Bidirectional promoter derived from thermomyces lanuginosus and use thereof

Abstract

The present application relates to the field of agricultural biotechnology, in particular to a bidirectional promoter derived from Myceliopthora thermophila and application thereof. The bidirectional promoter derived from Myceliopthora thermophila has a unique bidirectional transcription activity feature, and can simultaneously and efficiently initiate the transcription and expression of two independent genes in the same regulation region in opposite directions. The present application provides a more favorable promoter element for the metabolic engineering of the industrial filamentous fungus Myceliopthora thermophila, significantly simplifies the construction process of a multi-gene co-expression system, and realizes the synergistic expression of two functional genes through a single promoter element, which has a wide application space and market prospect in the production of enzyme preparations, biological medicine products and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, and particularly relates to a bidirectional promoter derived from Myceliopthora thermophila and application thereof. BACKGROUND

[0002] As a kind of high-temperature filamentous fungal chassis strain with high biomass degradation capacity and high protein secretion capacity, Myceliopthora thermophila has not been detected with viruses, mycoplasma and reported mycotoxins. Compared with traditional industrial strains Trichoderma reesei and Penicillium decumbens, the cellulase produced by Myceliopthora thermophila has significantly higher specific activity and thermal stability, and the enzyme preparation performs particularly outstanding in high-temperature industrial environment, and has important application value in the fields of biofuels, textiles, papermaking and the like. Meanwhile, the glycosylation modification system of the strain can produce human-like glycan structures, and this feature enables the strain to exhibit unique advantages in the production of recombinant protein drugs and vaccines. Therefore, it is of great significance to transform Myceliopthora thermophila through genetic engineering technology and develop it as a multifunctional filamentous fungal chassis cell for the production of enzyme preparations and biomedical products.

[0003] At present, the research on the gene expression regulation system of Myceliopthora thermophila is still in a relatively preliminary stage. The types of functional promoter elements identified in the strain are limited, and only two types of transcription elongation factor EF-1 promoter and pyruvate decarboxylase PDC promoter are widely used in gene expression regulation. The lack of such promoter resources becomes a key bottleneck in complex metabolic engineering modification requiring multi-gene co-expression, and seriously limits the application potential of Myceliopthora thermophila in synthetic biology and metabolic engineering. Therefore, developing new multifunctional promoters (such as bidirectional promoters, conditionally inducible promoters, etc.) through genome mining, rational design or directed evolution, and establishing a perfect gene expression regulation toolbox will become a key research direction to break through the bottleneck of metabolic engineering modification of Myceliopthora thermophila, and has important theoretical value and practical significance for realizing its industrial application.

[0004] As a special cis-acting element, the bidirectional promoter is located in the shared DNA sequence region between two adjacent genes in opposite directions. Its structure enables the RNA polymerase to initiate transcription from the opposite two directions at the same time, thereby efficiently coordinating the co-expression regulation of two independent genes. Existing researches show that although the bidirectional promoters derived from Pichia pastoris have been successfully identified, such promoters exhibit non-typical promoter characteristics: lack of the TATA box core domain which is generally conserved in the promoter region of eukaryotic organisms; the sequence homology between different bidirectional promoters varies greatly; and the functional activity exhibits species specificity. Therefore, the traditional bioinformatics prediction methods based on sequence conservation analysis (such as motif search, promoter prediction, etc.) have limitations, making it difficult to effectively mine functional bidirectional promoter sequences in Myceliopthora thermophila through conventional computational biology means. SUMMARY

[0005] An object of the present application is to provide bidirectional promoters derived from the thermophilic fungus Myceliopthora thermophila.

[0006] Another object of the present application is to provide use of the above-mentioned bidirectional promoters derived from the thermophilic fungus Myceliopthora thermophila.

