CRISPR-mediated immortalized sheep fetal skin fibroblast cell line and application thereof

Abstract

The present application relates to a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line in the field of variation or genetic engineering and application thereof.The construction of the CRISPR-mediated immortalized sheep fetal skin fibroblast cell line of the present application comprises the following steps: step one, constructing a Cas9 site-directed knockout plasmid containing an FGF5 gene target sequence; step two, constructing a homologous repair plasmid Donor-2 kb HA-SV40LT containing an FGF5 gene homologous arm; step three, constructing a donor DNA containing an SV40LT protein expression frame; and step four, preparing a sheep fetal fibroblast cell line stably expressing SV40LT protein.The immortalized SFF-FGF5 / SV40LT monoclonal cell strain created by the present application can become an ideal tool cell line for genome editing researches such as sheep CRISPR library screening, multiple gene editing and mutation gene function exploration.

Description

Technical Field

[0001] This invention relates to a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line and its applications in the field of mutation or genetic engineering. Background Technology

[0002] The CRISPR / Cas9 system is an immune defense system widely found in the genomes of bacteria and archaea. These bacteria express the Cas9 protein, which has nucleic acid-cutting activity, and simultaneously transcribe CRISPR RNA (tracrRNA and crRNA). This RNA can pair complementaryly with the bacteriophage genome and guide the Cas9 protein to cleave it, thereby creating double-strand breaks in the foreign DNA, silencing the expression of foreign genes, and resisting the invasion of foreign genetic material such as bacteriophage viruses. In late 2012, Charpentier and Doudna's research group combined tracrRNA and crRNA into a single RNA, called single-stranded guide RNA (sgRNA). In vitro experiments showed that sgRNA can guide the Cas9 protein to complete the double-strand cleavage of the target DNA, thus simplifying the CRISPR / Cas9 system to two components: Cas9 protein and sgRNA, and proposing RNA-mediated CRISPR / Cas9 gene editing technology for the first time. In early 2013, Chinese scientist Feng Zhang first used CRISPR / Cas9 technology to achieve genome editing in eukaryotic cells, and CRISPR / Cas9 technology has since shone brightly. In 2016, David Liu's research group developed novel single-base editors, CBE (Cytosine base editors) and ABE (Adenine base editor), based on the CRISPR / Cas9 system, achieving free conversion of C·G--T·A and A·T--G·C base pairs, respectively. In 2017, Zhang Feng's research group developed a novel Cas13a gene editing system capable of editing at the RNA level. In 2019, David Liu's team developed a new precision gene editing tool, PE (Prime Editors), which can effectively achieve free conversion of all 12 single bases without additional DNA templates, and can also effectively achieve precise insertion and deletion of multiple bases. The emergence of CRISPR genome editing technology has brought about a major revolution in the life sciences field, greatly promoting the development of the entire life sciences industry.

[0003] CRISPR-mediated genome editing in sheep has broad application prospects in agriculture and biomedicine. For example, in improving productive traits, the Lian Zhengxing research group at China Agricultural University knocked out the FGF5 gene of myostatin and the FGF5 gene of fibroblast growth factor 5, cultivating a new sheep breed with high meat production, low fat deposition, and high fine wool production; the Li Menghua research group edited the TBXT gene of fine-wool sheep, obtaining short-tailed fine-wool sheep, creating valuable germplasm resources for breeding short-tailed fine-wool sheep. In improving reproductive performance, the Liu Mingjun research group at the Xinjiang Academy of Animal Sciences performed a 746-amino acid AG mutation editing on the FecB gene, a major gene regulating lambing in sheep, obtaining multiparous gene-edited sheep. In disease resistance breeding, the Liu Jun research group at Northwest A&F University successfully bred gene-edited sheep with enhanced mastitis resistance by directionally integrating the innate inflammation regulatory sequence (IRS) into the promoter region of the lysozyme (LYZ) gene. In the field of human disease models, Williams' group edited the TNSALP gene to obtain a gene-edited sheep model that mimics human hypoalkaline phosphatemia (HPP); Vilarino's group knocked out the PDX1 gene to obtain gene-edited sheep with a pancreatic absence phenotype similar to human PDX1 gene mutations; and Menchaca's group knocked the mutant Otoferlin gene into the sheep genome through CRISPR-mediated single-stranded homologous recombination repair to obtain a gene-edited sheep model that mimics human congenital deafness.

[0004] In sheep genome editing research, primary sheep fetal fibroblasts (SFFs) are the most commonly used tool cells due to their strong growth and division capabilities, ease of manipulation, and accessibility. They are also an important donor cell for preparing genetically modified live sheep using somatic cell cloning technology. However, they generally stop proliferating and die after a few passages (typically 15-30 passages, with signs of senescence appearing after 20 passages). Furthermore, the long isolation cycle and high cost of primary cells hinder the application of CRISPR gene editing technology in sheep. Artificially inducing SFFs into immortalized cells without altering their physiological characteristics would greatly facilitate genome editing research requiring large numbers of cells or long passages, such as CRISPR library screening, multiplex gene editing, and exploration of mutant gene function. It would also significantly facilitate routine genome editing research, including optimizing conditions for efficient transfection, gene knockout, gene knock-in, and point mutation, as well as validating or developing novel enzyme tools.

