Zmllg3 gene and application thereof in regulating nitrogen efficiency and number of lateral roots

By performing a loss-of-function mutation or inhibiting the expression of the maize ZmLLG3 gene and using CRISPR/Cas9 and RNAi technologies, the problem of low nitrogen utilization efficiency in maize was solved, the nitrogen absorption and transport capacity was improved, the number of lateral roots was increased, new breeding resources and ideas were provided, and food security and sustainable agricultural development were promoted.

CN120555499BActive Publication Date: 2025-10-17SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511052416.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-29
Publication Date
2025-10-17
Estimated Expiration
2045-07-29

AI Technical Summary

Technical Problem

The existing technology has low nitrogen utilization efficiency of corn and lacks effective genetic resources and molecular basis, making it difficult to cultivate new varieties that efficiently utilize nitrogen, affecting global food security and sustainable agricultural development.

Method used

By performing a loss-of-function mutation on the ZmLLG3 gene in corn plants or inhibiting its expression, the nitrogen absorption and transport capacity is improved, and the number of lateral roots is increased. CRISPR/Cas9 gene editing technology and RNAi methods are used for gene editing or hybridization to obtain corn plants with improved nitrogen utilization efficiency and increased number of lateral roots.

Benefits of technology

It significantly improved the nitrogen utilization efficiency and lateral root number of corn, enhanced the nitrogen absorption and transport capacity, provided new germplasm resources and breeding ideas for corn breeding, and promoted global food security and sustainable agricultural development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555499B_ABST
    Figure CN120555499B_ABST
Patent Text Reader

Abstract

The application discloses a kind of ZmLLG3 Gene and its application in regulating nitrogen efficient, lateral root number, belong to the field of plant biotechnology breeding.The corn ZmLLG3 Gene, after the endogenous gene produces functional loss mutation in plant, or ZmLLG3 Gene expression is inhibited, phenotype with nitrogen utilization efficiency improvement and / or lateral root number increase can be obtained, and the aforementioned gene resources and application method have wide application prospect in the field of corn breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant biotechnology, and particularly relates to a ZmLLG3 gene and application thereof in regulating nitrogen high efficiency and lateral root number of corn. BACKGROUND

[0002] Nitrogen is essential for plant growth and development, and various macromolecular proteins, nucleic acids, and phospholipids in plants need nitrogen to be involved in synthesis. Nitrogen also participates in the synthesis of plant chlorophyll, affecting plant photosynthesis. In addition, the yield formation of cereals and the protein content are closely related to the rational application of nitrogen fertilizer and the nitrogen metabolism regulation process. Corn (Zea mays L.) is the main food crop in the world, accounting for 37.2% of the global grain yield (FAO, http: / / faostat.fao.org / ), and the application of nitrogen fertilizer is the main way to increase corn yield per unit.

[0003] With the continuous growth of global demand for food and increasing concern about environmental problems, the agricultural production is required to reduce nitrogen and increase efficiency. In this context, improving the nitrogen use efficiency (NUE) of corn has become a sustainable solution to coordinate crop high yield and environmental protection.

[0004] Nitrogen use efficiency (NUE) is a complex agronomic trait, including nitrogen absorption, transport, assimilation and reutilization processes, involving a series of biochemical reactions and related gene regulation, and there is a wide genetic variation among different corn varieties. Although several genes that may improve NUE have been reported in different nitrogen metabolism processes, there is still a large gap in the whole nitrogen metabolism process of corn. The gene resources for regulating efficient nitrogen utilization are relatively few, and the molecular basis is weak, making it difficult to effectively breed new varieties with efficient nitrogen utilization. Therefore, studying the molecular mechanism of corn nitrogen efficient utilization, mining excellent gene resources of nitrogen efficient utilization, and breeding new varieties of nitrogen efficient corn are of great significance for global food security and sustainable agricultural development. SUMMARY

[0005] All references mentioned herein are incorporated by reference. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Unless otherwise indicated, all techniques or methods used or mentioned in this document are standard techniques or methods commonly used by those of ordinary skill in the art. Materials, methods, and examples are illustrative only and not limiting.

