Construction method of HBB gene mutation beta thalassemia model pig

Through CRISPR/Cas9 technology and Donor DNA homologous recombination technology, HBB gene site-directed mutation was carried out in pig cells, and β-thalassemia model was constructed, which solved the problem of lack of large animal models in the existing technology, and achieved efficient and low-cost disease research and drug screening.

CN120555432APending Publication Date: 2025-08-29ZHEJIANG FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510691445.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2025-08-29

AI Technical Summary

Technical Problem

There is currently no thalassemia model in large animals. The existing small animal models are very different from humans, making it difficult to truly simulate human physiological pathology, and the cloning efficiency is low and cost-effective, and there is a lack of suitable disease research models.

Method used

CRISPR/Cas9 technology combined with Donor DNA homologous recombination technology was used to perform site-directed mutation of HBB genes, and recombinant pig cells were prepared. Beta thalassemia model pigs were obtained through somatic cell nuclear transplantation. Gene editing was used for NCN protein and gRNA of efficient targets, and the ratio of Donor DNA usage was optimized to obtain efficient single-cell clones of target site mutations.

Benefits of technology

The β-thalassemia model pig with HBB gene mutation was successfully constructed, which simulates the characteristics of human diseases and is suitable for drug screening and gene therapy research, shortening the model production cycle, reducing costs, and improving mutation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555432A_ABST
    Figure CN120555432A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method of a beta thalassemia model pig with HBB gene mutation, the invention provides a kit, the kit comprises HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein, the HBB-T7-gU1 is sgRNA, and a target sequence binding region of the HBB-T7-gU1 is as shown in 3rd to 22nd nucleotides in SEQ ID NO: 8; the HBB-T7-gD1 is sgRNA, and a target sequence binding region of the HBB-T7-gD1 is shown as nucleotides at the 3rd to 22nd sites in SEQ ID NO: 9; the HBB-28mut-ss111 is Donor DNA (deoxyribonucleic acid), and the sequence of the HBB-28mut-ss111 is as shown in SEQ ID NO: 10.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for constructing a beta-thalassemia model pig with HBB gene mutation. Background Art

[0002] Beta-thalassemia is a group of inherited autosomal recessive blood disorders caused by reduced or absent β-globin chain synthesis, leading to hemolytic anemia. While thalassemia affects both men and women equally, it is most common in people of Mediterranean, African, and Southeast Asian descent. It is most common in Guangdong, Guangxi, and Sichuan provinces of my country, with sporadic cases occurring in provinces south of the Yangtze River. It is rare in northern China.

[0003] The HBB-28A>G mutation is a typical β+ mutation located in the TATA-box region of the HBB gene promoter. The TATA-box is the binding site for RNA polymerase II and the general transcription factor TFIID and is crucial for transcription initiation. This mutation accounts for approximately 5%-10% of all β-thalassemia patients in the Guangdong and Guangxi regions of my country and is one of the more common non-deletion mutations.

[0004] At present, no large animal thalassemia model has been successfully developed. Pigs, as large animals, have long been the main meat supplier for humans. Their body size and physiological functions are similar to those of humans, making them easy to breed and raise on a large scale. They also have lower requirements in terms of ethics and animal protection, making them ideal animal models of human diseases.

[0005] In order to solve the above problems, the present invention proposes a method for constructing a β-thalassemia model pig with HBB gene mutation. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] The purpose of the present invention is to provide a method for constructing a beta-thalassemia model pig with HBB gene mutation.

[0008] The present invention provides a kit comprising HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein;

[0009] The NCN protein is shown in SEQ ID NO: 3 in patent 202210973665.5;

[0010] The HBB-T7-gU1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 8; the HBB-T7-gD1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 9; HBB-28mut-ss111 is a DonorDNA, and its sequence is shown in SEQ ID NO: 10;

[0011] The ratios of HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein are: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

[0012] The uses of the above kits are as follows:

[0013] (a) preparing recombinant pig cells;

[0014] (b) preparing a β-thalassemia model pig;

[0015] (c) Preparing a β-thalassemia cell model, a β-thalassemia tissue model, or a β-thalassemia organ model.