[0005] There are many methods to induce cell immortalization, and transfection overexpressing the SV40 large T antigen is a classic immortalization strategy applicable to various cell types. SV40 virus is simian vacuolating virus 40, and its genome is a circular double-stranded DNA encoding two tumor antigens (T antigens): a large T antigen (LT) with a molecular weight of 94,000 and a small T antigen with a molecular weight of 17,000. LT is essential for initiating cell transformation, and the maintenance of the transformed cell phenotype requires continuous expression of the large T antigen, mainly because LT can bind to cyclin p53 and PRb, reducing the inhibitory effect of these two proteins on cell proliferation. One of the most commonly used tool cell lines in cell biology, the human kidney epithelial cell line HEK293T, has achieved immortalization through the stable and random insertion of the SV40 LT antigen gene into its genome, and is therefore widely used in retroviral / lentiviral production, gene and protein expression, gene editing, and other research.

[0006] In the field of large animals such as pigs and cattle, the teams led by Wang Hui of Southwest University for Nationalities, Chen Shulin of Northwest A&F University, Si Youhui of Huazhong Agricultural University, and Li Xiaomin of Wuhan University of Light Industry have used lentivirus systems to insert the SV40 large T antigen gene into the genome of primary cells, constructing immortalized bovine intramuscular adipocytes, bovine corpus luteum cells, porcine lung fibroblasts, and porcine peritoneal mesothelial cells that still exhibit good viability after more than 50 passages in vitro. In the field of sheep, the teams led by Xiang Hua of Southwest University for Nationalities, Ding Guojie of Anhui Dongfang Diwei Biological Products Co., Ltd., Han Yanguo of Southwest University, and Yang Chunlei of Zhejiang University have also successfully obtained immortalized intramuscular adipocytes, testicular cells, pituitary cells, and rumen epithelial cells by infecting primary cells with lentiviruses carrying SV40LT.

[0007] Specifically regarding sheep fibroblasts, the team led by Shang Youjun at the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences successfully prepared an immortalized sheep fetal fibroblast cell line using the SV40LT / lentivirus system. However, all of these immortalization studies are based on the lentivirus system, and the integration of SV40LT into the genome is random. Randomly inserting exogenous genes may face risks such as: (1) epigenetic silencing, where genes are "forced to be silenced," resulting in the inability to express them; (2) insertional mutations, which disrupt the function of key genes in situ; and (3) unstable expression, which may be affected by surrounding regulatory elements (such as enhancers and insulators), leading to fluctuating expression levels. Furthermore, in CRISPR gene editing research at the cellular level, the genetic background of the tool cells should be as clear as possible. Therefore, creating an immortalized sheep fetal skin fibroblast cell line with high knock-in efficiency and a clear genetic background, based on the CRISPR gene editing system, that integrates SV40LT into a safe site in the sheep genome, has significant application value. Summary of the Invention

[0008] The main problem this invention aims to solve is the random insertion of exogenous genes in sheep immortalized cell line research based on SV40LT overexpression, providing a tool cell with high creation efficiency, safe integration site, and clear genetic background for sheep CRISPR gene editing research.

[0009] To address the aforementioned issues, this invention provides a safe FGF5 / sgRNA site for efficient and targeted knock-in of exogenous genes into the sheep genome, as well as a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line, its construction method, and its applications.

[0010] The method for constructing a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line provided by this invention includes the following steps:

[0011] Step 1: Construct a site-specific knockout plasmid for Cas9 containing the FGF5 gene target sequence;

[0012] Step 2: Construct the homology repair plasmid Donor-2 kb HA-SV40LT containing the FGF5 gene homology arm:

[0013] The upstream sequence of the FGF5 gene genome was designated as the left homologous arm, and the downstream sequence of the FGF5 genome was designated as the right homologous arm. The Donor-2 kb HA-SV40LT homologous repair plasmid was constructed by linking the four DNA fragments—the left homologous arm, the CMV-SV40LT-pA expression structure, the right homologous arm, and the pX330 plasmid—using seamless cloning technology.

[0014] The nucleotide sequence of the CMV-SV40LT-pA expression structure is positions 4747-7743 of SEQ ID No:4;

[0015] Step 3: Construct donor DNA containing the SV40LT protein expression cassette:

[0016] The Donor-2 kb HA-SV40LT plasmid obtained in step 2 was amplified by PCR using primers to obtain the donor DNA of the immortalized gene SV40LT expression cassette with 2 kb homologous arms on the left and right sides.

[0017] Step 4: Preparation of sheep fetal fibroblast cell lines stably expressing SV40LT protein at a specific site:

[0018] The donor DNA obtained in step three and the site knockout plasmid described in step one were co-transfected into sheep fetal fibroblasts to obtain an immortalized sheep fetal skin fibroblast cell line that can stably express SV40LT protein.

[0019] The FGF5 gene sequence (Gene ID: 100642180, updated: 2024.5.8) is 21877 bp in length and consists of 3 exons and 2 introns. Figure 1 (A)

[0020] A gene-targeting FGF5 / crRNA sequence (5'-aaatatttgctgtgtctcag-3') (SEQ ID No:1) was designed targeting exon 2 of the FGF5 gene.

[0021] Furthermore, the FGF5 / crRNA is formed by annealing primers crRNA-F (5'-caccgaaatatttgctgtgtctcag-3', SEQ ID No:2) and crRNA-R (5'-aaacctgagacacagcaaatatttC-3', SEQ ID No:3).

[0022] Furthermore, the site-specific knockout plasmid of Cas9 containing the FGF5 gene target sequence can be pX459-FGF5sgRNA or pX330-FGF5sgRNA.