[0006] The present application embodiment finds, through a series of experiments, that the ZmLLG3 gene is involved in the regulation of nitrogen high efficiency and lateral root number of corn plants. ZmLLG3The functional loss mutation of the gene has unexpected technical effects, the mutant plant has the phenotype of increased nitrogen utilization efficiency and / or increased number of lateral roots, the increased nitrogen utilization efficiency includes stronger nitrogen absorption and transport capacity, and the foregoing gene resource and function have great significance for corn breeding.

[0007] Optionally, the embodiment of the present application provides a method for producing a corn plant having the phenotype of increased nitrogen utilization efficiency and / or increased number of lateral roots, the method comprising the steps of:

[0008] Generating one or more corn plants, the corn plants endogenously ZmLLG3 gene Containing at least one functional loss mutation, or endogenously ZmLLG3 gene The expression is inhibited;

[0009] Obtaining at least one seed of the corn plant generated in the foregoing step.

[0010] Optionally, wherein the ZmLLG3 Polynucleotide sequence of the gene is selected from one of the following groups of sequences:

[0011] (a) the polynucleotide sequence as shown in SEQ ID No: 1 or 2;

[0012] (b) the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No: 3;

[0013] (c) the polynucleotide sequence capable of hybridizing to the polynucleotide sequence in (a) or (b) under stringent hybridization conditions, and the functional loss mutation of the polynucleotide sequence endogenous to the corn plant has the function of increasing nitrogen utilization efficiency and / or increasing the number of lateral roots;

[0014] (d) the polynucleotide sequence having at least 90%, 95%, 98% or more similarity to the polynucleotide sequence in any one of (a)-(c), and the functional loss mutation of the polynucleotide sequence endogenous to the corn plant has the function of increasing nitrogen utilization efficiency and / or increasing the number of lateral roots of the plant; or

[0015] (e) the polynucleotide sequence complementary to any one of the sequences in (a)-(d).

[0016] Optionally, the gene provided by the embodiment of the present application ZmLLG3 Also includes homologous genes or the same genes of different varieties having at least 80%, 85%, 90%, 95%, 98% or 99% sequence similarity to the polynucleotide sequence thereof, or the same genes of different varieties as disclosed in the embodiment of the present application ZmLLG3A homologous gene or the same gene in different varieties of a gene having at least 90%, 95% or 98% sequence similarity, and after endogenous homozygous functional loss mutation of the homologous gene, the plant has improved nitrogen utilization efficiency and / or increased number of lateral roots.

[0017] Alternatively, the method provided in the present application can be applied to any plant containing ZmLLG3 The plant preferably includes monocotyledonous plants such as corn, millet, wheat, barley, rye, rice and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, tobacco, etc.

[0018] The percentage of sequence similarity described in the present application can be obtained by known bioinformatics algorithms, including Myers and Miller algorithm, Needleman-Wunsch global alignment method, Smith-Waterman local alignment method, Pearson and Lipman similarity search method, Karlin and Altschul algorithm, which are known to those skilled in the art.

[0019] Those skilled in the art should know that there is single nucleotide polymorphism (SNP) between different varieties of the same plant, i.e. the nucleotide sequence of the same gene often has individual base differences, but there are many varieties of the same crop, and the inventors cannot list them one by one, and the present application only provides the sequences of representative varieties in corn crops. Therefore, those skilled in the art should know that nucleotide sequences with SNP from different varieties of the genes and nucleotide sequences disclosed in the present application, using endogenous functional loss mutation to obtain improved nitrogen utilization efficiency and / or increased number of lateral roots, methods and applications, are also within the scope of the present application. ZmLLG3

[0020] Alternatively, the functional loss mutation described in the present application is obtained by mutation, and the mutation includes substitution, deletion and / or addition of one or more nucleotides in the nucleotide sequence of the gene.

[0021] Alternatively, the functional loss mutation includes but is not limited to methods obtained by physical mutagenesis, chemical mutagenesis, gene editing, etc. Physical mutagenesis includes but is not limited to radiation mutagenesis, space breeding, etc.; the method of chemical mutagenesis includes mutagenesis caused by treatment with EMS and other mutagenic agents; the method of gene editing includes but is not limited to ZFN, TALEN and / or CRISPR / Cas, etc.