[0007] The present application provides bidirectional promoters BIP1, BIP2, BIP3, BIP4, BIP5 and BIP6 derived from the thermophilic fungus Myceliopthora thermophila, the nucleotide sequences of which are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

[0008] SEQ ID NO: 1:

[0009] TGCGACGGTGCTGAGGTTTGTCGAAGAAGTGAGACTCAAATCGGCTCCTGGCGGTGTTGTCCTCGTCGCTGGCTGGGGTTGTCGCTGAGGGAGCAGAATCGCAAACTCGCCGAAATATTCTTTTTGCCGATGTGAATTCGCCTGCAGAGTGGGCTGAGTTCTCATTGGCTGAGCTTTGGGTGTGCCAGAGGTTCTCTCGAAACCCTAACGGCTCCACTCTTTTCCGACCAACAACTCGGCCGGTTGCATGACGAATCTTTGGATTGGTAATCGCGAGGCGAATTTGATTTGGTCAAAACCGCAGAGGCTCCCAACCATCCCCCTCTCCCCAAGACCAAGTCGATACCCGTTGTCGTGACATCGCAAAAACACCGTCACA.

[0010] SEQ ID NO: 2:

[0011] TGTGAGAGATATCGGTGTCGAGTCAAATGGGCGATGGGCGACGATTCCTTTGACAGCGACGGGGTCTTCGGGTCGTTGGAAGGGAATAGCCTCTCCTGCCGGCACAACGTCCTAACAAAATGTGAGAGGTGTGGATGCGCAAAATGCCAGCCAGGGCGGAAAACCCTACAGCCGAAAGTGGCCCGTGCAGCACAATCTTGGTCCAGCCATGATGGTCCCGCAGTTCCGAAAGCGGTTAGCTTGGGGTTTGGCCTTTCCGAACTTGCGCACAACCGAAGGCTCGTCCATTTCAAAATCTTGAGCAGCAGCAAGTCAAGTTGACGACCGACCAACGAATTTACTAATCCACCAAACAGCCAAAGCGCTCAAG.

[0012] SEQ ID NO: 3:

[0013] CTTGTCGTTGAGGCTTTCAGAAGTTGGTCGACCGAGCTGAAATTCGCAAAGTTGCAACGGGGCCCTGAAGGTTCGAGGAAAATTGAGGCACGAGGGGGATTTGTGGTGGTCCGTGCGTATCGCTCCCGCGCGTGCCCTAACGATAGCCTGCTGGTCCAAGCACCTGCACCCTGCTTAGTCACCCAGCCCGAAATCCCGTCTTGGATTTGCTTCCACACAAAAATACCCCAATTTTTTCGCAGCCCGCAGCAACTAACGACTTCGACACATCGATCCACGCCGACACACCCAGTAAACAGGCAAG.

[0014] SEQ ID NO: 4:

[0015] TTTGGCGGTTGTTGGCCGATCGGGGCGAGATTCTCAATTCGTAAAGAGGAAGAGAGGTATCTACCAGCATGCCGAAGCGTGTGACGTTAGCCTTCCGAGGCTCGATGAGCGTGGAGAGTGCCCTCGTCGACAAGTCGAGAGGGTTCTGCCTGCTCAGTTGCCGACGAGGAGAAGCGTATCACCGGAGGGCGTCGGCCACTGCCTCAGCCATCCCGTGATTGCTCTCCCCGGCCTTCGCTGAAGGCATTTGACTGTTGACAAGTCATTTTTCAGAAAACCACATACCTCAGGTTTGCCTGCGTTGAGAAGCCGTGATGGTTGATCAGGTCCTGGATCGAGGAGGTTTGGTTGCGACCAGAAAATTCAGCAGGTGTTGAGCGAGCTGTGGTGGCCCGTGCCCCGGAAACTTGCCCTAAACGCTTGGGGTCCCAGATTTGTGCGCTTGCTCAAAGCAGACTAGCTCGGTGTGGAATCCTTTCGACCACACAAAATCCGCGAATTGAGGTCCTGGGTCGGGTCCGTGGGGCCCGACAGCCCGCACACTTTAAACTTGACTTTTGTGGCCCAGCCGAGATCCCTCCATCCAACACACGAAAAACGACTACACTATCACCTACTCTTCGAGGATCGTAGCCGACACTTACCAGCAAACAACAACGTCAAG.