[0023] The structure of the pX459-FGF5 sgRNA plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:1 (5'-aaatatttgctgtgtctcag-3') between the two BbsI restriction sites of the backbone vector pX459, while keeping the other sequences of the backbone vector pX459 unchanged.

[0024] The structure of the pX330-FGF5 sgRNA plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:1 (5'-aaatatttgctgtgtctcag-3') between the two BbsI restriction sites of the backbone vector pX330, while keeping the other sequences of the backbone vector pX330 unchanged.

[0025] The pX459-FGF5 sgRNA is used to detect the gene knockout efficiency of the FGF5 gene target site. The specific detection steps are as follows: transfect the pX459-FGF5 sgRNA plasmid into sheep fibroblasts, extract the genome, and then detect the knockout efficiency of FGF5 sgRNA by PCR amplification combined with TA cloning.

[0026] Furthermore, the construction method of the pX330-FGF5 sgRNA is as follows:

[0027] Step (1): Anneal the single-stranded DNA to form double-stranded DNA;

[0028] The DNA sequences shown in SEQ ID No:2 and SEQ ID No:3 were dissolved separately, then mixed and annealed in a PCR instrument to obtain an annealed mix;

[0029] Step (2): Digest pX330 plasmid with BbsI enzyme;

[0030] Step (3): The annealed Mix and the enzyme digestion product from step (2) are ligated using a T4 DNA ligase kit to obtain the site knockout plasmid pX330-FGF5 sgRNA described in step 1.

[0031] Furthermore, the sequence of plasmid Donor-2 kb HA-SV40LT described in step two is shown in SEQ ID No:4.

[0032] The present invention also provides the plasmid Donor-2 kb HA-SV40LT described above.

[0033] This invention also provides the site-directed knockout plasmids described above. The site-directed knockout plasmids are pX459-FGF5sgRNA and pX330-FGF5sgRNA.

[0034] This invention also provides the application of the method described above in the preparation of immortalized sheep fetal skin fibroblast cell lines.

[0035] This invention also provides the application of the method described above in improving the efficiency of targeted gene knock-in in immortalized sheep fetal fibroblasts.

[0036] This invention also provides an immortalized sheep fetal skin fibroblast cell line constructed using the methods described above.

[0037] This invention also provides the application of the immortalized sheep fetal skin fibroblast cell line described above in sheep gene editing research.

[0038] PCR detection at the 5' and 3' ends of the insertion site and Sanger sequencing verification showed that 8 out of 151 monoclonal cell lines successfully integrated the CMV-SV40LT-pA expression structure into the FGF5 site of their genome. This indicates that, under conditions without fluorescence enrichment and drug screening, the knock-in efficiency of the large exogenous gene SV40LT (2997 bp) was as high as 5.30% (8 / 151). The obtained SFF-FGF5 / SV40LT monoclonal cell lines showed successful SV40LT expression according to immunofluorescence results. Furthermore, these cell lines exhibited normal morphology, vigorous cell division, and were stably passaged for more than 60 generations.

[0039] Compared with existing technologies, the sheep genome integration target site (FGF5 / crRNA) provided by this invention can be used to efficiently create sheep monoclonal cell lines with exogenous gene knock-in based on the CRISPR system, which improves the preparation efficiency and shortens the preparation cycle.

[0040] The immortalized SFF-FGF5 / SV40LT monoclonal cell line created in this invention has the characteristics of normal cell morphology and high passage number, and in particular, it has the advantage of clear integration site / genetic background. It can become an ideal tool cell line for genome editing research such as sheep CRISPR library screening, multiplex gene editing, and exploration of mutant gene function. Attached Figure Description

[0041] Figure 1 This diagram illustrates the design of sgRNA at the sheep FGF5 locus, the related CRISPR plasmid structures, and the types of base knockout mutations in the FGF5 / sgRNA gene. A shows the location and sequence of sgRNA at the sheep FGF5 locus; B shows the structure of the commercial pX459 plasmid, with sgRNA, Cas9, and Puro co-expressed; C shows the structure of the commercial pX330 plasmid, with sgRNA and Cas9 co-expressed; and D shows the sgRNA knockout efficiency and mutation types at the FGF5 locus after transfection with the pX459-FGF5 sgRNA plasmid and enrichment with puromycin.

[0042] Figure 2 This document presents a schematic diagram of SV40LT gene knock-in, a statistical table of positive monoclonal clone preparation, related PCR detection and Sanger sequencing verification diagrams, and an immunofluorescence detection diagram of SV40LT gene knock-in positive cell lines. A shows a schematic diagram of the exogenous SV40LT large fragment gene knock-in into the FGF5 site of the sheep genome. B shows the statistical table of SV40LT gene knock-in positive monoclonal clone preparation; C shows the PCR positivity detection diagram of the 3' and 5' ends of monoclonal cell lines. 151 monoclonal cell lines to be tested were first screened for 3' end PCR positivity, and then the 5' end of the 10 detected 3' end positive monoclonal cell lines was further verified by PCR; D shows the Sanger sequencing diagram of the knock-in site in the SV40LT gene knock-in positive monoclonal cell lines; E shows the expression of the large T antigen in the immortalized SFF-FGF5 / SV40LT monoclonal cell lines detected by immunofluorescence.