[0022] ​The skilled person in the art knows that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the location of the gene editing to be performed, i.e. the target DNA sequence, in the host genome by a nucleic acid fragment called guide-RNA (gRNA), and then to cut the DNA by a Cas protein. In the present application, the Cas protein includes but is not limited to Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13 and / or Cas14 protein, etc.

[0023] Optionally, when the gene editing system used is CRISPR / Cas9, the gene mutant sequence obtained by the CRISPR / Cas9 method is selected from one of the following sequences:

[0024] (I) a fragment in the nucleotide sequence shown in SEQ ID No: 1 or 2 that meets the sequence arrangement rule of 5'-Nx-NGG-3', wherein N represents any one of A, G, C and T, 14 < X < 30, and X is an integer, Nx represents X consecutive nucleotides; or

[0025] (II) a nucleotide sequence complementary to the polynucleotide sequence described in (I).

[0026] Optionally, the corn plant has ZmLLG3 a gene mutant, and the genomic DNA sequence of the mutant is shown in SEQ ID NO: 7 or 8.

[0027] Optionally, the functional loss mutation described in the embodiments of the present application can also be obtained by crossing with a corn plant having the functional loss mutation.

[0028] Optionally, the method described in the embodiments of the present application, wherein the reduction or inhibition ZmLLG3 of the normal expression or protein function of the homologous gene includes obtaining by RNA interference (i.e. RNAi) and / or mutation, or using natural variation, or molecular biology methods or gene editing to change the promoter of the functional gene to obtain a phenotype of reduced expression or protein content. The skilled person in the art knows that the RNAi technology is a conventional technology in the art, which specifically binds to the homologous region of the mRNA expressed by the target gene by a short-chain double-stranded RNA (siRNA: small interfering RNA) of 21-23 bp or a long-chain double-stranded RNA (dsRNA: double-stranded RNA), degrades the mRNA, and achieves the effect of inhibiting gene expression.

[0029] Optionally, the expression of the endogenous gene in the corn plant is inhibited by the method of RNAi in the present application, so as to affect the activity of the aforementioned gene, inhibit the expression of the gene, and make the corn plant have the phenotype of increased nitrogen utilization efficiency and / or increased number of lateral roots. ZmLLG3

[0030] Optionally, the present application also provides the use of the endogenous gene in the production of corn plants with increased nitrogen utilization efficiency and / or increased number of lateral roots. ZmLLG3

[0031] Optionally, the present application also provides a method for obtaining the aforementioned functional loss mutant of the endogenous gene in the corn plant. ZmLLG3 Optionally, the present application also provides the use of the functional loss mutant of the endogenous gene in the corn breeding, preferably, the use includes but is not limited to the use in the regulation of the traits of the corn plant, such as increased nitrogen utilization efficiency and / or increased number of lateral roots.

[0032] Optionally, the present application also provides a feed, meal, protein or oil product made of corn, wherein the feed, meal, protein or oil product contains ZmLLG3 the functional loss mutant of the endogenous gene in the corn plant. ZmLLG3 contains at least one functional loss mutation, or the endogenous ZmLLG3 gene expression is inhibited. The functional loss mutation includes substitution, deletion and / or addition of one or more nucleotides on the nucleotide sequence of the aforementioned gene.

[0033] Optionally, the present application also provides a gene mutant, which is ZmLLG3 the functional loss mutant of the endogenous ZmLLG3 gene in the corn plant, characterized in that the endogenous ZmLLG3 gene in the corn plant has the function of increasing the nitrogen utilization efficiency and / or increasing the number of lateral roots after the mutation of the gene.

[0034] (a) the polynucleotide sequence as shown in SEQ ID No: 1 or 2;

[0035] (b) the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID No: 3;

[0036] (c) the polynucleotide sequence capable of hybridizing to the polynucleotide sequence in (a) or (b) under stringent hybridization conditions, and the functional loss mutation of the polynucleotide sequence endogenous to the corn plant has the function of increasing the nitrogen utilization efficiency and / or increasing the number of lateral roots;

[0037] ​​(d) a polynucleotide sequence that is at least 90%, 95%, 98% or more similar to the polynucleotide sequence shown in any one of (a) to (c), and a loss-of-function mutation of the polynucleotide sequence endogenous to a corn plant has the function of improving the nitrogen use efficiency of the plant and / or increasing the number of lateral roots; or

[0038] (e) A polynucleotide sequence complementary to any one of the sequences described in (a) to (d).