[0016] The present invention also provides a method for preparing recombinant pig cells, comprising the following steps:

[0017] Recombinant porcine cells were generated by co-transfecting HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein into primary porcine fibroblasts. The ratio is: approximately 100,000 primary porcine fibroblasts: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

[0018] The co-transfection specifically adopts the method of electric shock transfection.

[0019] Mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon™ transfection system electroporator were used.

[0020] The parameters of electrotransfection were set as: 1450 V, 10 ms, 3 pulses.

[0021] The present invention also protects the recombinant pig cells prepared by the above method.

[0022] The present invention also protects the use of the recombinant pig cells in preparing beta-thalassemia model pigs.

[0023] The recombinant pig cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, namely, β-thalassemia model pigs.

[0024] The beneficial effects of the present invention are:

[0025] 1. The research subjects (pigs) are more applicable than other animals (mice, rats, and primates). Mice and other rodents are very different from humans in terms of body shape, organ size, physiology, and pathology, and cannot truly simulate the normal physiological and pathological conditions of humans. Studies have shown that more than 95% of drugs that have been proven effective in mice are ineffective in human clinical trials. As far as large animals are concerned, primates are the animals that are most closely related to humans, but they are small in size, mature sexually late, and are single-birth animals. The population expansion rate is extremely slow, and the breeding cost is very high. In addition, primate cloning is inefficient, difficult, and costly;

[0026] As a model animal, pigs do not have the above disadvantages. They are the animals that are most closely related to humans besides primates. Their body shape, weight, organ size, etc. are similar to those of humans. They are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. At the same time, pigs reach sexual maturity early (4-6 months), have high fertility, and can have many offspring per litter. A large group can be formed within 2-3 years. In addition, pig cloning technology is very mature, and the cost of cloning and raising pigs is much lower than that of primates. Therefore, pigs are very suitable animals as models of human diseases;

[0027] 2. Gene editing was performed using the high-efficiency NCN protein in combination with in vitro transcribed gRNA of the high-efficiency target screened by the present invention, with synthetic ssODN used as donor DNA. The optimal dosage ratio of NCN protein, gRNA, and donor DNA was optimized. Ultimately, the single-cell clone rate of target site point mutations was as high as 36.7%, which is much higher than the conventional point mutation efficiency (<5%).

[0028] 3. Using the target gene point mutation single-cell clone obtained by the present invention for somatic cell nuclear transfer animal cloning can directly obtain cloned pigs containing target site mutations, and the mutation can be stably inherited;

[0029] The method used in mouse model production involves microinjecting gene-edited materials into fertilized eggs and then performing embryo transplantation. However, the probability of directly obtaining offspring with point mutations is very low (less than 1%), requiring hybridization and selection of offspring. This is not suitable for model production in large animals (such as pigs) with long gestation periods. Therefore, the present invention uses a technically difficult and challenging method of in vitro editing of primary cells and homologous recombination of donor DNA and screening for positively edited single-cell clones, and then directly obtains β-thalassemia model pigs through somatic cell nuclear transfer animal cloning technology. This can greatly shorten the model pig production cycle and save manpower, material, and financial resources.

[0030] 4. This study employed CRISPR / Cas9 technology in conjunction with donor DNA homologous recombination to perform site-directed mutagenesis in the HBB gene, mimicking the genetic characteristics of naturally occurring β-thalassemia. Single-cell clones harboring HBB gene point mutations were then generated using somatic cell nuclear transfer (SCNT) animal cloning technology to create a β-thalassemia pig model with HBB gene point mutations. This model pig will facilitate research into the pathogenesis of β-thalassemia caused by HBB gene point mutations and can also be used for drug screening, efficacy testing, gene therapy, and cell therapy research. It will provide effective experimental data for further clinical applications and, in turn, offer a powerful experimental tool for the successful treatment of human β-thalassemia, possessing significant application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0032] Figure 1 This is a sequencing peak diagram of the target site region of the wild-type pig of the present invention;