[0043] Figure 3This diagram illustrates the application of the novel CRISPR enzyme CasMINI in evaluating gene knockout capabilities using the newly created SFF-FGF5 / SV40LT sheep immortalized cell line. A shows the structure of the CasMINI-Puro plasmid, with sgRNA, CasMINI, and Puro co-expressed. B is a schematic diagram of Cas9 and CasMINI gene knockout in the SFF-FGF5 / SV40LT sheep cell line, showing Cas9-HPRT sgRNA and CasMINI-HPRT sgRNA designed targeting exon 9 of the HPRT gene in the genome. C shows the knockout efficiency and mutation types of Cas9 sgRNA and CasMINI sgRNA at the HPRT site after transfection with pX459-HPRT sgRNA and CasMINI-Puro-HPRT sgRNA plasmids, respectively, followed by puromycin enrichment. Detailed Implementation

[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0046] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0047] The sheep primary fetal fibroblasts used in the following examples have been described in: Yan Li, Di Lian, Jiahao Wang, Yue Zhao, Yao Li, Guoshi Liu, Sen Wu, Shoulong Deng, Xuguang Du, and Zhengxing Lian; MDM2 antagonists promote CRISPR / Cas9-mediated precise genome editing in sheep primary cells; Molecular Therapy-Nucleic Acids; Vol. 31, 309-323. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0048] Example 1: CRISPR-mediated immortalized sheep fetal skin fibroblast cell line and its construction method

[0049] 1. Design of crRNA targeting the sheep FGF5 gene

[0050] Log in to the NCBI database (www.ncbi.nlm.nih.gov), search for and download the sheep FGF5 gene sequence (GeneID: 100642180, updated: 2024.5.8). The sheep FGF5 gene is 21877 bp in length and consists of 3 exons and 2 introns. Figure 1 (A). A 20 nt gene-targeting FGF5 / crRNA sequence was designed targeting exon 2 of the FGF5 gene: 5'-aaatatttgctgtgtctcag-3' (SEQ ID No:1) Figure 1 (A). Based on the designed FGF5 / crRNA, the corresponding primers were synthesized by Qingke Biotechnology (crRNA-F: 5'-caccgaaatatttgctgtgtctcag-3' (SEQ ID No: 2), crRNA-R: 5'-aaacctgagacacagcaaatatttC-3' (SEQ ID No: 3)). After synthesis, the primers were annealed to obtain an annealed mix containing crRNA.

[0051] The annealing system consisted of 1 μL upstream primer crRNA-F (100 μM), 1 μL downstream primer crRNA-R (100 μM), 1 μL T4 Ligation Buffer (10 ×), and 7 μL ddH2O. The annealing conditions were as follows: in a PCR instrument, 37 °C for 30 min, followed by cooling from 95 °C to 25 °C at a rate of 5 °C / min.

[0052] 2. The commercially available pX459 blank plasmid (addgene: Plasmid #48139) was digested with Bbs I endonuclease (NEB, R3539M). Figure 1 (B) and the commercially available pX330 blank plasmid (addgene: Plasmid #42230) Figure 1 The enzyme digestion conditions were as follows: metal bath at 37 ℃ for 3 h; the enzyme digestion system was: 20 μg pX459 or pX330, 10 μL Bbs I, 20 μL rCutSmart Buffer, and ddH2O added to 200 μL.

[0053] After enzyme digestion, gel electrophoresis was performed to verify whether the digestion was successful. Then, the enzyme digestion products were purified and recovered using a PCR product purification and recovery kit (Adley, DR0202) according to the instructions.

[0054] The annealed Mix containing crRNA from step 1 was ligated to Bbs I-digested pX459 and pX330 using T4 ligase (NEB, M0202S) to construct pX459-FGF5 sgRNA and pX330-FGF5 sgRNA gene knockout plasmids.

[0055] The ligation system consisted of: 1 μL annealing mix, 1 μL pX459 or pX330 digestion product, 1 μL T4 ligation buffer (10 ×), 1 μL T4 ligation, and 6 μL ddH2O. The ligation conditions were: overnight ligation in a metal bath at 16 ℃. Finally, the two ligation products were transformed using TOP 10 competent cells (Adley, CC0102) according to the manufacturer's instructions. After plating for 14 h, single clones were picked, and plasmids were extracted using a rapid plasmid extraction kit (Adley, PL0202). The extracted plasmids were sent to Nosei Gene sequencing to verify correct ligation. Subsequently, large-scale extraction of the two successfully constructed plasmids was performed using an endotoxin-free high-purity plasmid extraction kit (Adley, PL1301).

[0056] The structure of the pX459-FGF5 sgRNA plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No: 1 between the two BbsI restriction sites of the backbone vector pX459, while keeping the other sequences of the backbone vector pX459 unchanged.

[0057] The structure of the pX330-FGF5 sgRNA plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No: 1 between the two BbsI restriction sites of the backbone vector pX330, while keeping the other sequences of the backbone vector pX330 unchanged.

[0058] 3. pX459-FGF5 sgRNA plasmid was electrotransfected into sheep fetal fibroblasts.