[0039] Optionally, the genomic DNA sequence of the mutant is shown in SEQ ID NO: 7 or 8.

[0040] Alternatively, the nucleotide sequence, vector, construct or expression cassette described in the embodiments of the present application is transferred into a plant or introduced into a plant or the plant is transformed, all referring to a method of transferring the target nucleotide sequence, construct, vector or expression cassette into a recipient cell or recipient plant by conventional transgenic methods or hybridization with a target transgenic plant. Any transgenic method known to those skilled in the art can be used to transform the recombinant expression vector into a plant cell to produce the transgenic plant or mutant of the embodiments of the present application. The transformation method may include direct or indirect transformation methods. Specifically, the transformation method includes but is not limited to polyethylene glycol-induced DNA uptake, liposome-mediated transformation, introduction using a gene gun, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods, etc.

[0041] Compared with the prior art, this application has the following beneficial effects:

[0042] (1) This application provides a method for producing corn plants and its application, by obtaining ZmLLG3 Loss-of-function mutants of genes, or suppression of ZmLLG3 By regulating the expression level of the gene, plants with excellent agronomic traits such as improved nitrogen use efficiency and / or increased lateral root number are obtained. The aforementioned genes, methods, and their applications provide new germplasm resources and breeding strategies for corn breeding, which are of great significance to global food security and sustainable agricultural development.

[0043] (2) It is clear that ZmLLG3 gene The functions after mutation provide new genetic resources for crop species and also provide new ideas for the study of gene action mechanism networks.

[0044] Definitions of terms involved in the present invention

[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described.

[0046] In the context of the present application, the term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides in single- or double-stranded form, and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0047] The term "homologous gene" in the present application refers to two or more gene sequences with sequence similarity of 80%, which includes orthologous genes (also known as vertical homologous genes, positive homologous genes or directional evolutionary homologous genes), paralogous genes (also known as lateral homologous genes, parallel homologous genes or parallel evolutionary homologous genes) and / or xenologous genes.

[0048] The term "sequence similarity" refers to the degree of similarity between two sequences, which is a quantitative concept used to compare the degree of similarity between different sequences, so as to find and analyze the correlation between two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.

[0049] The "stringent hybridization conditions" in the present application means conditions of low ionic strength and high temperature known in the art. Generally, under stringent conditions, the detectable degree of hybridization of a probe to its target sequence is higher than that of hybridization to other sequences (e.g. more than 2 times the background. The stringent hybridization conditions are sequence-dependent and will be different under different environmental conditions, longer sequences specifically hybridize at higher temperatures. By controlling the stringency of hybridization or washing conditions, target sequences 100% complementary to the probe can be identified. For detailed guidance on nucleic acid hybridization, please refer to the relevant literature (Tijssen, "Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, More specifically, the stringent conditions are usually selected to be about 5-10°C lower than the thermal melting point (T m ) of the specific sequence at the specified ionic strength pH. T m is the temperature at which 50% of the probe hybridized to the target sequence in equilibrium state (at the specified ionic strength, pH and nucleic acid concentration) (because the target sequence is present in excess, so at T mStringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion concentration, typically about 0.01 to 1.0 M sodium ion concentration (or other salts), at pH 7.0 to 8.3, and the temperature is at least about 30°C for short probes (including but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including but not limited to, greater than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least twice the background hybridization, optionally 10 times the background hybridization. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5× SSC, and 1% SDS, incubated at 42°C; or 5× SSC, 1% SDS, incubated at 65°C, washed in 0.2× SSC, and washed in 0.1% SDS at 65°C. The washing may be performed for 5, 15, 30, 60, 120 minutes or longer.

[0050] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, along with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include the cis-acting sequences required for T-DNA transfer, a selectable marker engineered for expression in plant cells, and the heterologous DNA sequence to be transcribed.

[0051] The term "hybridization" is a broad term that refers to the process of hybridization between gametes of different populations or genotypes to produce hybrids. Depending on the relationship between the parents, it includes close hybridization and distant hybridization.