[0016] SEQ ID NO: 5:

[0017] TTTGGCGGTGTCTCGAGTATGCTGGTTCTCAAGAGGTTGTGTGGGAGAAGGGCGAGCAGGTCAGAAATTCGTCTGCTGCTGGAAAACTGCCGTGTTGGACCCACCTGAGAAATTCCCCACCCTCAATCAGCTCTTGGGGTGCGACTGAGGGCAAGTTCTCGAGCAAACCCTAAACCGCAGGCACAGAGTCAGCTGACCCACATCACCCAGAGTGGGCCCCGCCCAAAAGTTCAACTCCGCCGCCGACGCACGTCAATTTCCTGCCATTTTCTTCCCAAGCGCACCTTCACAACATCTACAGATTGCTGAGGAAGACATTGTGTCTAGGTACGTCTGCACGATGTTGCGAGCCGGCGCTTCGTCCCTTTTGCCTTTTGAGGCACCATGATACCCAATCTTGTCATCTCTTCTGCTGCGGGCTGCTATGGAATCTTCGCTCGCGGCTCGGACACTTGCCCGAGCGCGGTTTCGAGTCGGCTTCCCCCCTCCCCTCCCCATGATCCAAGATGGCGCCGGCTTAGCTCTTCACGAAGCCTTCTCTCCCCTGCCTCTAACTCATCCTCACCACTTCTCAGTAGGCAATC.

[0018] SEQ ID NO: 6:

[0019] TTTGATGGATGTTCTGGTGGTTGATGAAGGTTGGAGTCGGGGTCGAGGCGCAAAAGGCGGGGAGTTTTTTCTGAGAGGCCGCGCTGCCAGATGCCAAAGCTTAGGTTAACCGAGCCCTAATAAAATGGGGCGCTCTGAGTGGCTGCGCTCCCGCCCAGACCACTCCCAGCGGGGCCACCAAAAAATTCACGACCACACGCTCAAGCCTTCTGTGTCGTCGTCCTGCACGCCAAACTTCCAATCCATCACCACCTTCAGCTTTTCAGCCAGCCGACCACCGCAAAC.

[0020] The present application also relates to a recombinant expression vector comprising the bidirectional promoter derived from the thermophilic fungus Myceliopthora thermophila described above.

[0021] The application has the beneficial effect that the bidirectional promoters BIP1, BIP2, BIP3, BIP4, BIP5 and BIP6 derived from the thermophilic fungus Myceliopthora thermophila have unique bidirectional transcription activity characteristics, and can simultaneously and efficiently initiate the transcription and expression of two independent genes in the same regulatory region in opposite directions. The application provides more favorable promoter elements for the metabolic engineering of the industrial filamentous fungus Myceliopthora thermophila, significantly simplifies the construction process of a multi-gene co-expression system, and realizes the synergistic expression of two functional genes through a single promoter element, which has a wide application space and market prospect in the production of enzyme preparations, biological medicine products and the like. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A recombinant expression vector containing a bidirectional promoter derived from the thermophilic fungus Myceliopthora thermophila is shown;

[0023] Figure 2 Transcription of a green fluorescent gene derived from the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila is shown;

[0024] Figure 3 Transcription of a red fluorescent gene derived from the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila is shown;

[0025] Figure 4 Expression of a green fluorescent protein derived from the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila is shown;

[0026] Figure 5 Expression of a red fluorescent protein derived from the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila is shown. DETAILED DESCRIPTION

[0027] The application will be further described by way of examples, but the application is not limited to the examples described. The experimental methods in the following examples, for which no specific conditions are indicated, are selected in accordance with conventional methods and conditions, or in accordance with the instructions of the commercial product.

[0028] 1. Strains

[0029] Myceliopthora thermophila ATCC42464 is a strain of existing thermophilic filamentous fungus for producing industrial enzyme preparations, which is preserved in the American Type Culture Collection. In this example, the non-homologous end joining repair pathway key gene-deficient strain Δ ku 80 of Myceliopthora thermophila ATCC42464 is used as the starting strain. Compared with Myceliopthora thermophila ATCC42464, the non-homologous DNA repair function of the strain Δ ku 80 is lost, and this characteristic makes it suitable for gene site-directed integration and maintaining the same number of gene copies.