[0059] Frozen sheep fetal fibroblasts were revived and cultured at 37 °C in a 5% CO2 incubator. The culture medium consisted of 89% DMEM / F12 basal medium (Gibco, 11320033), 10% FBS (Gibco, A5669701), and 1% penicillin-dextrose antibody (Gibco, 15070063). After growth stabilized, 1.5 × 10⁻⁶ cells were obtained by digestion with 0.25% trypsin (Gibco, 25200114). 6Cells, using Nucleofector TM 2B electroporator (Lonza, AAB-1001) and its matching electroporation reagent kit, Basic Nucleofector ® Using the Kit for Primary Mammalian Fibroblasts (Lonza, VPI-1002), 15 μg of pX459-FGF5 sgRNA plasmid (Puro-resistant) was electroporated into sheep fetal fibroblasts via the A033 electroporation program, followed by transfection into 6-well plates. After 48 h of electroporation, the cells were replaced with fresh medium containing 1000 ng / ml puromycin (Gibco, A1113803) and cultured further. After 72 h of drug screening, floating and dead cells were washed away with PBS (HyClone, SH30256.01B), and adherent cells were digested with 0.25% trypsin. Genomic DNA was then extracted from the electroporated cells enriched by drug screening using a genomic DNA extraction kit (Takara, 9765).

[0060] 4. Detection of gene knockout efficiency in sheep fetal fibroblasts

[0061] Gene knockout efficiency detection PCR primers (FGF5-TA-F: 5'-aaactcactgtaataaagaatgg-3', FGF5-TA-R: 5'-taaagtgctctgggcaaattgtc-3') were designed upstream and downstream of FGF5 / crRNA and sent to Qingke Biosynthesis.

[0062] Genomic DNA was amplified using PrimeSTAR Max DNA Polymerase (Takara, R045A). The amplification system consisted of 25 μL PrimeSTAR Max Premix (2 ×), 1 μL FGF5-TA-F, 1 μL FGF5-TA-R, 50 ng genomic DNA, and ddH2O to a final volume of 50 μL. The amplification program was as follows: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 59 ℃ for 15 s + 72 ℃ for 10 s (35 cycles), 72 ℃ for 2 min 30 s, and 4 ℃ to infinity. After amplification, the PCR products were directly ligated into a blunt-ended T-vector (Adelaide, CV2101), transformed with TOP 10 competent cells (Adelaide, CC0102), plated, and after 14 h, 35 single clones were picked and cultured. Plasmids were extracted using a rapid plasmid extraction kit and sent to Nosai Gene for Sanger sequencing. Figure 1 (D).

[0063] The results showed that 13 out of 35 monoclonal T vectors carried mutant fragments, meaning that the knockout efficiency of the designed FGF5 / sgRNA in the sheep genome was 37.14% (13 / 35).

[0064] 5. Construction of pSV40LT-N1 plasmid and Donor-2 kb HA-SV40LT homology repair plasmid

[0065] 1) Construction of pSV40LT-N1 plasmid

[0066] Primers were designed (SV40LT / OE-F: 5'-CACCGAgctcaagcttcgaattcatggataaagttttaaacagaga-3'; SV40LT / OE-R: 5'-ttatgatctagagtcgcggccgcttatgtttcaggttcagggggag-3'). The commercially available pBABE-puro SV40 LT plasmid (addgene: Plasmid #13970) was amplified by PCR. The amplification system was: 25 μL RimeSTAR Max Premix (2 ×), 1 μL SV40LT / OE-F, 1 μL SV40LT / OE-R, 1 ng pBABE-puroSV40 LT plasmid, and ddH2O added to a final volume of 50 μL. The amplification program was: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 65 ℃ for 15 s + 72 ℃ for 40 s. s (35cycle), 72 ℃ 2 min 30 s, 4 ℃ ∞.

[0067] After amplification, the SV40LT fragment (nucleotide sequence 5374-7500 of SEQ ID No:4) was purified and recovered using a PCR product purification and recovery kit (Adley, DR0202) in accordance with the instructions.

[0068] The commercially available pmCherry-N1 plasmid (Clontech, 632523) was digested with EcoRI (NEB, R3101S) and Not I (NEB, R3189S). The large backbone plasmid with the mCherry gene removed was recovered by gel excision using an agarose gel purification and recovery kit (Adley, DR0102). The SV40LT fragment was ligated to the large backbone plasmid with the mCherry gene removed using a seamless cloning kit (TransGold, CU101-02) according to the manufacturer's instructions to construct the pSV40LT-N1 plasmid containing the CMV-SV40LT-pA overexpression structure.

[0069] The structure of the pSV40LT-N1 plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment of sequence 4747-7743 of SEQ ID No:4 between the EcoRI and NotI restriction sites of the starting vector pmCherry-N1, while keeping the other sequences of the vector pmCherry-N1 unchanged.

[0070] Using a 3 bp interval upstream of the FGF5 / crRNA target site PAM (5'-aaatatttgctgtgtctcag-3'), the upstream 2 kb base sequence was designated as the left homologous arm, and corresponding primers Left HA-F / Left HA-R were designed. The downstream 2 kb base sequence was designated as the right homologous arm, and corresponding primers Right HA-F / Right HA-R were designed. The sheep genome was amplified using PrimeSTAR Max DNAPolymerase and the two designed primer pairs, yielding the left and right homologous arm fragments, respectively.

[0071] Left HA-F: 5'-TTGCTGGCCTTTTGCTCACATGTtttgtatctgtcattctacacat-3';

[0072] Left HA-R: 5'-gaccccgtaattgattactattaagacacagcaaatatttccaaaa-3',

[0073] Left HA-F: 5'-tccaaactcatcaatgtatcttacaggggattgtaggaatacgagg-3';

[0074] Left HA-R: 5'-TCACTAGGGGTTCCTGCGGCCGCcttttagcctgccaagatgagaa-3'.