[0033] Figure 2 It is a sequencing peak diagram of the target site region of the heterozygous mutant pig of the present invention;

[0034] Figure 3 This is a sequencing peak diagram of the target site region of the homozygous mutant pig of the present invention;

[0035] Figure 4 This is a schematic diagram of the comparison results of blood routine indicators between the model group and the control group of the present invention;

[0036] Figure 5 This is a schematic diagram of the comparison results of blood biochemical indicators between the model group and the control group of the present invention;

[0037] Figure 6 This is a schematic diagram of the comparison results of organ weight coefficients between the model group and the control group of the present invention;

[0038] Figure 7 This is a comparison of the heart sizes of the model group and the control group of the present invention;

[0039] Figure 8 This is a comparison of spleen sizes between the model group and the control group of the present invention;

[0040] Figure 9 This is a schematic diagram showing the comparison of HBB mRNA expression levels in erythrocytes between the model group and the control group of the present invention; DETAILED DESCRIPTION

[0041] The preferred embodiments of the present invention are described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0042] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques and conditions described in literature in the field or according to product specifications. The materials and reagents used in the following examples are commercially available unless otherwise noted. The recombinant plasmids constructed in the examples have been verified by sequencing.

[0043] Example 1. Screening of efficient gRNA targets for the HBB gene

[0044] 1. HBB gene information

[0045] Pig HBB gene information: hemoglobin beta globin, located on chromosome 9; GeneID is 407066, Susscrofa.

[0046] In genomic DNA, the porcine HBB gene has three exons.

[0047] In porcine genomic DNA, the -28A>G mutation site of the HBB gene and its 300 bp upstream and downstream sequences are shown in SEQ ID NO: 1. The nucleotide sequence of the TATA-box region of porcine HBB is highly conserved with that of human HBB (-30 to -24 region).

[0048] SEQ ID NO: 1

[0049] Tccttggattcttcgtttgtgtactaagaaaatggggaggcagtctctaagagattgctacagtgggactcaactctaaaagttgtacagacttgctaaggaggatgaaattagtagcactttgcactgtgaggatgggacctagagctccccagagaagggctgaaggtctgaagttggtgccaggaacgccgaagacaggtatactgtcaacattcaagcctcaccctgtggaaccacgccctggcctgggccaatctgctcccagaagcagggagggcaggaggctgggggggcataaaaggaagagcagagccagcagccacctacatttgcttctgacacaaccgtgttcactagcaactgcacaaacagacaacatggtgcatctgtctgctgaggagaaggaggccgtcctcggcctgtggggcaaagtgaatgtggacgaagttggtggtgaggccctgggcaggttggtatccagggcttcaggagagggagcgggaggtgggcaggtggggacagagccacccctgcctttctgacaggtgctgactccctcgggccttgcgctcttttcacccctcaggctgctggttgt

[0050] Plasmid pKG-GE3 is a circular plasmid as shown in SEQ ID NO: 2 in Patent Application 202010084343.6.

[0051] In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position where self-cleavage occurs is The invention discloses a novel oligonucleotide encoding a cleavage site comprising a nucleotide sequence of at least 50 amino acids, comprising a WPRE sequence element, a nucleotide sequence of at least 50 amino acids ...

[0052] In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene and express a fusion protein.

[0053] Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0054] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone.

[0055] When used, a DNA molecule of about 20 bp (used to transcribe the target sequence binding region of gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in the cell to obtain gRNA.

[0056] According to the porcine HBB genome reference sequence published by NCBI, primers were designed using Primer-BLAST to amplify the sequence at the 3' end of the promoter region of porcine HBB close to the transcription start site.

[0057] HBB-F1: TTGCTACAGTGGGACTCAACTC;

[0058] HBB-R441: CTCCTGAAGCCCTGGATACC.

