentrations of 3wt%, 5wt%, and 10wt%, the LAMP fluorescence peak appeared at 6.0 minutes, 6.1 minutes, and 8.1 minutes, respectively. These results indicate that GelA within the tested concentration range supports LAMP amplification, but higher concentrations slightly inhibit the reaction. Therefore, a GelA concentration of 5wt% was used in subsequent experiments.

[0085] (3) Negative control group: 5 wt% GelA was used as the dispersed phase;

[0086] Experimental group 1: GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration was 5wt%, LAP concentration was 0.2wt%, target DNA concentration was 2.5×10 1 copy);

[0087] Experimental group 2: GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (the concentration of GelA was 5wt%, the concentration of LAP was 0.2wt%, and the concentration of target DNA was 2.5×10 2 copy);

[0088] Experimental group 3: GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration was 5wt%, LAP concentration was 0.2wt%, target DNA concentration was 2.5×10 3 copy);

[0089] Experimental group 3: GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration was 5wt%, LAP concentration was 0.2wt%, target DNA concentration was 2.5×10 4 copy);

[0090] The LAMP reagent and target sequence mixed solution are as follows:

[0091] 1×Bst DNA polymerase reaction buffer solution (40mM Tris-HCl, 20mM (NH4)2SO4, 20mM KCl, 4mMMgSO4, 0.2% Triton X-100, pH 8.8), 12mM MgSO4, 2.8mM dNTPs, 16U Bst DNA polymerase, 3.2μM FIB and BIP, 0.4μM F3 and B3, 0.8μM LF and LB, and 2×SYBR Green I, target DNA is as above.

[0092] The dispersed phase (negative control group, experimental group 1, experimental group 2 and experimental group 3) had a flow rate of 30 μL / h, and the immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (the temperature of the dispersed phase inlet and the droplet microfluidic chip was controlled at 35°C by a heating device). The corresponding droplets were then amplified, and the corresponding fluorescence intensity was shown in Figure 2. Figure 2 As shown in c.

[0093] pass Figure 2 c It can be found that as the concentration of the target sequence increases, the time of LAMP fluorescence peak gradually advances, confirming that the GelA solution system can successfully achieve LAMP amplification.

[0094] Example 3

[0095] This example provides an investigation into the stability of microgels, as follows:

[0096] GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution as the dispersed phase (the concentration of GelA was 5 wt %, and the concentration of LAP was 0.2 wt %);

[0097] The dispersed phase flow rate was 30 μL / h, and immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (a heating device was used to control the temperature of the dispersed phase inlet and the droplet microfluidic chip to 35°C). Then, blue light was used to initiate photocrosslinking (the blue light source was 1 cm away from the droplets, the blue light wavelength was 405 nm, the power was 11 mW, and the crosslinking time was 30 seconds) to obtain microgels.

[0098] Droplet nucleic acid detection technology (such as Bio-Rad's commercial droplet digital nucleic acid detection platform: QX200) involves multiple droplet transfer operations, which may cause droplets to break and merge, which is not conducive to the reading of droplet signals after transfer, and is also not conducive to the subsequent operation of droplets in downstream applications after amplification. In order to test whether the introduction of GelA can enhance the stability of droplets, the experiment tested the morphological changes of droplets and microgels during multiple transfers of pure deionized water droplets, droplets without photocrosslinking, and microgels after photocrosslinking; the results are shown in Figure 2. Figure 3 shown.

[0099] pass Figure 3 It can be found that after the simple deionized water droplets are transferred more than 20 times, some droplets begin to break and merge to form larger droplets. However, for droplets that have not been photocrosslinked and microgels that have been photocrosslinked, the droplet morphology is well maintained even after 30 transfers, and no breakage or merging occurs between droplets. Therefore, it is found that the introduction of GelA, even without photocrosslinking to form microgels, has greatly enhanced the stability of the droplets during the transfer process.