[0075] Simultaneously, corresponding PCR primers were designed and the pSV40LT-N1 plasmid (SV40LT-F: 5'-taatagtaatcaattacggggtc-3'; SV40LT-R: 5'-taagatacattgatgagtttgga-3') constructed in step 1) was amplified using PrimeSTAR Max DNA Polymerase to obtain the CMV-SV40LT-pA expression structure (nucleotide sequence is 4747-7743 of SEQ ID No:4).

[0076] Design corresponding PCR primers to amplify commercially available pX330 (pX330 / GJ-F: 5'-GCGGCCGCAGGAACCCCTAGTGA-3'; pX330 / GJ-R: 5'-ACATGTGAGCAAAAGGCCAGCAA-3') to obtain the pX330 backbone plasmid.

[0077] The amplification system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL upstream primer, 1 μL downstream primer, 50 ng sheep genome or 1 ng pSV40LT-N1 plasmid or 1 ng pX330 plasmid, and ddH2O added to 50 μL; the amplification program was as follows: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 62 ℃ for 15 s + 72 ℃ for 30 s (35 cycles), 72 ℃ for 2 min 30 s, and 4 ℃ ∞.

[0078] After amplification, four PCR products were recovered using a PCR product purification and recovery kit. Then, using a seamless cloning kit (TransGold, CU101-02), the left homologous arm fragment, the CMV-SV40LT-pA expression structure, the right homologous arm fragment, and the pX330 backbone plasmid were sequentially ligated according to the manufacturer's instructions. After transformation, plating, culture, and plasmid extraction, the constructed Donor-2 kb HA-SV40LT homology repair plasmid was sent to Nosei Gene for sequencing verification.

[0079] The nucleotide sequence of the Donor-2 kb HA-SV40LT homology repair plasmid is SEQ ID No:4. In SEQ ID No:4, positions 2747-4746 are the left homology arm sequence, positions 4747-7743 are the CMV-SV40LT-pA expression structure, positions 7744-9743 are the right homology arm sequence, and positions 1-2746 are the pX330 backbone plasmid sequence.

[0080] 6. Preparation of CMV-SV40LT-pA donor templates with 2kb homologous arms on both sides

[0081] Design upstream and downstream primers (Donor-F: 5'-tttgtatctgtcattctacacat-3'; Donor-R: 5'-cttttagcctgccaagatgagaa-3') to amplify the Donor-2 kb HA-SV40LT plasmid by PCR.

[0082] The amplification system consisted of 25 μL PrimeSTAR Max Premix (2×), 1 μL Donor-F, 1 μL Donor-R, 1 ng Donor-2 kb HA-SV40LT plasmid, and ddH2O to a final volume of 50 μL. The amplification program was as follows: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 65 ℃ for 15 s + 72 ℃ for 1 min 20 s (35 cycles), 72 ℃ for 2 min 30 s, and 4 ℃ to infinity. After amplification, the CMV-SV40LT-pA donor template was recovered using a PCR product purification and recovery kit.

[0083] 7. Preparation of CMV-SV40LT-pA site-directed knock-in sheep monoclonal cell line

[0084] A schematic diagram of gene knock-in is shown below. Figure 2 As shown in Figure A. Digestion yielded 1.5 × 10⁻⁶. 6 Cells were electroporated using a Lonza electroporator and its accompanying reagents (A033 program). 12 μg of the pX330-FGF5 sgRNA gene targeting plasmid and 6 μg of CMV-SV40LT-pA donor template (both 2kb homologous arms) were injected into SFF cells. After 48 h of electroporation, BD FACSAria was used. TM The flow cytometer sorted single cells into six 96-well plates (each well containing 79% DMEM / F12 + 20% FBS + 1% triple antibody). After 10 days of incubation, 210 single colonies were observed under a microscope, with a colony formation rate of 27.34% (210 / 768). Figure 2 (B)

[0085] 151 healthy monoclonal cell lines were selected and digested with 0.25% trypsin. Half of the cells were transferred to 48-well plates for further culture, while the other half were lysed using cell lysis buffer (2 ml Tris-HCl (1 M, pH 8.0), 0.45 ml Triton X-100, 0.45 ml NP-40, 0.02 g proteinase K, dissolved in ddH2O and brought to a final volume of 50 ml). The lysis program was: 65 °C for 30 min, 65 °C for 15 min, and 4 °C indefinitely.

[0086] Detection primers for the 5' and 3' ends of positive monoclonal cell lines were designed at the upstream of the left homologous arm of the genome / homology repair template promoter, and at the pA site of the homologous repair template / downstream of the right homologous arm of the genome (5' / Dection-F: gtcttgacctcttaaatgttaac; 5' / Dection-R: ccgtaagttatgtaacgcggaac; 3' / Dection-F: cactgcattctagttgtggtttg; 3' / Dection-R: agacagtgggcttggacaattgg). The amplification system was as follows: 25 μL RimeSTAR Max Premix (2 ×), 1 μL 5' / Dection-F or 3' / Dection-F, 1 μL 5' / Dection-R or 3' / Dection-R, 5 μL cell lysis buffer, and ddH2O added to a final volume of 50 μL; the amplification program was: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 53 ℃ (5' end) / 62℃ (3' end) 15 s + 72 ℃ 40 s (35 cycles), 72 ℃ 2 min 30 s, 4℃∞.