[0059] Wild-type Bama Xiang pig ear tissue was used as a template for PCR amplification using the HBB-F1 / HBB-R441 primer pair. The target bands were then recovered and sequenced after electrophoresis on a 1% agarose gel. Sequencing results were aligned with the HBB gene sequence of the porcine reference genome (sus scrofa 11.1). SNP-free regions were selected for gRNA target design.

[0060] 2. Screening gRNA targets

[0061] An online tool (https: / / www.benchling.com) was used to design gRNA targeting the porcine HBB gene. A total of four gRNAs were designed, and the four target sequences are as follows:

[0062] HBB-gU1:5'-ATCTGCTCCCAGAAGCAGGG-3'

[0063] HBB-gU2:5'-CCAATCTGCTCCCAGAAGCA-3'

[0064] HBB-gD1:5'-GTGTCAGAAGCAAATGTAGG-3'

[0065] HBB-gD2:5'-GTTGTGTCAGAAGCAAATGT-3'

[0066] 3. Preparation of recombinant plasmid

[0067] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).

[0068] HBB-gU1-S and HBB-gU1-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA(HBB-gU1). The plasmid pKG-U6gRNA(HBB-gU1) expresses the sgRNA HBB-gU1 set forth in SEQ ID NO: 2.

[0069] sgRNAHBB-gU1 (SEQ ID NO: 2):

[0070] AUCUGCUCCCAGAAGCAGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuagu ccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0071] HBB-gU2-S and HBB-gU2-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA (HBB-gU2). The plasmid pKG-U6gRNA (HBB-gU2) expressed the sgRNA HBB-gU2 set forth in SEQ ID NO: 3.

[0072] sgRNAHBB-gU2 (SEQ ID NO: 3):

[0073] CCAAUCUGCUCCCAGAAGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuagu ccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0074] HBB-gD1-S and HBB-gD1-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. These double-stranded DNA molecules with sticky ends were ligated to a vector backbone to generate the plasmid pKG-U6gRNA (HBB-gD1). The plasmid pKG-U6gRNA (HBB-gD1) expressed the sgRNA HBB-gD1 set forth in SEQ ID NO: 4.

[0075] sgRNAHBB-gD1 (SEQ ID NO: 4):

[0076] GUGUCAGAAGCAAAUGUAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuag uccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0077] HBB-gD2-S and HBB-gD2-A were synthesized separately, mixed, and annealed to generate double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to generate the plasmid pKG-U6gRNA(HBB-gD2). The plasmid pKG-U6gRNA(HBB-gD2) expresses the sgRNA HBB-gD2 set forth in SEQ ID NO:5.

[0078] sgRNAHBB-gD2 (SEQ ID NO: 5):

[0079] GUUGUGUCAGAAGCAAAUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuag uccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0080] HBB-gU1-S: caccgATCTGCTCCCAGAAGCAGGG

[0081] HBB-gU1-A:aaacCCCTGCTTTCGGGAGCAGATc

[0082] HBB-gU2-S:caccgCCAATCTGCTCCCAGAAGCA

[0083] HBB-gU2-A:aaacTGCTTCTGGGAGCAGATTGGc

[0084] HBB-gD1-S:caccGTGTCAGAAGCAAATGTAGG

[0085] HBB-gD1-A:aaacCCTACATTTGCTTCTTGACAC

[0086] HBB-gD2-S: caccGTTGTGTCAGAAGCAAATGT

[0087] HBB-gD2-A:aaacACATTTGCTTCTGACACAAC

[0088] HBB-gU1-S, HBB-gU1-A, HBB-gU2-S, HBB-gU2-A, HBB-gD1-S, HBB-gD1-A, HBB-gD2-S, and HBB-gD2-A are all single-stranded DNA molecules.

[0089] 4. Comparison of Editing Efficiency of Different Targets

[0090] Group 1: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gU1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gU1): 1.08 μg plasmid pKG-GE3.