[0052] As used herein, "mutation" refers to a "loss-of-function mutation" or "loss-of-function mutation," which is a mutation in the coding sequence of a gene that results in a reduction in or complete loss of function of the gene product (usually a protein). Loss-of-function mutations can be caused, for example, by truncation of the gene product (due to a frameshift or nonsense mutation), and the phenotype associated with an allele having a loss-of-function mutation can be recessive or dominant.

[0053] The term "RNA interference" (RNAi) refers to a gene blocking technology in which a double-stranded RNA (dsRNA) molecule blocks the expression of a specific gene or silences it at the mRNA level, i.e., sequence-specific post-transcriptional gene silencing (PTGS). BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0055] Figure 1 for ZmLLG3 Schematic diagram of the structure of the gene knockout vector;

[0056] Figure 2 for ZmLLG3 Schematic diagram of the target location of gene knockout;

[0057] Figure 3 for ZmLLG3 Schematic diagram of the mutation types of gene-edited materials (Zmllg3-1 and Zmllg3-2);

[0058] Figure 4 for Zm LLG3 Phenotypic observation diagram of gene-edited materials and statistical results of lateral root number; where a is ZmLLG3 Phenotypic results of gene-edited materials and wild-type materials under normal nitrogen conditions; b is ZmLLG3 Phenotypic results of gene-edited materials and wild-type materials under low nitrogen conditions; c is ZmLLG3 Statistical results of the lateral root numbers of gene-edited materials and wild-type materials under normal nitrogen conditions; d is ZmLLG3 Statistical results of lateral root numbers of gene-edited materials and wild-type materials under low nitrogen conditions; NN stands for normal nitrogen and LN stands for low nitrogen;

[0059] Figure 5 for ZmLLG3 Gene editing materials 15 N isotope detection experimental results diagram; where a is ZmLLG3 Gene-edited materials and wild-type materials 15 N-labeled nitrate absorption rate; b is the ZmLLG3 gene-edited material and the wild-type material 15 N-labeled nitrate transport capacity;

[0060] Figure 6 for ZmLLG3 Excellent haplotype analysis results of gene editing materials; where a is ZmLLG3 Schematic diagram of two haplotypes of the gene; b is ZmLLG3 Statistical results of the expression levels of the two haplotypes of the gene in different inbred lines. DETAILED DESCRIPTION

[0061] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0062] The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified; unless otherwise specified, quantitative tests are performed with more than five replicates.

[0063] Example 1. ZmLLG3 Acquisition of gene editing materials

[0064] 1. ZmLLG3 Construction of CRISPR / Cas9 gene knockout vector

[0065] according to ZmLLG3 (Zm00001eb189170, whose genomic nucleotide sequence is shown in SEQ ID NO.1, its CDS sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.3) gene, two target sequences spanning exons were selected, and sgRNA was designed. Homologous recombination technology was used to connect the sgRNA to the pCPB vector (the vector is described in the literature RNA-guided Cas9 as an in vivo desired-target mutator in maize. Plant BiotechnolJ. 2017 Dec;15(12):1566-1576. doi: 10.1111 / pbi.12739.) to construct ZmLLG3 The gene knockout vector was named pCPB-Ubi::hspCas9. ZmLLG3 The structure of gene knockout vector is as follows Figure 1 As shown, the component structure between LB and RB is as follows Figure 2 The sequences are as follows:

[0066] Target sequence 1: GGCTGTGAGCTCGTTTCGGG (SEQ ID NO. 4);

[0067] Target sequence 2: GTCCTGCAGTATTACCCTCA (SEQ ID NO.5);

[0068] sgRNA:

[0069] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 6);

[0070] 2. Genetic transformation of maize plants

[0071] Using Agrobacterium-mediated method to transform ZmLLG3 The gene knockout vector pCPB-Ubi::hspCas9 was genetically transformed into maize plants (maize inbred line B104). The obtained maize plants were subjected to PCR identification and nucleotide sequence sanger sequencing, and finally two homozygous mutant plants were obtained, named Zmllg3-1 and Zmllg3-2 . Zmllg3-1 and Zmllg3-2 The gene mutation types are shown in Figure 3 . Among them, the mutation type of Zmllg3-1 is a frameshift mutation caused by 1 bp insertion at target site 1 and 2 bp deletion at target site 2; Zmllg3-2 The mutation type is a frameshift mutation caused by 20 bp deletion at target site 1 and 2 bp deletion at target site 2. Zmllg3-1 The genomic nucleotide sequence of the mutant is shown in SEQ ID NO. 7, Zmllg3-2 The nucleotide sequence of