[0087] After PCR amplification, run a gel electrophoresis to observe the band size. Figure 2 (C), and the remaining PCR products were sent to Nosai Gene for Sanger sequencing detection (C). Figure 2 (D) The results showed that among the 151 cell lines tested, 8 monoclonal cell lines successfully inserted the exogenous SV40LT gene into the FGF5 locus of their genome, with a knock-in efficiency of 5.30%. Figure 2 (B)

[0088] 8. Immunofluorescence verification of positive cell lines

[0089] One monoclonal cell line with vigorous growth and normal cell shape was selected from eight positive cell lines and named SFF-FGF5 / SV40LT. Immunofluorescence verification was performed on this cell line, with wild-type SFF as the control. After fixation, permeabilization, blocking, binding of SV40LT primary antibody (Abcam, AB2344276), binding of secondary antibody (Beyotime, A0423), DAPI staining (Beyotime, C1006), and mounting, fluorescence microscopy results showed that SV40LT protein was successfully expressed in the positive cell line. Figure 2 (E). Continuous passage culture was carried out, and the cell line has now been successfully passaged to the 60th generation, indicating that the CRISPR-mediated immortalized sheep fetal skin fibroblast cell line has been successfully constructed.

[0090] Example 2: Application of CRISPR-mediated immortalized sheep fetal skin fibroblast cell line

[0091] 1. Construction of CasMINI-Puro plasmid co-expressing CasMINI, sgRNA, and Puro

[0092] First, the gene sequences of CasMINI and U6 / tracrRNA (containing two BsmBI restriction sites) were synthesized by the company and then cloned into the pUC57 backbone plasmid (Qingke Biotechnology) to obtain pUC57-CasMINI and pUC57-U6 / tracrRNA.

[0093] Subsequently, primers hU6-F (5'-ttaccgccatgcattagttatTAATgagggcctatttcccatgatt-3') and hU6-R (5'-ccccgtaattgattactattaATaaaaaaaagagacgatatatcgt-3') were designed. The pUC57-U6 / tracrRNA plasmid was amplified using PrimeSTARMax DNA Polymerase (Takara). The system was as follows: 25 μL PrimeSTARMax Premix (2 ×), 1 μL hU6-F, 1 μL hU6-R, 1 ng pUC57-U6 / tracrRNA, 22 μL ddH2O. The amplification program was as follows: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 62 ℃ for 15 s + 72 ℃ for 10 s (35 cycles), 72 ℃ for 2 min 30 s, 4 ℃... After amplification, the PCR product was recovered using a DNA purification kit (Tiangen, DP205). At the same time, the commercially available pEGFP-N1 plasmid (Clontech, 60851) was digested with AseI (NEB, R0526S). The digested product was then recovered using a DNA purification kit (Tiangen, DP205).

[0094] Using the Seamless Cloning Kit (TransGold, CU101-02), the U6 / tracrRNA fragment was ligated into the single-enzyme-digested pEGFP-N1 backbone plasmid according to the manufacturer's instructions to form the pEGFP-N1-U6 / tracrRNA plasmid.

[0095] The structure of the pEGFP-N1-U6 / tracrRNA plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:5 between the AseI restriction sites of the starting vector pEGFP-N1, while keeping the other sequences of the vector pEGFP-N1 unchanged.

[0096] Finally, primers CasMINI-Gibson-LF: 5'-tctcgagctcaagcttcgaattcgccaccatgggacccaagaaaaac-3' and CasMINI-Gibson-MR: 5'-tgccctctccactgccgaattcgtctagtttaacgcgtttggca-3', as well as primers CasMINI-Gibson-MF: 5'-gaattcggcagtggagagggca-3' and CasMINI-Gibson-RR: 5'-tgattatgatctagagtcgcggccgctcaggcaccgggcttgcgggtc-3' were designed.

[0097] The pUC57-CasMINI plasmid and the commercially available pX459 plasmid were amplified using PrimeSTAR Max DNA Polymerase (Takara), respectively. The system was as follows: 25 μL PrimeSTAR Max Premix (2 ×), 1 μL CasMINI-Gibson-LF or CasMINI-Gibson-MF, 1 μL CasMINI-Gibson-MR or CasMINI-Gibson-RR, 1 ng pUC57-CasMINI or pX459 plasmid, and 22 μL ddH2O. The amplification program was as follows: 98 ℃ for 1 min 30 s, 98 ℃ for 10 s + 62 ℃ for 15 s + 72 ℃ for 30 s (CasMINI fragment, 35 cycles) or 72 ℃ for 15 s (T2A-Puro fragment, 35 cycles), 72 ℃ for 2 min 30 s, and 4 ℃ ∞.

[0098] After amplification, the two PCR products were recovered using a DNA purification kit (Tiangen, DP205). Using a seamless cloning kit (TransGen, CU101-02), the CasMINI fragment and the T2A-Puro fragment amplified from the commercial pX459 plasmid were ligated into the pEGFP-N1-U6 / tracrRNA plasmid, which had been double-digested with EcoRI (NEB, R3101S) and NotI (NEB, R3189S), to construct the CasMINI-Puro plasmid, which co-expresses CasMINI, sgRNA, and Puro. Figure 3 (A)

[0099] The structure of the CasMINI-Puro plasmid is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:6 between the EcoRI and NotI restriction sites of the starting vector pEGFP-N1-U6 / tracrRNA, while keeping the other sequences of the vector pEGFP-N1-U6 / tracrRNA unchanged.

[0100] 2. Construction of HPRT gene knockout plasmids in sheep using Cas9 and CasMINI systems

[0101] Cas9 HPRT sgRNA (5'-gtgtgtgtcattagcgaaac-3') and CasMINI HPRT sgRNA (5'-tagcacgtgtgtgtcattagcga-3') were designed targeting exon 9 of the HPRT gene in the sheep genome, respectively. Figure 3 As shown in B.