[0030] 2. Culture media and other reagents

[0031] The culture medium used for culturing Myceliopthora thermophila was potato dextrose agar medium;

[0032] Protoplast regeneration medium (100 mL): 2 mL of 50x Vogel's solution, 2 g of sucrose, 18.2 g of sorbitol, 0.75 g of agarose, and dilution to 100 mL;

[0033] 50x Vogel's solution (1 L): 130 g of trisodium citrate dihydrate, 126 g of potassium nitrate, 144 g of ammonium dihydrogen phosphate, 80 g of potassium dihydrogen phosphate, 10 g of magnesium sulfate heptahydrate, 5 g of calcium chloride dihydrate, 5 mL of trace element solution, 2.5 mL of 0.1 mg / mL biotin solution, 2 mL of chloroform, and dilution to 1000 mL;

[0034] Trace element solution (100 mL): 5 g of citric acid monohydrate, 5 g of zinc sulfate heptahydrate, 1 g of ferrous ammonium sulfate hexahydrate, 0.25 g of copper sulfate pentahydrate, 0.05 g of manganese sulfate monohydrate, 0.05 g of boric acid, and 0.05 g of sodium molybdate dihydrate, and dilution to 100 mL;

[0035] Function evaluation medium (100 mL): 7.5 g of glucose, 1 g of yeast extract, 0.015 g of potassium dihydrogen phosphate, 0.015 g of dipotassium hydrogen phosphate, 0.01 g of magnesium sulfate heptahydrate, 0.01 g of calcium chloride dihydrate, 0.1 mL of 0.1 mg / mL biotin solution, and 0.1 mL of trace element solution.

[0036] The present application adopts whole genome sequencing technology to perform positioning analysis on the coding genes of Myceliopthora thermophila, obtains candidate non-coding regulatory regions through systematic identification of intergenic regions, further combines RNA-seq transcriptome data under different carbon source-glucose / cellulose culture conditions, and finally screens out short promoter sequences with potential bidirectional transcription regulation function based on co-localization analysis of differentially expressed genes.

[0037] The present application provides bidirectional promoters BIP1, BIP2, BIP3, BIP4, BIP5 and BIP6 derived from the thermophilic fungus Myceliopthora thermophila, and the nucleotide sequences of the bidirectional promoters are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

[0038] Example 1 Preparation of a recombinant expression vector containing a bidirectional promoter derived from the thermophilic fungus Myceliopthora thermophila

[0039] PCR amplification was performed with the genomic DNA of Myceliopthora thermophila as template, and the target fragment, i.e. the endogenous bidirectional promoter of Myceliopthora thermophila, was obtained by electrophoresis on a 1% agarose gel and gel recovery. Subsequently, the fragment was recovered and connected to the HygR-Vector-EGFP-BIP-DsRed vector backbone by homologous recombination to obtain the recombinant expression vectors HygR-Vector-EGFP-BIP1-DsRed, HygR-Vector-EGFP-BIP2-DsRed, HygR-Vector-EGFP-BIP3-DsRed, HygR-Vector-EGFP-BIP4-DsRed, HygR-Vector-EGFP-BIP5-DsRed and HygR-Vector-EGFP-BIP6-DsRed. The primers used for PCR amplification to obtain the bidirectional promoter and the sequences are shown in Table 1 (the italicized part is the homologous arm). Figure 1

[0040] Table 1 Primer information table for construction of bidirectional promoter recombinant expression vector

[0041] Primer name Sequence information (5'-3') Vector-EGFP-BIP-DsRed-F (SEQ ID NO: 7) ATGGACAACACCGAGGACGTCATC Vector-EGFP-BIP-DsRed-R (SEQ ID NO: 8) ATGGTGAGCAAGGGCGAGGAGCTG BIP1-F (SEQ ID NO: 9) TTGCGACGGTGCTGAGGTTTG BIP1-R (SEQ ID NO: 10) TGTGACGGTGTTTTTGCGAT BIP2-F (SEQ ID NO: 11) TTGTGAGAGATATCGGTGTCG BIP2-R (SEQ ID NO: 12) CTTGAGCGCTTTGGCTGTTTG BIP3-F (SEQ ID NO: 13) TCTTGTCGTTGAGGCTTTCAGAAG BIP3-R (SEQ ID NO: 14) CTTGCCTGTTTACTGGGTGTG BIP4-F (SEQ ID NO: 15) TTTTGGCGGTTGTTGGCCGATCG BIP4-R (SEQ ID NO: 16) CTTGACGTTGTTGTTTGCTGG BIP5-F (SEQ ID NO: 17) TTTTGGCGGTGTCTCGAGTATGC BIP5-R (SEQ ID NO: 18) GATTGCCTACTGAGAAGTGGTG BIP6-F (SEQ ID NO: 19) TTTTGATGGATGTTCTGGTGGTTG BIP6-R (SEQ ID NO: 20) GTTTGCGGTGGTCGGCTGGCTG