[0100] Example 4

[0101] This example provides an investigation of microgels based on acrylated gelatin and nucleic acids to be detected, as follows:

[0102] GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with a LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (GelA concentration of 5 wt %, LAP concentration of 0.2 wt %);

[0103] The LAMP reagent and target sequence mixed solution are as follows:

[0104] 1× Bst DNA polymerase reaction buffer solution (40 mM Tris-HCl, 20 mM (NH4)2SO4, 20 mM KCl, 4 mM MgSO4, 0.2% Triton X-100, pH 8.8), 12 mM MgSO4, 2.8 mM dNTPs, 16 U Bst DNA polymerase, 3.2 μM FIB and BIP, 0.4 μM F3 and B3, 0.8 μM LF and LB, and 2× SYBR Green I, target DNA was 2.5 × 10 4 copy.

[0105] The dispersed phase flow rate was 30 μL / h, and immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (a heating device was used to control the temperature of the dispersed phase inlet and the droplet microfluidic chip to 35°C). The corresponding droplets were then amplified (65°C, 30 minutes). After amplification, blue light was used to initiate photocrosslinking (the blue light source was 1 cm away from the droplets, the blue light wavelength was 405 nm, the power was 11 mW, and the crosslinking time was 30 seconds) to obtain microgels.

[0106] Among them, the bright field and dark field images after amplification and photocrosslinking are as follows Figure 4 As shown in a; the microgel was sliced ​​and the dark field image of the slice was as shown in Figure 4 As shown in b; To verify the stability of the microgel during washing and the stability of the microgel (amplified) coating the LAMP amplification product, the gel microspheres after photoinitiated cross-linking were replaced with the oil phase and fixed in a 1% low-melting point agarose solution for observation. 20 microliters of the HFE-7500 oil phase containing the microgel was added to 1 ml of a 1wt% low-melting point agarose solution. After pipetting and mixing, the microspheres were electrophoresed (18.2 V / cm, 30 min). The bright field and dark field images before and after electrophoresis are shown in Figure 2. Figure 4 As shown in c.

[0107] pass Figure 4 As shown in the figure above, some droplets exhibit green fluorescence signals (amplified droplets), indicating that the LAMP reaction has successfully occurred in the droplets. The fluorescence intensity of the amplified droplets is significantly higher than that of the non-amplified droplets, and the two can be clearly distinguished. After the amplification is completed, photocrosslinking is performed. Figure 4 a The figure below shows that although the fluorescence signal of the microgel (amplified) is slightly weakened, it can still be clearly distinguished from the microgel (unamplified).

[0108] pass Figure 4b) Bright fluorescent spots of approximately 1 μm in size appear within the microgel (amplified). This phenomenon may be due to the large DNA fragments generated by LAMP amplification being fixed in the gel network.

[0109] pass Figure 4 The results before electrophoresis in c show that the microgels after transfer still maintain a complete spherical structure without rupture. The microgels fixed in agarose can be directly observed by confocal microscopy without staining. The internal fluorescence signal distribution characteristics are obvious, especially the Figure 4 b) Consistently strong fluorescent spots confirm that the microgels prepared in this example maintain structural stability during transfer and oil phase replacement. Electrophoresis results show that the distribution range of the fluorescent signal within the gel microspheres does not change significantly after electrophoresis, indicating that even under an applied electric field, the amplified product cannot migrate out of the microgel and is effectively retained within the gel network. This property reduces the possibility of target nucleic acid leakage and the risk of environmental contamination due to droplet rupture.