[0091] Group 2: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gU2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gU2): 1.08 μg plasmid pKG-GE3.

[0092] Group 3: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gD1) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gD1): 1.08 μg plasmid pKG-GE3.

[0093] Group 4: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (HBB-gD2) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (HBB-gD2): 1.08 μg plasmid pKG-GE3.

[0094] Group 5: Primary porcine fibroblasts, electroporated with the same electroporation parameters but without adding plasmids.

[0095] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0096] The parameters of electroporation were set as: 1450 V, 10 ms, 3 pulses.

[0097] After completing the above steps, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0098] After completing the above steps, trypsin was used to digest and collect the cells, the cells were lysed, genomic DNA was extracted, PCR amplification was performed using a primer pair consisting of HBB-F1 / HBB-R441, and then 1% agarose gel electrophoresis was performed to detect the mutation of the cell target gene.

[0099] The target product is excised and recovered from the gel and sent to a sequencing company for sequencing. The sequencing results are then analyzed using the web-based Synthego ICE tool to analyze the sequencing peak graph and determine the gene editing efficiency of different targets.

[0100] The gene editing efficiencies of groups 1 to 4 were 68%, 46%, 57%, and 43%, respectively, with no gene editing occurring in group 5. The results showed that HBB-gU1 and HBB-gD1 had high editing efficiencies.

[0101] Example 2: Preparation of single cell clones with HBB gene mutations

[0102] The two highly efficient gRNA targets (HBB-gU1 and HBB-gD1) screened in Example 1 were selected.

[0103] 1. Preparation of gRNA

[0104] 1. Preparation of HBB-gU1 and HBB-gD1 transcription templates

[0105] The HBB-T7-gU1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:6.

[0106] SEQ ID NO: 6

[0107] GGCTTGTCGGACTCTTCGCTATTACGCCAGCTGGCGAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTTAGGAAATTAATACGACTCACTATAGGATCTGCTCCCAGAAGCAGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT;

[0108] The HBB-T7-gD1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO:7.

[0109] SEQ ID NO: 7

[0110] GGCTTGTCGGACTCTTCGCTATTACGCCAGCTGGCGAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCCAGGGTTTTCCCAGTCACGACGTTTAGGAAATTAATACGACTCACTATAGGGTGTCAGAAGCAAATGTAGGGTTTAAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0111] 2. Obtain gRNA by in vitro transcription

[0112] The HBB-T7-gU1 transcription template was used for in vitro transcription using the TranscriptAidT7 HighYieldTranscription Kit (Fermentas, K0441), and then the MEGAclear TM The RNA was recovered and purified using Transcription Clean-Up Kit (Thermo, AM1908) to obtain HBB-T7-gU1, which is a single-stranded RNA as shown in SEQ ID NO: 8.

[0113] SEQ ID NO: 8

[0114] GGATCTGCTCCCAGAAGCAGGGGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUU;

[0115] The HBB-T7-gD1 transcription template was used for in vitro transcription using the TranscriptAidT7 HighYieldTranscription Kit (Fermentas, K0441), and then the MEGAclear TM The RNA was recovered and purified using Transcription Clean-Up Kit (Thermo, AM1908) to obtain HBB-T7-gD1, which is a single-stranded RNA as shown in SEQ ID NO: 9.

[0116] SEQ ID NO: 9

[0117] GGGTGTCAGAAGCAAATGTAGGGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUU.

[0118] 2. Synthesis of HBB-28A>G mutant single-stranded donor DNA

[0119] A single-stranded DNA corresponding to the HBB-28A>G mutation was synthesized as donor DNA, and the single-stranded donor DNA was named HBB-28mut-ss111.

[0120] HBB-28mut-ss111 is shown in SEQ ID NO:10.