[0102] The primers for constructing the pX459-HPRT sgRNA gene knockout plasmid (Cas9 HPRT sgRNA-F: 5'-caccggtgtgtgtcattagcgaaac-3', SEQ ID No:7; Cas9 HPRT sgRNA-R: 5'-aaacgtttcgctaatgacacacacc-3', SEQ ID No:8) and the primers for constructing the CasMINI-Puro-HPRT sgRNA gene knockout plasmid (CasMINI HPRT sgRNA-F: 5'-GCAACtagcacgtgtgtgtcattagcga-3', SEQ ID No:9; CasMINI HPRT sgRNA-R: 5'-aaaatcgctaatgacacacacgtgctaG-3', SEQ ID No:10) were sent to the company for synthesis.

[0103] According to the method described in step 2 of Example 1, the annealed products were ligated into the pX459 plasmid digested with BbsI (NEB, R3539M) and the CasMINI-Puro plasmid digested with BsmBI (NEB, R0739S), respectively, to obtain pX459-HPRT sgRNA and CasMINI-Puro-HPRT sgRNA gene knockout plasmids.

[0104] The structure of pX459-HPRT sgRNA is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:11 between the BbsI restriction sites of the starting vector pX459, while keeping the other sequences of the vector pX459 unchanged.

[0105] The structure of CasMINI-Puro-HPRT sgRNA is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:12 between the two BsmBI restriction sites of the starting vector CasMINI-Puro, while keeping the other sequences of the vector CasMINI-Puro unchanged.

[0106] 3. Comparison of gene knockout efficiency between Cas9 and CasMINI systems

[0107] Using an endotoxin-free plasmid large-scale extraction kit (Tiangen, DP117), pX459-HPRT sgRNA and CasMINI-Puro-HPRT sgRNA gene knockout plasmids were extracted. Following the method described in step 3 of Example 1, 15 μg of pX459-HPRT sgRNA plasmid and 15 μg of CasMINI-Puro-HPRT sgRNA plasmid were electroporated into the SFF-FGF5 / SV40LT sheep tool cell line. After selection for resistance with 900 ng / μL puromycin (Gibco, A1113803), detection primers HPRT Dection-F: 5'-ctggaggcaggaatctggagaat-3'; HPRT Dection-R: 5'-gaatgagaacattggatcatgtc-3' were designed upstream and downstream of the HPRT gene target site. Following the method described in step 4, the Cas9 and CasMINI gene knockout efficiency was detected.

[0108] The results showed that the gene knockout efficiency of the classic Cas9 system was 8.00% (4 / 50), while that of the CasMINI system was 5.88% (2 / 34). Figure 3 The difference between the two is not significant, indicating that the novel gene editing tool enzyme CasMINI has similar gene editing capabilities at the sheep HPRT site as the classic gene editing tool enzyme Cas9.

[0109] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method of construction of a CRISPR-mediated immortalized sheep fetal skin fibroblast cell line, characterized in that, It comprises the following steps: Step one, constructing a Cas9 site-specific knockout plasmid containing FGF5 gene target sequence; The construction method of the site-specific knockout plasmid is as follows: Step (1), annealing single-stranded DNA to form double-stranded DNA; dissolving the DNA primers shown as SEQ ID No: 2 and SEQ ID No: 3 respectively, then mixing and placing in a PCR instrument for annealing to obtain annealing Mix; Step (2), single enzyme digestion of pX330 plasmid with BbsI; Step (3), carrying out a ligation reaction on the annealing Mix and the enzyme digestion product of step (2) with T4 DNA ligase to obtain the site-specific knockout plasmid of step one; Step two, constructing a homologous repair plasmid Donor-2 kb HA-SV40LT containing FGF5 gene homologous arm: The genomic upstream sequence of the FGF5 gene is set as the left homologous arm, and the genomic downstream sequence of the FGF5 gene is set as the right homologous arm; the homologous repair plasmid Donor-2 kb HA-SV40LT is constructed by connecting the left homologous arm, CMV-SV40LT-pA expression structure, right homologous arm and pX330 plasmid through seamless cloning technology; The nucleotide sequence of the CMV-SV40LT-pA expression structure is 4747-7743 of SEQ ID No: 4; The sequence of the homologous repair plasmid Donor-2 kb HA-SV40LT is shown as SEQ ID No: 4; Step three, constructing a donor DNA containing SV40LT protein expression frame: The homologous repair plasmid Donor-2 kb HA-SV40LT obtained in step two is subjected to PCR amplification with primers to obtain a 2 kb immortalization gene SV40LT expression frame donor DNA with left and right homologous arms; Step four, preparation of a sheep fetal fibroblast cell line stably expressing SV40LT protein: The donor DNA obtained in step three and the site-specific knockout plasmid of step one are co-transfected into sheep fetal fibroblast cells to obtain an immortalized sheep fetal skin fibroblast cell line stably expressing SV40LT protein.

2. The use of the method of claim 1 in the preparation of an immortalized sheep fetal skin fibroblast cell line.

3. The use of the method of claim 1 in improving the site-specific knock-in efficiency of a target gene in an immortalized sheep fetal fibroblast cell.

4. An immortalized sheep fetal skin fibroblast cell line constructed by the method of claim 1.

5. The use of the immortalized sheep fetal skin fibroblast cell line of claim 4 in sheep gene editing research.

Images