[0110] Example 5

[0111] This example provides an investigation of microgels based on acrylated gelatin and nucleic acids to be detected, as follows:

[0112] (1) ddLAMP group: TE buffer solution was mixed with LAMP reagent and target sequence at a volume ratio of 1:1 to obtain a dispersed phase (target DNA was 0 copies, 2.5×10 1 Copy, 2.5×10 2 Copy, 2.5×10 3 Copy, 2.5×10 4 copy);

[0113] (2) GelA-based ddLAMP group: GelA and LAP were dissolved in TE buffer solution to obtain a prepolymer solution, and then the prepolymer solution was mixed with the LAMP reagent and target sequence mixed solution at a volume ratio of 1:1 to obtain a dispersed phase (the concentration of GelA was 5wt%, the concentration of LAP was 0.2wt%, and the target DNA was 0 copies, 2.5×10 1 Copy, 2.5×10 2 Copy, 2.5×10 3 Copy, 2.5×10 4 copy);

[0114] The LAMP reagent and target sequence mixed solution are as follows:

[0115] 1×Bst DNA polymerase reaction buffer solution (40mM Tris-HCl, 20mM (NH4)2SO4, 20mM KCl, 4mMMgSO4, 0.2% Triton X-100, pH 8.8), 12mM MgSO4, 2.8mM dNTPs, 16U Bst DNA polymerase, 3.2μM FIB and BIP, 0.4μM F3 and B3, 0.8μM LF and LB, and 2×SYBR Green I, target DNA is as above.

[0116] The dispersed phase (ddLAMP group and GelA-based ddLAMP group, respectively) had a flow rate of 30 μL / h, and immiscible fluorinated oil (HFE-7500) was used as the continuous phase (flow rate of 150 μL / h). The dispersed phase was dispersed into uniform droplets through a droplet microfluidic chip (a heating device was used to control the temperature of the dispersed phase inlet and the droplet microfluidic chip to 35°C). The corresponding droplets were then amplified (65°C, 30 min). After amplification, blue light was used to initiate photocrosslinking (the blue light source was 1 cm away from the droplets, the blue light wavelength was 405 nm, the power was 11 mW, and the crosslinking time was 30 seconds) to obtain microgels. Its quantitative performance and amplification efficiency are shown in Figure 2. Figure 5 shown.

[0117] First, in order to explore the difference in amplification effect between the GelA-based ddLAMP group and the ddLAMP group at the same target sequence concentration, the target sequence concentration was tested from 2.5×10 1 Copy / test up to 2.5×10 4 The amplification effect of ddLAMP group and GelA-based ddLAMP group during copy / test. Figure 5 It can be found that as the concentration of the target sequence in the sample decreases, the number of microgels (amplified) in the ddLAMP group and the GelA-based ddLAMP group gradually decreases after amplification, and the number of microgels (amplified) in the two groups is relatively consistent, indicating that the GelA-based ddLAMP group can amplify the target sequence concentration as low as 2.5×10 1 The number of copies / test samples was quantified with 2.5×10 1 Copy / test up to 2.5×10 4 The detection range of copy / test is large, so the quantitative performance of GelA-based ddLAMP meets the detection requirements of actual samples.

[0118] In order to quantify the concentration of sample target sequences detected by the GelA-based ddLAMP panel and compare it with the ddLAMP quantitative results, the Poisson distribution was used to Figure 5The ratio of microgels (amplified) after amplification of the ddLAMP group and the GelA-based ddLAMP group at different target sequence concentrations in a was statistically analyzed to estimate the target sequence concentration in the sample. Figure 5 b It can be found that the target sequence concentrations predicted by the GelA-based ddLAMP group and the ddLAMP group are relatively consistent, and the predicted target sequence concentration of the sample and the expected target sequence concentration of the sample are in a linear relationship. However, the prediction results of the GelA-based ddLAMP group and the ddLAMP group are low. This is because: on the one hand, the actual target sequence concentration in the sample is lower than the expected target sequence concentration; on the other hand, in digital droplet nucleic acid amplification, the amplification efficiency of the droplets is inhibited and is lower than the amplification efficiency in ordinary tubes. In order to scientifically evaluate the amplification efficiency of the GelA-based ddLAMP group, the amplification efficiency of the GelA-based ddLAMP group was calculated using the amplification results of the ddLAMP group as the standard. Figure 5 c It can be found that the target sequence concentration is 2.5×10 1 Copy / test, 2.5×10 2 Copy / test, 2.5×10 3 Copy / test, 2.5×10 4 During copying / testing, the amplification efficiency of GelA-ddLAMP and that of ddLAMP differed by 21%, 2%, 30%, and 7%, respectively, indicating that the amplification efficiencies of the GelA-ddLAMP group and the ddLAMP group were consistent.