[0121] SEQ ID NO: 10

[0122] 5′-AAGCCTCACCCTGTGGAACCACGCCCTGGCCTGGGCCAATCTGCTC CCAGAAGCAGGGAGGGCAGGAGGCTGGGGGGGCATAgAAGGAAGAGCAG AGCCAGCAGCCACCTACATTTGCTTCTGACACAACCGTGTTCACTAGCAAC TGCACAAACAGACAACATG-3'

[0123] The NCN protein is a Cas9 protein, and its sequence is shown in SEQ ID NO: 3 in patent 202210973665.5.

[0124] 3. Transfection of Primary Porcine Fibroblasts

[0125] 1. Co-transfect porcine primary fibroblasts with HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein. Co-transfection was performed by electroporation using the Mammalian Nucleofection Kit (Neon kit, ThermoFisher) and the Neon™ transfection system (parameters: 1450V, 10 ms, 3 pulses).

[0126] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.

[0127] 3. After completing step 2, use trypsin to digest and collect the cells, then wash with complete culture medium, and then resuspend in complete culture medium. Then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium) and culture for about 10 days (replace new complete culture medium every 2-3 days).

[0128] 4. After completing step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0129] 5. Take the 6-well plate from step 4 and culture until the cells grow to 80% confluence, digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).

[0130] 6. Take the centrifuge tube from step 4, remove the cells, lyse the cells and extract genomic DNA. Amplify the DNA by PCR using the HBB-F1 / HBB-R441 primer pair, and then perform electrophoresis. Use primary porcine fibroblasts as a wild-type control (WT).

[0131] 7. After completing step 6, recover the PCR amplification product and sequence it.

[0132] The sequencing results of wild-type porcine primary fibroblasts are considered wild-type. If the sequencing results of a single-cell clone show an A / G overlap peak at the HBB-28 locus and other loci are consistent with the wild type, the genotype of the single-cell clone is a heterozygous mutant type;

[0133] If the sequencing result of a single cell clone shows a single G peak at the HBB-28 site and other sites are consistent with the wild type, the genotype of the single cell clone is a homozygous mutant.

[0134] A total of 139 single-cell clones were obtained. After identification, 36 of them were heterozygous target mutation clones and 15 were homozygous target mutation clones. The editing efficiency of the HBB target mutation (-28A>G) (including heterozygous and homozygous mutations at the target site) was (36+15) / 139=36.7%, of which the homozygous editing efficiency was 15 / 139=10.8%.

[0135] Exemplary sequencing comparison results are shown in Figure 1-Figure 3 shown.

[0136] Example 3: Cloning and Production of Model Pigs

[0137] 1. Oocyte maturation in vitro

[0138] Fresh isolated porcine ovaries (ovaries from Duroc-Changda hybrid sows) were collected from the slaughterhouse, preserved in 0.9% sodium chloride solution containing 75 mg / mL penicillin and 50 mg / mL streptomycin, and transported to the laboratory at 25-30°C.

[0139] Ovaries were harvested and cumulus-oocyte complexes (COCs) were extracted from follicles 3 to 6 mm in diameter. COCs with at least three layers of dense cumulus cells were selected and seeded into 4-well plates. Each well was filled with 200 μL of porcine oocyte in vitro maturation medium, with 50 COCs seeded per well. Each transplant required 300-400 COCs. The plates containing the COCs were incubated in a 38.5°C, 5% CO2, and saturated humidity incubator for 42-44 hours.

[0140] Porcine oocyte in vitro maturation medium (IVM medium): contains 0.1 mg / mL pyruvate, 0.1 mg / mL cysteine ​​hydrochloride, 10 ng / mL epidermal growth factor, 10% (v / v) porcine follicular fluid, 75 mg / mL penicillin, 50 mg / mL streptomycin, 10 IU / mL eCG and 10 IU / mL hCG, with the balance being TCM-199 medium.

[0141] 2. Somatic Cell Nuclear Transfer and Embryo Transfer

[0142] (1) Somatic cell nuclear transfer (SCNT)

[0143] The nuclear donor cell is the mutant recombinant cell obtained in Example 2.