[0042] Example 2 Construction of Myceliopthora thermophila engineering strain overexpressing bidirectional promoter recombinant expression vector

[0043] Preparation of protoplasts: Spore suspension of the starting strain Δ ku 80 of Myceliopthora thermophila was spread on a potato glucose agar medium plate, and after 16 hours of culture at 37°C, the germinated mycelium was collected and placed in 20 mL of 10 mg / mL lysozyme solution, and digested at 75 rpm and 28°C for 2 hours. The filtrate was collected by filtration into a 50 mL centrifuge tube, and centrifuged at 3000 rpm and 4°C for 10 minutes. Then 10 mL of STC solution (1.2 M sorbitol, 50 mM calcium chloride, 35 mM sodium chloride, pH 7.0) was added to suspend the protoplasts, which were then centrifuged at 3000 rpm and 4°C for 10 minutes. The supernatant was discarded, and 200 μL of STC solution was added to resuspend the protoplasts. 50 μL of PEG solution was mixed with the gene fragment by gentle shaking, and incubated on ice for 20 minutes. Then 2 mL of PEG solution was added, mixed by gentle shaking, and incubated at room temperature for 5 minutes. 4 mL of STC solution was added, and then mixed with the protoplast regeneration medium containing 100 μg / mL hygromycin, and incubated at 45°C for 3 days until the transformants grew out.

[0044] ​The transformants were cultured on potato glucose agar medium plates for 3 days, and then the transformant genomic DNA was extracted and used as a template for PCR verification. According to the above method, the recombinant vector HygR-Vector-EGFP-BIP1-DsRed was transformed into the host M. thermophila Δ ku 80, and the gene fragments of the recombinant expression vectors HygR-Vector-EGFP-BIP2-DsRed, HygR-Vector-EGFP-BIP3-DsRed, HygR-Vector-EGFP-BIP4-DsRed, HygR-Vector-EGFP-BIP5-DsRed, and HygR-Vector-EGFP-BIP6-DsRed were obtained, to obtain the M. thermophila engineering strain Δ ku 80-EGFP-BIP1-DsRed, Δ ku 80-EGFP-BIP2-DsRed, Δ ku 80-EGFP-BIP3-DsRed, Δ ku 80-EGFP-BIP4-DsRed, Δ ku 80-EGFP-BIP5-DsRed, and Δ ku 80-EGFP-BIP6-DsRed.

[0045] Example 3 Quantitative evaluation of the transcription efficiency of the bidirectional promoter

[0046] The M. thermophila starting strain Δ ku 80 and the M. thermophila engineering strain overexpressing the bidirectional promoter recombinant expression vector were inoculated on potato glucose agar culture plates and cultured at 45°C for 7 days to produce spores, and the spore suspension was then inoculated into the functional evaluation medium at a concentration of 10 6 spores / mL. After 3 days of fermentation at 45°C, the bacterial cells were collected and RNA was extracted using the Trizol method, and the expression levels of the EGFP and DsRed genes were detected by fluorescent quantitative PCR. The M. thermophila engineering strain overexpressing the fusion bidirectional promoter recombinant expression vector (the fusion promoter was constructed by reversely connecting two constitutive high-expression promoters P87219 and P2074790 of M. thermophila) was used as a positive control, and the transcription levels of different strains were compared. The primers and sequences used in the fluorescent quantitative PCR are shown in Table 2.