[0072] Example 2. Zmllg3 Root phenotype and lateral root number determination of mutant material

[0073] In order to verify the function of ZmLLG3 , the homozygous gene editing mutant material Zmllg3-1 , Zmllg3-2 and the corresponding wild type control B104 corn material (WT) were subjected to seedling low nitrogen and normal nitrogen treatment, and the specific steps were as follows:

[0074] After the corn seedlings were cultured to the two-leaf-one-heart stage, they were cultured with Hoagland nutrient solution containing 0.04 mM KNO3 (low nitrogen condition, LN) and 4 mM KNO3 (normal nitrogen condition, NN), respectively, and the nutrient solution was replaced every three days during the period; after 7 days of low nitrogen and normal nitrogen treatment, the phenotype was observed by taking photos, and the lateral root number phenotype was counted.

[0075] The results are shown in Figure 4 a-d, Zmllg3-1 and Zmllg3-2 The lateral root number of Figure 4 a and Figure 4 b) is significantly better than that of WT; and after counting the lateral root number, it is further found that,Zmllg3-1 and Zmllg3-2 The number of lateral roots of WT was significantly higher under low nitrogen and normal nitrogen treatments ( Figure 4 c and Figure 4 d). The experimental results show that, ZmLLG3 The gene mutation will make the roots of corn more developed and increase the number of lateral roots.

[0076] Example 3. Zmllg3 mutant material 15 N isotope detection experiment

[0077] To explore ZmLLG3 Is the gene related to efficient nitrogen utilization? Zmllg3-1 and Zmllg3-2 and wild-type materials (WT) were tested in the laboratory 15 N isotope labeling experiment. Select corn seeds of uniform size and germinate them on germination paper. After germination, culture them in clear water and then change to normal nutrient solution until they reach the three-leaf and one-heart stage (activating nitrogen-induced gene expression in corn seedlings). Then, transfer the corn seedlings to nitrogen-free culture medium and culture them in the empty nitrogen state for three days (to remove the influence of residual nitrogen). After three days of empty nitrogen culture, replace it with 5mM 15 After incubating for 5 hours in a solution of N-labeled potassium nitrate, the corn seedlings were removed and rinsed three times with a calcium sulfate solution, each rinse lasting 1 minute. The aboveground and underground parts were then separated and immediately placed in a 100°C oven for 1 hour. The seeds were then dried at 65°C, ground with a grinder, passed through a 100-mesh sieve, and sent to the Analytical and Testing Center of the Institute of Environmental Science and Engineering, Chinese Academy of Agricultural Sciences, for isotope content determination.

[0078] The formula of normal nutrient solution is: 4mM KNO3, 0.75 mM K2SO4, 0.65 mM MgSO4, 0.1 mM KCl, 0.25 mM KH2PO4, 0.001 mM H3BO3, 0.001 mM MnSO4·H2O, 0.0001 mM CuSO 4·5H2O, 0.0001 mM ZnSO4·7H2O, 0.000005 mM (NH4)6Mo7O24 and 0.2 mM Fe-EDTA.

[0079] The formula of nitrogen-free nutrient solution is: 0.75 mM K2SO4, 0.65 mM MgSO4, 0.1 mM KCl, 0.25 mM KH2PO4, 0.001 mM H3BO3, 0.001 mM MnSO4·H2O, 0.0001 mM CuSO 4·5H2O, 0.0001 mMZnSO4·7H2O, 0.000005 mM (NH4)6Mo7O24 and 0.2 mM Fe-EDTA.