[0144] After completing step 1, the expanded cumulus cells of the COCs were removed by repeated pipetting with 0.1% (w / v) hyaluronidase. Oocytes with intact membranes and extruded first polar bodies were cultured in NCSU23 medium containing 0.1 mg / mL demeclocycline, 0.05 M sucrose, and 4 mg / mL bovine serum albumin for 0.5-1 h to induce oocyte nuclear protrusion. The protruding nuclei and polar bodies were then removed using a microinjection needle with a beveled tip (approximately 20 μm diameter) in Tyrode's lactate medium containing 10 μM HEPES, 0.3% (w / v) polyvinylpyrrolidone, 10% FBS, 0.1 mg / mL demeclocycline, and 5 mg / mL cytochalasin B. A single nuclear donor cell was injected into the perivitelline space of an enucleated oocyte. The donor cell and recipient oocyte were fused for 20 μs using an embryonic cell fusion instrument (ET3, Fujihira Industry) in fusion medium using a 200 V / mm direct current pulse. The reconstructed embryos were then cultured in PZM-3 medium (formula see Table 1) for 2 h to allow nuclear reprogramming and then activated with a single pulse of 150 V / mm for 100 μs in activation medium. The activated reconstructed embryos were then placed in PZM-3 medium supplemented with 5 μg / mL cytochalasin B for 2 h in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity for further activation. The reconstructed embryos were then placed in PZM-3 medium in an incubator at 38.5°C, 5% CO₂, 5% O₂, 90% N₂, and saturated humidity. Most reconstructed embryos were ready for subsequent embryo transfer within 6 h of activation.

[0145] Fusion medium: contains 0.25M D-sorbitol, 0.05mM Mg(C2H3O2)2, 20mg / mL BSA and 0.5mM HEPES [acid-free], with the balance being water.

[0146] Activation medium: contains 0.25M D-sorbitol, 0.01mM Ca(C2H3O2)2, 0.05mM MgCa(C2H3O2)2 and 0.1mg / mL BSA, with the balance being water.

[0147] Table 1 Formulation of PZM-3 culture medium

[0148]

[0149]

[0150] Note: *Add before use

[0151] (2) Embryo transfer

[0152] Hybrid sow: A sow obtained by hybridizing a Large White pig (female) and a Landrace pig (male).

[0153] Six hybrid sows in estrus were selected as surrogate sows for the reconstructed embryos. The reconstructed embryos, activated and cultured for six hours, were transplanted into the oviducts of the surrogate sows, with 300-350 reconstructed embryos transferred to each sow. Approximately 23 days after embryo transfer, pregnancy was confirmed using an ultrasound scanner (HS-101V, Honda Electronics, Japan). Of the six surrogate sows, four became pregnant.

[0154] The cloned pigs were born around 116-117 days after embryo transfer.

[0155] The four successfully pregnant sows gave birth to a total of 16 cloned pigs, which are known as model pigs.

[0156] 3. Preparation of wild-type control pigs

[0157] Using primary porcine fibroblasts from the same source as the recombinant cells as nuclear donors in step 2, four cloned pigs were obtained, which became wild-type control pigs. The genetic background of the wild-type control pigs was identical to that of the model pigs, except for the lack of exogenous replacement DNA.

[0158] Example 4: Physiological, pathological and phenotypic characteristics of model pigs

[0159] 1. Hematological parameter testing

[0160] The peripheral anticoagulated blood of the pigs in the model group and the control group was collected, and the blood routine and blood biochemistry tests were performed using an animal blood routine analyzer (IDEX) and an animal blood biochemistry analyzer (IDEX).

[0161] Routine blood test: focus on anemia-related indicators such as RBC (red blood cell count), HGB (hemoglobin concentration), HCT (hematocrit), MCV (mean corpuscular volume), MCH (mean hemoglobin content), RDW (red blood cell distribution width), PLT (platelet count), WBC (white blood cell count), and LYM (lymphocytes).

[0162] Blood biochemistry: focus on hemolytic indicators such as TBIL (total bilirubin) and LDH (lactate dehydrogenase).