[0047] Table 2 Information of fluorescent quantitative PCR primers

[0048] Primer name Sequence information (5'-3') Actin-F (SEQ ID NO: 21) TGCCCATCTACGAGGGTTTC Actin-R (SEQ ID NO: 22) TTGATGTCACGGACAATTTCAC EGFP-F (SEQ ID NO: 23) GACTGGGTGCTCAGGTAGTG EGFP-R (SEQ ID NO: 24) CAAGATCCGCCACAACATCG DsRed-F (SEQ ID NO: 25) GACCGTGTACAAGGCCAAGA DsRed-R (SEQ ID NO: 26) AGTCCTCGTTGTGGTTGGTG

[0049] The results are shown in Figure 2 and Figure 3As shown, compared with the Myceliopthora thermophila engineering strain overexpressing the fusion bidirectional promoter recombinant expression vector, the Myceliopthora thermophila engineering strain Δ ku 80-EGFP-BIP1-DsRed, Δ ku 80-EGFP-BIP2-DsRed, Δ ku 80-EGFP-BIP3-DsRed, Δ ku 80-EGFP-BIP4-DsRed, Δ ku 80-EGFP-BIP5-DsRed and Δ ku 80-EGFP-BIP6-DsRed were significantly higher than the positive strain, and the green fluorescence and red fluorescence gene expression of the Myceliopthora thermophila starting strain Δ ku 80 no green fluorescence and red fluorescence gene expression was detected, indicating that the bidirectional promoters BIP1, BIP2, BIP3, BIP4, BIP5 and BIP6 derived from the thermophilic fungus Myceliopthora thermophila have high bidirectional transcription activity characteristics, and can simultaneously and efficiently initiate the transcription and expression of two independent genes in the same regulatory region in opposite directions.

[0050] Example 4 Qualitative evaluation of bidirectional promoter driven protein expression

[0051] The Myceliopthora thermophila starting strain Δ ku 80, the Myceliopthora thermophila engineering strain overexpressing the bidirectional promoter recombinant expression vector was inoculated on potato glucose agar culture plates and cultured at 45°C for 7 days to produce spores, and the spore suspension was washed and quantified to 10 8 spores / mL, 200 μL of the spore suspension was taken and mixed well in a Corning® 96-well black polyester microplate, and the fluorescence intensity of the spores was detected using a BioTek SYNERGY H1 multifunctional microplate reader. Parameter settings: gain 100; detection height 7 mm; green fluorescence protein EGFP excitation wavelength and emission wavelength are 488 nm and 520 nm, respectively; red fluorescence protein DsRed excitation wavelength and emission wavelength are 558 nm and 585 nm, respectively.

[0052] The results are shown in Figure 4 and Figure 5 As shown, compared with the Myceliopthora thermophila starting strain Δ ku 80, the Myceliopthora thermophila engineering strain Δ ku 80-EGFP-BIP1-DsRed, Δ ku 80-EGFP-BIP2-DsRed, Δ ku 80-EGFP-BIP3-DsRed, Δ ku80-EGFP-BIP4-DsRed, Δ ku 80-EGFP-BIP5-DsRed and Δ ku The green fluorescence value and the red fluorescence value of 80-EGFP-BIP6-DsRed are both significantly enhanced, which indicates that the bidirectional promoters BIP1, BIP2, BIP3, BIP4, BIP5 and BIP6 derived from the thermophilic fungus Myceliopthora thermophila can simultaneously and efficiently drive the expression of two independent gene coded proteins in the same regulatory region in opposite directions.

[0053] The above examples are only used for explaining the technical solutions of the present application and do not limit the protection scope of the present application.

Claims

1. A bidirectional promoter from the thermophilic fungus Myceliopthora thermophila, characterized in that, The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO:

6.

2. A method for bidirectional expression of a gene in Myceliopthora thermophila, characterized by, The method comprises the following steps: constructing a recombinant expression vector comprising a bidirectional promoter and a target gene, wherein the nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6; introducing the obtained recombinant expression vector into a Myceliopthora thermophila cell.

3. Use of the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila according to claim 1 for bidirectional expression of a gene in Myceliopthora thermophila.

4. A recombinant expression vector comprising the bidirectional promoter of the thermophilic fungus Myceliopthora thermophila according to claim 1.

Images