[0119] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the explanations of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A microgel based on acrylic anhydride gelatin and a nucleic acid to be detected, characterized in that: The following steps are involved: (S1) dissolving a photoinitiator and acrylic anhydride-treated gelatin and mixing them to obtain a prepolymer solution; (S2) mixing the prepolymer solution prepared in step (S1) with the nucleic acid mixture to be tested to form a dispersed phase; and using an oil incompatible with the dispersed phase as a continuous phase; (S3) constructing a constant temperature device and using a droplet microfluidics method to form droplets of the dispersed phase prepared in step (S2); (S4) The droplets prepared in step (S3) are amplified and then subjected to photoinitiated cross-linking to obtain a microgel based on acrylated gelatin and the nucleic acid to be tested.

2. The microgel based on acrylic anhydride gelatin and nucleic acid to be detected according to claim 1, characterized in that: In step (S1), the photoinitiator is selected from one or more of phenyl-2,4,6-trimethylbenzoyl lithium phosphite (LAP), 2,4,6-trimethylbenzoyl ethyl phosphonate (TPO-L), (2,4,6-trimethylbenzoyl) di(p-tolyl) phosphine oxide (TMO) or bis(2,4,6-trimethylbenzoyl) phenyl phosphine oxide; The chemical structural formula of the acrylic anhydride gelatin is shown below:

3. The microgel based on acrylic anhydride gelatin and nucleic acid to be detected according to claim 2, characterized in that: The mass ratio of the photoinitiator to the acrylic anhydride gelatin is 3-10:0.1-0.

4.

4. The microgel based on acrylic anhydride gelatin and nucleic acid to be detected according to claim 3, characterized in that: In step (S2), the nucleic acid mixture to be tested includes the following components at the following concentrations: 1×Bst DNA polymerase reaction buffer solution, 8-16 mM MgSO4, 2.5-3.0 mM dNTPs, 16 U Bst DNA polymerase, 3-3.5 μM FIB and BIP, 0.2-0.6 μM F3 and B3, 0.6-1.0 μM LF and LB, and 2×SYBRGreen I. The nucleic acid to be tested is 2.5×10 1 ~2.5×10 4 copy.

5. The microgel based on acrylic anhydride gelatin and nucleic acid to be detected according to claim 4, characterized in that: The volume ratio of the prepolymerization solution to the nucleic acid mixture to be tested is 1:0.8-1.

2.

6. The microgel based on acrylic anhydride gelatin and nucleic acid to be detected according to claim 1, characterized in that: In step (S2), the continuous phase is HFE-7500.

7. The microgel based on acrylated gelatin and nucleic acid to be detected according to claim 1, characterized in that: In step (S3), the constant temperature device used controls the temperature to 35-40°C, and the temperature region covers the range from the water phase inlet to the chip position where the droplets are formed.

8. The microgel based on acrylated gelatin and nucleic acid to be detected according to claim 1, characterized in that: In step (S4), during the amplification treatment, the temperature is 60-70°C and the time is 25-35 minutes; During the photo-induced cross-linking process, the light source was 0.8 to 1.2 cm away from the droplets.

9. A microgel based on acrylic anhydride gelatin and a nucleic acid to be detected, characterized in that: It is prepared by the method according to any one of claims 1 to 8.

10. Use of the microgel based on acrylated gelatin and a nucleic acid to be detected as claimed in claim 9 in the detection of target nucleic acid.

Images