[0163] like Figure 4 As shown in the data, the RBC, HGB, HCT, MCV, and MCH in the model group were significantly lower than those in the control group, while the RDW, PLT, WBC, and LYM in the model group were significantly higher than those in the control group.

[0164] like Figure 5 As shown in the figure, TBIL and LDH in the blood biochemical indicators of the model group were significantly higher than those of the control group.

[0165] 2. Organ weight coefficient detection

[0166] The pigs in the model group and the control group were anesthetized and then killed. The hearts and spleens were taken out and weighed, and the weight coefficients of the organs were calculated.

[0167] Organ weight coefficient = (organ weight / body weight) × 100%.

[0168] like Figure 6 As shown in the figure, the spleen weight coefficient and heart weight coefficient of the model group were significantly increased compared with the control group.

[0169] Figure 7 Shown are comparison images of the hearts of the model group and the control group.

[0170] Figure 8 Shown are comparison images of the spleens of the model group and the control group.

[0171] 3. Detection of HBB expression level

[0172] qPCR primers were designed to detect porcine HBB and β-actin mRNA, and the expression levels of HBB mRNA in pig erythrocytes from the model and control groups were measured. The primer sequences are shown in Table 2.

[0173] Table 2 qPCR primer sequences for porcine HBB and β-actin

[0174]

[0175] like Figure 9 As shown in the figure, the mRNA expression level of HBB in red blood cells in the model group was significantly decreased compared with the control group.

[0176] Regarding the detection of HBB protein expression levels, since there is currently no suitable commercial antibody for porcine HBB protein, after multiple attempts, the expression level of the protein could not be detected due to the species differences of the antibodies.

[0177] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A kit comprising HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein; The HBB-T7-gU1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 8; the HBB-T7-gD1 is an sgRNA, and its target sequence binding region is shown in nucleotides 3-22 of SEQ ID NO: 9; HBB-28mut-ss111 is a donor DNA, and its sequence is shown in SEQ ID NO: 10; The ratios of HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein are: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

2. The use of the kit according to claim 1 is as follows (a) or (b) or (c): (a) preparing recombinant pig cells; (b) preparing a β-thalassemia model pig; (c) Preparing a β-thalassemia cell model, a β-thalassemia tissue model, or a β-thalassemia organ model.

3. A method for preparing recombinant porcine cells, comprising the following steps: HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111, and NCN protein were co-transfected into porcine primary fibroblasts to obtain recombinant porcine cells; The ratios of HBB-T7-gU1, HBB-T7-gD1, HBB-28mut-ss111 and NCN protein are: 1 μg HBB-T7-gU1: 1 μg HBB-T7-gD1: 2 μg HBB-28mut-ss111: 4 μg NCN protein.

4. The method according to claim 3, wherein HBB-T7-gU1 is the HBB-T7-gU1 described in claim 1; HBB-T7-gD1 is the HBB-T7-gD1 described in claim 1; HBB-28mut-ss111 is the HBB-28mut-ss111 described in claim 1; and NCN protein is the NCN protein described in claim 1.

5. The recombinant pig cell prepared according to the method according to any one of claims 3-4.

6. Use of the recombinant pig cell according to claim 5 in preparing a β-thalassemia model pig.

7. Pig tissue, pig organ or pig cell of a β-thalassemia model pig prepared using the recombinant pig cell according to claim 5.

8. Uses of the recombinant pig cell according to claim 5, the pig tissue according to claim 7, the pig organ according to claim 7, the pig cell according to claim 7, or the β-thalassemia model pig prepared using the recombinant pig cell according to claim 5, including screening drugs for treating β-thalassemia, evaluating the efficacy of β-thalassemia drugs, evaluating the efficacy of gene therapy and cell therapy for β-thalassemia, and studying the pathogenesis of β-thalassemia.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • Application of gene editing system in preparation of SMN1 gene mutation spinal muscular atrophy model porcine nuclear transplantation donor cells

    CN116004715A