[0080] The results are as follows Figure 5 As shown, visible, Zmllg3-1 and Zmllg3-2 right 15 The absorption and transport capacity of N-labeled nitrate were significantly higher than those of the wild type. Zmllg3-1 and Zmllg3-2 The nitrate absorption capacity of the wild-type materials increased by 4.5% and 6%, respectively; Zmllg3-1 and Zmllg3-2 The nitrate transport capacity of the wild-type material increased by 3.4% and 7%, respectively. Zmllg3 Gene mutation can improve corn's ability to absorb and transport nitrate, thereby improving corn's nitrogen utilization efficiency.

[0081] Example 4. ZmLLG3 Excellent haplotype mining of genes

[0082] To dig ZmLLG3 To identify superior haplotypes, we resequenced the ZmLLG3 genomic region of 100 maize inbred lines. We ultimately identified two distinct haplotypes, Hap1 and Hap2. Hap2 contains a 0.27 kb insertion between exons 3 and 4, while Hap1 lacks this insertion ( Figure 6 After removing one inbred line with an extreme outlier, gene expression analysis of inbred lines from different breeding years showed that Hap1 had a significantly lower expression level compared to Hap2 (p = 9.19×10⁻3; Figure 6 b) This example shows that Hap1, as an excellent haplotype, can reduce ZmLLG3 expression level, thereby improving the ability of corn to absorb and transport nitrogen and improving the nitrogen utilization efficiency of corn.

[0083] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A method for producing corn plants, characterized in that The maize plant has a phenotype of improved nitrogen use efficiency and / or increased number of lateral roots, and the method includes the steps of: Generating one or more maize plants in which the endogenous ZmLLG3 gene contains at least one loss-of-function mutation, or the expression of the endogenous ZmLLG3 gene is inhibited; Obtaining at least one seed of the maize plant generated in the previous step; The polynucleotide sequence of the ZmLLG3 gene is selected from one of the sequences in the following group: (a) The polynucleotide sequence shown in SEQ ID No: 1 or 2; or (b) The polynucleotide sequence whose encoded amino acid sequence is shown in SEQ ID No:

3.

2. The method according to claim 1, wherein the loss-of-function mutation includes substitution, deletion and / or addition of one or more nucleotides in the polynucleotide sequence of the gene; and the inhibition of the gene expression is in the form of RNA interference.

3. The method according to claim 2, wherein the loss-of-function mutation is obtained by physical mutagenesis, chemical mutagenesis, ZFN, TALEN and / or CRISPR / Cas gene editing technology, or obtained by hybridization with a maize plant having the loss-of-function mutation.

4. The method according to claim 3, wherein the CRISPR / Cas gene editing is CRISPR / Cas9 gene editing technology, and the target sequence used in the CRISPR / Cas9 is selected from one of the sequences in the following group: (Ⅰ) A fragment conforming to the sequence arrangement rule of 5'-Nx-NGG-3' in the nucleotide sequence shown in SEQ ID No: 1 or 2, where N represents any one of A, G, C and T, 14 < X < 30, and X is an integer, and Nx represents X consecutive nucleotides; or (Ⅱ) The nucleotide sequence complementary to the polynucleotide sequence described in (Ⅰ).

5. The method according to any one of claims 1-4, wherein the genomic nucleotide sequence after the loss-of-function mutation is shown in SEQ ID NO: 7 or 8.

6. Use of the method according to any one of claims 1-5 in improving the nitrogen use efficiency and / or increasing the number of lateral roots of maize plants.

7. A feed, meal, protein or oil product made from corn, characterized in that: The feed, meal, protein or oil product contains a loss-of-function mutant of the ZmLLG3 gene, the ZmLLG3 gene contains at least one loss-of-function mutation, and the polynucleotide sequence of the ZmLLG3 gene is selected from one of the sequences in the following group: (a) The polynucleotide sequence shown in SEQ ID No: 1 or 2; or (b) The polynucleotide sequence whose encoded amino acid sequence is shown in SEQ ID No:

3.

8. The feed, meal, protein or oil product according to claim 7, wherein the genomic nucleotide sequence of the loss-of-function mutation is shown in SEQ ID NO: 7 or 8.

Citation Information

Patent Citations

  • Application of ZmGLK63 and coding gene thereof in yield improvement and lodging resistance

    CN120174001A

  • Increasing leaf biomass and nitrogen use efficiency by regulating NTP2

    WO2024079137A1